ID: 1127076106

View in Genome Browser
Species Human (GRCh38)
Location 15:55327434-55327456
Sequence AAGCTGATCCAACTATCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127076106 Original CRISPR AAGCTGATCCAACTATCTAT GGG (reversed) Intronic
918641573 1:186847480-186847502 AAGCTGGTTCACCTATGTATTGG + Intronic
1064486196 10:15793315-15793337 AAACTGAGCCAATTATCTAGAGG + Intronic
1065155184 10:22862388-22862410 AGGCTGGTCCAACTCTTTATGGG - Intergenic
1067396988 10:45930064-45930086 AAGTTGATTAAACTGTCTATAGG + Intergenic
1067865301 10:49899165-49899187 AAGTTGATTAAACTGTCTATAGG + Intronic
1074395836 10:113097251-113097273 AAGCTGCTCCTACTTTCTAGTGG - Intronic
1086499240 11:87435333-87435355 CAGTTGATCCAACTATCCCTTGG - Intergenic
1087096256 11:94321575-94321597 TAGCTGATATAACTATCTTTTGG - Intergenic
1095060282 12:37680170-37680192 AAGGTGCTCCAAATATCCATTGG + Intergenic
1095460292 12:42436460-42436482 AACCAGAACCAACTATCAATAGG - Intronic
1095829139 12:46564676-46564698 AAACTAATCCACGTATCTATAGG - Intergenic
1099673980 12:85733090-85733112 CAACTGATTCAAATATCTATTGG - Intergenic
1106931033 13:34665582-34665604 AAGTTGATCCAGTTATATATAGG - Intergenic
1115741481 14:36393729-36393751 GAGAGGATCCAACTATCCATTGG - Intergenic
1116500804 14:45618634-45618656 CAGGTAATCCAACTATCCATTGG + Intergenic
1117454411 14:55883392-55883414 ATGCTGATGCAGCTATCCATGGG - Intergenic
1127076106 15:55327434-55327456 AAGCTGATCCAACTATCTATGGG - Intronic
1127505249 15:59591746-59591768 ACGCTGATCCAATTATACATGGG - Intergenic
1131909600 15:97182996-97183018 AATCTGATCCAACTGCCTACTGG + Intergenic
1135812803 16:25604881-25604903 ATTCTGATCCAAGGATCTATTGG - Intergenic
1141009716 16:80386223-80386245 AAGGTGGTCCTACTAGCTATGGG + Intergenic
1145085603 17:19936601-19936623 AAGTTGACCCAACTATCTCTGGG - Intronic
1146507043 17:33414453-33414475 AAGCTGAGCAGGCTATCTATTGG + Intronic
1149774122 17:59343969-59343991 AAGCAGAACCAACTGTCTAGGGG + Intronic
1149814449 17:59709076-59709098 AAACTGATTTAACTAGCTATAGG - Intronic
1150516329 17:65813489-65813511 AAGCAAATCCAACCATCTGTTGG - Intronic
1152349432 17:79776484-79776506 AAACTGATCCAGCTATTTGTAGG + Intergenic
1155182211 18:23357730-23357752 CAAATGATTCAACTATCTATTGG + Intronic
1155421632 18:25662831-25662853 AAGCTGATTCAAATATTTAGAGG - Intergenic
1157327840 18:46681606-46681628 AAGCTGACCCACCCATCTCTAGG + Intronic
1163646012 19:18489552-18489574 AATCTTACCCAAGTATCTATTGG + Intronic
1164354229 19:27398480-27398502 AAAGTGATCCAAATATCCATTGG + Intergenic
928231870 2:29505356-29505378 AAGATGATTGAACTATCTTTGGG + Intronic
929812697 2:45205146-45205168 AATGTGTTGCAACTATCTATCGG + Intergenic
941785618 2:169495546-169495568 AAGCTGATATAAATATCTATAGG - Intronic
944216295 2:197259536-197259558 AAGCTGATCCAACACTCCTTAGG + Intronic
945418422 2:209603827-209603849 AAGTTGATCTAACTATCTAAGGG + Intronic
945750002 2:213769809-213769831 AAGATGATCAAACTGTATATGGG - Intronic
1168914129 20:1472391-1472413 AAGCAGGGCCAACTTTCTATAGG + Intronic
1173158763 20:40637058-40637080 AAGCTGGTTCAACCATCTACAGG - Intergenic
1182156522 22:28078635-28078657 AAGGTGATTAGACTATCTATAGG + Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
957113392 3:75994134-75994156 AAGGTGATCCAATTAACTTTAGG + Intronic
957898639 3:86457564-86457586 AAGCTGATGAAACTTTCTAATGG - Intergenic
959102714 3:102031376-102031398 AAGAAGATACAAATATCTATTGG - Intergenic
974420683 4:61669269-61669291 AAGATGAGACAACTATCTAATGG - Intronic
974549521 4:63352949-63352971 ATGCTGATCCAACTCTATGTGGG + Intergenic
978309064 4:107365547-107365569 AAGCAGATTGAATTATCTATAGG + Intergenic
982551773 4:156810794-156810816 AAGCTGATCCAATTAAATAAGGG + Intronic
983266758 4:165515528-165515550 AAGCTGACCCAAGTCTCCATGGG - Intergenic
988983122 5:36591487-36591509 AAGATGATCCTACTACCTAGAGG + Intergenic
990009582 5:50980878-50980900 AAGCTGATCTAAACCTCTATGGG - Intergenic
994020649 5:95020870-95020892 AAACAGATCCAACTGTATATGGG - Intronic
1001806122 5:174588190-174588212 AAGATGATCCAGCCATGTATTGG - Intergenic
1004195323 6:13499250-13499272 GAGCTGTTTCAATTATCTATTGG + Intergenic
1008644367 6:53498803-53498825 ATGCTGATCCAAGTAACTCTGGG + Exonic
1015423135 6:133034528-133034550 TAGCCGAGCCAACTATCTAGAGG + Intergenic
1016137606 6:140564433-140564455 TAGCTGATCCAAATATTTAAAGG + Intergenic
1020068602 7:5210221-5210243 AAACTTAGGCAACTATCTATAGG - Intronic
1021388471 7:20062062-20062084 AAGCTGATCCTAAAATTTATAGG + Intergenic
1037395120 8:18433533-18433555 AAGGTGATGCACCTACCTATAGG + Intergenic
1038942800 8:32323999-32324021 AAGCTAATCCAACTATAAAGTGG + Intronic
1041546879 8:59055562-59055584 AAGCAGATCCCACTACATATGGG + Intronic
1044203596 8:89465331-89465353 AAGCTGATCTAAGTAACTTTGGG + Intergenic
1044210888 8:89550023-89550045 AAGCTGACCAATCTATCTTTGGG + Intergenic
1057203642 9:93157566-93157588 AGGCTGATACATCTATCTGTAGG + Intergenic
1186656067 X:11613503-11613525 AAGCTGATTGAACTAGCTAAAGG - Intronic
1187683299 X:21790599-21790621 AAGCAGATAAAACTATCTAAAGG + Intergenic
1194789142 X:98124678-98124700 AAGCTGATCCAAAAATTCATAGG - Intergenic
1198959387 X:142168431-142168453 AAGCTCATTCAACTATGTTTGGG + Intergenic