ID: 1127074522

View in Genome Browser
Species Human (GRCh38)
Location 15:55312237-55312259
Sequence CGGCAAACAACAGGGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 3, 2: 67, 3: 131, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127074510_1127074522 24 Left 1127074510 15:55312190-55312212 CCCTGCTGGATCCGGAGGGATGG 0: 20
1: 71
2: 130
3: 138
4: 219
Right 1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG 0: 1
1: 3
2: 67
3: 131
4: 179
1127074514_1127074522 13 Left 1127074514 15:55312201-55312223 CCGGAGGGATGGAAGTCAGCGGC 0: 22
1: 88
2: 109
3: 75
4: 146
Right 1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG 0: 1
1: 3
2: 67
3: 131
4: 179
1127074512_1127074522 23 Left 1127074512 15:55312191-55312213 CCTGCTGGATCCGGAGGGATGGA 0: 12
1: 72
2: 118
3: 157
4: 197
Right 1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG 0: 1
1: 3
2: 67
3: 131
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127074522 Original CRISPR CGGCAAACAACAGGGGTGGA CGG Intronic
900315111 1:2052438-2052460 GGGAAAACAACAGGGAAGGAGGG - Intronic
902043890 1:13511568-13511590 CAACCAACAACAGGGGTGAATGG + Intronic
903372748 1:22847461-22847483 CTGGACACAACAGGGGAGGAAGG + Intronic
903667336 1:25016087-25016109 CCGCAAACAACTGGGCAGGAAGG - Intergenic
903859045 1:26354253-26354275 AGGCAAGCACCAGGGGAGGAGGG - Intergenic
904535949 1:31199510-31199532 CCGCAGACAACAGAGCTGGAAGG + Intronic
906116912 1:43363314-43363336 CCACAAACAAGAGGGATGGATGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919669372 1:200324952-200324974 AGGCAAACAACAGGATTGAATGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1074119055 10:110479759-110479781 AGGCAAAAACCAGGGGTGGCTGG - Intergenic
1074578119 10:114690062-114690084 CTGCAAGCAAATGGGGTGGAGGG + Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076813697 10:132903258-132903280 TGGCAGAAAACAGGGATGGAGGG - Intronic
1078630337 11:12997302-12997324 CAGCAAACAATAGAGCTGGAGGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1083434128 11:62631050-62631072 CGGAAAACATCAGAGATGGAGGG + Exonic
1084684054 11:70683409-70683431 CGGCAAGTTCCAGGGGTGGAAGG - Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086064362 11:82731297-82731319 CAGAAACCAACAGAGGTGGAAGG + Exonic
1086579317 11:88379139-88379161 AGGAAAACAACAGGGTTGGCAGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089440296 11:118510379-118510401 TGGCAAAAAACAAGGCTGGAGGG - Intronic
1090263248 11:125337927-125337949 AGACAACCAACAGAGGTGGAAGG - Intronic
1091974918 12:4816782-4816804 CGGTAAACAAAAGAAGTGGACGG + Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096754668 12:53789066-53789088 CAGCCAAGATCAGGGGTGGAAGG - Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1097882353 12:64697974-64697996 AGGGCAAGAACAGGGGTGGAGGG - Intergenic
1098462787 12:70751324-70751346 TGGCATAGAACAGGGGTGGGTGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1105727260 13:23176811-23176833 AGGTAAACAACAAGGGAGGAAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113318758 13:109211998-109212020 CAACAAACAAAAGGGTTGGAGGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114896256 14:26994545-26994567 CAGAAAACAACAGAGGTGGCTGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116549758 14:46221940-46221962 TTGCAAAAAACAGGGGAGGAAGG + Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118843016 14:69526881-69526903 CGGTAAAGTGCAGGGGTGGAAGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1122688180 14:103519779-103519801 CGGCGAACATCAGGGGTGCATGG + Exonic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123220508 14:106851262-106851284 CGGGAAAGAACTGGAGTGGATGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127647618 15:60974114-60974136 CTGCAGACAACAGAGGAGGAGGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128980392 15:72181178-72181200 TGGTAAACAACAAGGCTGGAGGG + Intronic
1129455731 15:75675416-75675438 CTGGAGACACCAGGGGTGGAGGG - Exonic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130269819 15:82440369-82440391 CGGAAGACACCTGGGGTGGATGG - Intergenic
