ID: 1127077655

View in Genome Browser
Species Human (GRCh38)
Location 15:55343715-55343737
Sequence CCTTCTAAGTAGACAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127077655_1127077661 24 Left 1127077655 15:55343715-55343737 CCATCCTCTGTCTACTTAGAAGG 0: 1
1: 0
2: 0
3: 34
4: 240
Right 1127077661 15:55343762-55343784 AAACCCCTTGATCTCCTCACAGG 0: 1
1: 0
2: 0
3: 13
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127077655 Original CRISPR CCTTCTAAGTAGACAGAGGA TGG (reversed) Intronic
900573661 1:3372423-3372445 CCATCTAAGTGGCCAGAGAAAGG + Intronic
900956743 1:5890781-5890803 CCTTCCAAGCAGACAGACGCTGG + Intronic
904151513 1:28445388-28445410 CCTTCTAATTAGAATTAGGAAGG - Intronic
904552259 1:31328824-31328846 ACTTCTAGGAAGAAAGAGGAGGG - Intronic
904603964 1:31689001-31689023 GCTTCCAGGTAGGCAGAGGAGGG + Intronic
905949005 1:41929615-41929637 CCATCTCAGTAGACAGAGCTAGG + Intronic
906133100 1:43473613-43473635 CCTTCTCAGCTGACAGAGTAAGG - Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907394134 1:54177872-54177894 CATTCTCAGGCGACAGAGGAGGG + Intronic
908074191 1:60496179-60496201 CCTTCTAAGGAGAAACAGGAAGG - Intergenic
908564246 1:65338147-65338169 CCTTCTCAGTGGACAGAGCTAGG + Intronic
908701933 1:66911532-66911554 CCTTCTAGGTAGCTTGAGGATGG - Intronic
910464651 1:87485316-87485338 CCTTCTGAGGTGACAGAGGGAGG - Intergenic
911565648 1:99460760-99460782 CCTTCTCAGCAGACAGAACAAGG - Intergenic
913016242 1:114738780-114738802 GCTACTAAGTAGACTGAGGTGGG - Intronic
913599073 1:120405574-120405596 CTTTCTAAGTAAACACAGGAAGG - Intergenic
914088306 1:144474046-144474068 CTTTCTAAGTAAACACAGGAAGG + Intergenic
914310305 1:146460164-146460186 CTTTCTAAGTAAACACAGGAAGG - Intergenic
914359425 1:146920028-146920050 CCTTCTGAGGTGACAGAGGGAGG - Intergenic
914494324 1:148179847-148179869 CCTTCTGAGGTGACAGAGGGAGG + Intergenic
914591804 1:149112978-149113000 CTTTCTAAGTAAACACAGGAAGG + Intergenic
916682283 1:167115631-167115653 ACATCTAAGTAGACACGGGAAGG + Intronic
918698543 1:187577420-187577442 CCTTTTGAGTAAACAGAGAAAGG + Intergenic
918732473 1:188015098-188015120 CCCTCTCAGTTGACAGAGCAAGG + Intergenic
920165658 1:204033938-204033960 CCTTATAAGTAAAAAGAGGGAGG - Intergenic
920385475 1:205568273-205568295 CCTTCTAACTAGTTGGAGGAGGG - Intergenic
920612141 1:207452022-207452044 CCCTCTCAGCAGACAGAGCAAGG - Intergenic
1063179470 10:3584773-3584795 CCTTCTTAGTAGACGGGGGCTGG - Intergenic
1063460375 10:6211808-6211830 CCTTCTCAGCAGGCAGAGTAAGG - Intronic
1066005680 10:31144285-31144307 CCTTCTCCGGCGACAGAGGAGGG + Intergenic
1067049500 10:43004578-43004600 CCCTCTCAGTGGACAGAGCAAGG + Intergenic
1068049594 10:51932572-51932594 CCCTCTAAGTGGACAGATGGAGG + Intronic
1068665634 10:59672546-59672568 CCTTGCAAGGAGACAGAGTATGG + Intronic
1068901857 10:62278530-62278552 CCTATGAAGCAGACAGAGGAAGG - Intergenic
1071614327 10:87061133-87061155 GCTTCTAAATAAACAGAGTATGG - Intronic
1071723365 10:88169842-88169864 ACTTCTAAGTAGGCAGAAGCAGG + Intergenic
1072180755 10:92977245-92977267 CATTCCAAGCAGAGAGAGGATGG - Intronic