1130462158 15:84167670-84167692 CGGAAGACACCTGGGGTGGATGG - Intergenic
1130473778 15:84246593-84246615 CGGAAGACACCTGGGGTGGATGG - Intergenic
1130481193 15:84360657-84360679 CGGAAGACACCTGGGGTGGATGG - Intergenic
1130490519 15:84427103-84427125 CGGAAGACACCTGGGGTGGATGG + Intergenic
1130502107 15:84505873-84505895 CGGAAGACACCTGGGGTGGATGG + Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132420435 15:101661306-101661328 AGGCAAACAATATGGGTTGAAGG + Intronic
1133737494 16:8627067-8627089 AGGCAAGCAACAGAGGTGGCTGG - Intronic
1135017211 16:18933849-18933871 CAGCAAACATCAGGGATGGAAGG + Intergenic
1136867816 16:33770674-33770696 CGGCAAAAAACAGCGGCGGCGGG - Intergenic
1138448524 16:57079226-57079248 CGGAAAACAACCTGGCTGGAGGG + Exonic
1138924200 16:61570600-61570622 TGGCAAAGAACATGGGTGCAGGG + Intergenic
1140109658 16:71992822-71992844 CGGCAATCAATATCGGTGGATGG - Intronic
1140346848 16:74221480-74221502 CTGCAAACAAATGGGGTGGAGGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141705410 16:85661851-85661873 AGGCAAAAAGCAGGAGTGGACGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1203104351 16_KI270728v1_random:1345574-1345596 CGGCAAAAAACAGCGGCGGCGGG + Intergenic
1203129163 16_KI270728v1_random:1616794-1616816 CGGCAAAAAACAGCGGCGGCGGG - Intergenic
1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG + Intergenic
1148239366 17:45989971-45989993 GGGCACACAGCAGGGCTGGAGGG - Exonic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148698952 17:49576760-49576782 AGGAAAACAACAGGCGGGGAGGG - Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149479392 17:56990198-56990220 CGGCAAACAAAAGGGTTAGAAGG + Intronic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152839774 17:82559670-82559692 CTGCAAACAAGGGGGGTGGGTGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157596769 18:48868965-48868987 AGGCAAACAAAATGGGTGGGAGG + Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1161580856 19:5080052-5080074 CGGCAGAAAATAGGGGTGGGGGG - Intronic
1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168663754 19:58186788-58186810 AAGCCAACAACAGGGATGGATGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
926429776 2:12773976-12773998 CTTCAAACAACAGGGTTTGATGG - Intergenic
927339300 2:21963332-21963354 CAGCAACCAACAGAGATGGAAGG + Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927861180 2:26561249-26561271 CTGCAAACAAACTGGGTGGAAGG - Intergenic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933038770 2:77433745-77433767 ACACAAACAACAGGAGTGGAAGG + Intronic
933515841 2:83300501-83300523 CAGCAAACTACAGGTGTTGAGGG + Intergenic
933940173 2:87238683-87238705 CTGCAACCAGCAGGGGTGAAAGG - Intergenic
934927130 2:98389773-98389795 AGGTAAGCGACAGGGGTGGAAGG + Exonic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936249802 2:110859682-110859704 CTGCAAACAAGAGGGTTGGATGG + Intronic
936352966 2:111727095-111727117 CTGCAACCAGCAGGGGTGAAAGG + Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
942265306 2:174218750-174218772 CAGCAAACCCCAGGGGTGGGAGG + Intronic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
947394884 2:229676588-229676610 TGGCAGAAAACAGGGATGGATGG - Intronic
948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG + Exonic
1169575813 20:6959764-6959786 CGACAAAAAATAGGGGTGGTAGG - Intergenic
1171239031 20:23550490-23550512 CGGCAAACTCCAGGGTGGGAGGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173065220 20:39704114-39704136 GGGGAAACAAGAGGGGTGAAGGG + Intergenic
1173539684 20:43842268-43842290 CTGCAGACAGCAGGGGTAGATGG - Intergenic
1174810725 20:53643325-53643347 CGTCTAACACCAGGGCTGGAAGG + Intergenic
1174857642 20:54061877-54061899 TGGCAAAGAACAGCGGTGGCTGG + Intronic
1176085297 20:63293076-63293098 CGGCAGACAGGAAGGGTGGAGGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178535985 21:33410963-33410985 TGGGAAACACCAGGGCTGGAAGG - Intronic
1179005178 21:37507663-37507685 GGGCAAAGAAAAGGGGTGGGGGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1182747525 22:32616977-32616999 GGGCCAACCACAGGGATGGAAGG + Intronic
1184847805 22:47099910-47099932 TGTCAAACACCAGGGCTGGAAGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951591925 3:24275670-24275692 CGGCAAAAACCAGAGTTGGATGG - Intronic
952653742 3:35758631-35758653 TGGCAAACAGCAGGGCTGAAGGG - Intronic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG + Intergenic
966302290 3:178493236-178493258 CTGCAAGCAAATGGGGTGGAGGG + Intronic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978046040 4:104128924-104128946 AGGCAAACAACTGTGGAGGATGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984036285 4:174672259-174672281 AGAAAAACAAGAGGGGTGGAAGG - Intronic
986435036 5:7721046-7721068 CAGGAAACAACAGGTGTTGAAGG - Intronic
987141539 5:14951796-14951818 AGGGAGACATCAGGGGTGGAGGG - Intergenic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988619231 5:32805339-32805361 CAGCAGGCAACAGGGGTGAAAGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993059824 5:83025845-83025867 GGGCAAAGAACAGGGCTGGCCGG + Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
998368492 5:141646202-141646224 AGGCAGAGAACAGGGGTGGGTGG + Intronic
998467952 5:142360953-142360975 CAGCAAACAAGAGCGGAGGAGGG + Intergenic
1000202341 5:159023882-159023904 GGGCAAACAGGAGGAGTGGAAGG + Intronic
1001703053 5:173721300-173721322 CGGGAAACATTAGGGGTGCATGG - Intergenic
1003300419 6:4876120-4876142 CAACAAACAACAAGGGTGGGAGG - Intronic
1003628036 6:7761537-7761559 CTGGAGCCAACAGGGGTGGATGG + Intronic
1003693687 6:8380196-8380218 AGGAAAATAAAAGGGGTGGAGGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005333589 6:24771974-24771996 CGGCAAAAGACAGGAATGGACGG - Intergenic
1005355268 6:24977041-24977063 CTGCAAGCAAATGGGGTGGAGGG - Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1007029062 6:38610901-38610923 CTGCAAAAAACCGGGGTGGGGGG + Intronic
1007910965 6:45513660-45513682 AGGGAAAGAAGAGGGGTGGAGGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1010130619 6:72489159-72489181 TGACACAAAACAGGGGTGGAGGG - Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011241822 6:85279799-85279821 CAGGAAAAAACAGGGGAGGAGGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013507348 6:110814402-110814424 GGGCATACAACAGGGATGGGAGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1019850455 7:3551171-3551193 CGGCCAACACCGGGGGTGGGGGG + Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032480068 7:132239150-132239172 TGGAAGAAAACAGGGGTGGATGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1036137884 8:6179073-6179095 CAGCAAACAGAAGGGGTTGAAGG - Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046726908 8:117685635-117685657 CTGCAAACAACTGGGGAAGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1050113680 9:2241902-2241924 TTGCACACACCAGGGGTGGAGGG - Intergenic
1051546693 9:18283567-18283589 CTGCAAACCACAGTGGTTGAAGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1058399308 9:104595315-104595337 AGGCAAAAAACAGGTGTGCAGGG - Intergenic
1059377557 9:113897612-113897634 AGGCAAACAATAGGGGTATATGG - Intronic
1186317534 X:8386958-8386980 TGGCAAAAGAAAGGGGTGGAGGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188897739 X:35689852-35689874 TGGCAAAAAACATGGGTGGGGGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194456260 X:94107393-94107415 AGCCAGACAAAAGGGGTGGATGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200061617 X:153486297-153486319 TGGCAACCAAGATGGGTGGATGG - Intronic
1200182487 X:154159260-154159282 CGGCAAGCAAGAGCTGTGGAGGG + Intergenic
1200188141 X:154196374-154196396 CGGCAAGCAAGAGCTGTGGAGGG + Intergenic
1200193791 X:154233514-154233536 CGGCAAGCAAGAGCTGTGGAGGG + Intergenic
1200199546 X:154271318-154271340 CGGCAAGCAAGAGCTGTGGAGGG + Exonic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1202377122 Y:24247462-24247484 CGGAAGACACCTGGGGTGGAGGG + Intergenic
1202493658 Y:25422659-25422681 CGGAAGACACCTGGGGTGGAGGG - Intergenic