1074310618 10:112319906-112319928 CCTTCTCAGTGGACAGAGTAGGG - Intergenic
1077172268 11:1172412-1172434 ACTTCTCTGTGGACAGAGGAGGG - Intronic
1078913379 11:15754939-15754961 CCTTCTTAGATGACACAGGAAGG + Intergenic
1079105092 11:17566048-17566070 CCTTCTCAGCTGACAGAGAAAGG + Intronic
1080419503 11:32097474-32097496 CATTCTGAGTTTACAGAGGAGGG - Intronic
1080931452 11:36815746-36815768 CCTTATAAGAAGACAGAGAAGGG + Intergenic
1086158608 11:83695769-83695791 CCTTCTAGGTAGACAGACAGGGG - Intronic
1086431757 11:86743021-86743043 GTTTGTAAGTAGGCAGAGGATGG + Intergenic
1089219186 11:116856574-116856596 TATTCTTAGTAGACATAGGAGGG - Intronic
1090852801 11:130585312-130585334 CCTTATCAGTAGGCATAGGAGGG - Intergenic
1091043988 11:132309697-132309719 CCTTCTAAGTAAGCAGAGCCAGG + Intronic
1092008731 12:5090743-5090765 CCTTCTCAGCAGACAGAGCTAGG + Intergenic
1093340584 12:17968169-17968191 CCTTCTAAGCTGACAGAGCAAGG + Intergenic
1096615712 12:52832411-52832433 CCTTCTGAGTCTATAGAGGAAGG - Intronic
1098921386 12:76305347-76305369 CCTTGTAAGTTGACAATGGATGG + Intergenic
1100621591 12:96281229-96281251 CATTGTAAGGAGACAGAGAAAGG - Intronic
1100763903 12:97842035-97842057 CTTTCTAATTAGAAAGAGGAAGG + Intergenic
1100809360 12:98323472-98323494 ACTACTAGGGAGACAGAGGAAGG - Intergenic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1102764207 12:115417536-115417558 CATTCAAAGTTGACAGAGTAGGG + Intergenic
1102812762 12:115838622-115838644 CCTTAAAAGAAGACAGAGAAAGG + Intergenic
1103783597 12:123415753-123415775 CCTTCAAAGCAGACTGAGGAGGG - Exonic
1104106430 12:125664177-125664199 CCTTCTCAATAGACACAGAAAGG - Intergenic
1106716452 13:32393732-32393754 CCCTCTCAGCAGACAGAGGTGGG + Intronic
1109443137 13:62400363-62400385 CCTTCAGAGCTGACAGAGGAGGG - Intergenic
1109738166 13:66514401-66514423 CCTTTTATGTAGACAGAGAATGG + Intronic
1110989171 13:82015480-82015502 CCGTCTCAGTTGACAGAGCAAGG - Intergenic
1111139684 13:84099800-84099822 GCTTCTGAGTAGCAAGAGGATGG + Intergenic
1112988569 13:105482370-105482392 ACTTCTAAGTAGCATGAGGAAGG + Intronic
1113328470 13:109306610-109306632 ACTTCTAATTAGCCATAGGAAGG + Intergenic
1113547457 13:111165136-111165158 ACGTCTAACTAGCCAGAGGATGG + Intronic
1116441176 14:44955331-44955353 CCTTTTCAGTAGACAGAGCTAGG - Intronic
1116643747 14:47499748-47499770 CCTTCTAGGGAGACAGAGCCTGG - Intronic
1119954734 14:78784731-78784753 TCTAGTTAGTAGACAGAGGATGG + Intronic
1123024475 14:105418309-105418331 CCTGCTGAGGAGACAGAGGTAGG + Intronic
1124415588 15:29470988-29471010 TCTGCTAAGTAAACAGAGGTGGG + Intronic
1125537889 15:40453073-40453095 CCTTCCAACCCGACAGAGGAGGG - Intronic
1127077655 15:55343715-55343737 CCTTCTAAGTAGACAGAGGATGG - Intronic
1127224607 15:56917015-56917037 CCCTGTAAGTAGGCAGAGCAGGG + Intronic
1127618639 15:60711613-60711635 GCTTCTGACAAGACAGAGGAAGG - Intronic
1128923158 15:71630544-71630566 CCTTCTCTGAAGACAGAGAAAGG + Intronic
1129293976 15:74589390-74589412 CCTTCTAGGAAGTCAGAGAAAGG + Intronic
1130850991 15:87793413-87793435 TCTTATTAGTAGACCGAGGAGGG - Intergenic
1132102450 15:99034216-99034238 GCTTCTCAGGAGACTGAGGAAGG - Intergenic
1133334017 16:4995056-4995078 CCATCTAGGTAAACAGAGGTGGG - Intronic
1134252641 16:12585288-12585310 CCTTCTAAGAAGGCAGAACATGG + Intergenic
1135559318 16:23463438-23463460 CCCTCTGAAAAGACAGAGGATGG + Intergenic
1135573113 16:23564528-23564550 CCTGCAAAGTTGACAGAGGCTGG - Intronic
1138206180 16:55126795-55126817 CCTTTTAACCAGCCAGAGGATGG - Intergenic
1138914212 16:61443079-61443101 CCCTCTCAGCTGACAGAGGAGGG - Intergenic
1139869154 16:70090124-70090146 CCTTTGAAATAGACAGTGGAAGG + Intergenic
1140386228 16:74542013-74542035 CCTTTGAAATAGACAGTGGAAGG - Intronic
1140641481 16:76978292-76978314 CCTTCAAAGTTGAAAGAGGAGGG - Intergenic
1140847296 16:78902748-78902770 CATTCTTAGAAGACAGTGGATGG - Intronic
1141414388 16:83858927-83858949 CCCTCCAAGTGGACAGGGGAAGG + Intergenic
1141494448 16:84397430-84397452 ACTTGTAAGTGGACAGAGTAGGG - Intronic
1141870751 16:86783930-86783952 ACTTCTTAGTAAACAAAGGACGG + Intergenic
1142579480 17:932551-932573 CCTTCTAAGAAAACACAGGCTGG + Intronic
1144028502 17:11299734-11299756 CCTTATAAGTGGACACAGGTTGG - Intronic
1145854560 17:28141146-28141168 TCATCTATCTAGACAGAGGAGGG + Intronic
1146298819 17:31672345-31672367 CTTTCTGAGCAGGCAGAGGAGGG - Intergenic
1146587746 17:34097055-34097077 CTCTCTAAGCACACAGAGGAAGG + Intronic
1146592564 17:34140403-34140425 CCTTCTCAGTGGACAGAGCTAGG - Intronic
1147275895 17:39316331-39316353 CCCTCTTAGTAGACAGAGCTCGG - Intronic
1150525933 17:65922724-65922746 TCCTCTAAGTAAACTGAGGAAGG - Intronic
1150607570 17:66707340-66707362 ACTTCAAAGTATTCAGAGGAGGG - Intronic
1150853102 17:68724660-68724682 CATGTTGAGTAGACAGAGGAGGG + Intergenic
1151999021 17:77633149-77633171 GCTTCTAAGGAGGCAGAGGCAGG + Intergenic
1155144232 18:23070218-23070240 CCCACTAAGGAGACAGAGTAGGG + Intergenic
1155723030 18:29042975-29042997 TCTTAAAAGTAGCCAGAGGAAGG + Intergenic
1156307981 18:35896888-35896910 CCTTCTCAGTGCACAGAGGTAGG + Intergenic
1157069713 18:44391754-44391776 CCTGTGTAGTAGACAGAGGAGGG + Intergenic
1158003592 18:52646915-52646937 CCTCCTAAATAGACTTAGGATGG - Intronic
1159701707 18:71637288-71637310 CCCTCTCAGTTGACAGAGCAAGG - Intergenic
1160197508 18:76768383-76768405 TCTCCAAAGAAGACAGAGGATGG - Intergenic
1162298881 19:9832627-9832649 CCCTCTAAGTGGATAGAGCAAGG - Intergenic
1162305127 19:9868012-9868034 CCTACTCAGGAGACAGAGGTGGG - Intronic
1167558602 19:50211220-50211242 CCTTCTAGGAAGACTGAGGCAGG + Intronic
925165879 2:1715349-1715371 GTTTCTAATTAGACAGATGACGG - Intronic
926003155 2:9350664-9350686 CCTTCAGACTTGACAGAGGAAGG - Intronic
926639237 2:15218050-15218072 CCTTCTAAGTATAGGGAGAAGGG + Intronic
927393845 2:22626913-22626935 TCCTCTAAGTAGAAAGATGAGGG + Intergenic
927607757 2:24503364-24503386 ACTGTTAAGAAGACAGAGGAAGG - Intronic
929444158 2:41989763-41989785 AGTTCTAAGCAGAGAGAGGAAGG + Intergenic
931635538 2:64337972-64337994 CCTGGTAAGTAGATAGAGTAGGG - Intergenic
932101019 2:68899133-68899155 CCTTCTCAGTGGACAGAGCTAGG - Intergenic
932869152 2:75379672-75379694 CATTCTAATCAGGCAGAGGAGGG + Intergenic
936146052 2:109981271-109981293 CCTTCTGAGCAGAGAGAGGCAGG - Intergenic
936198638 2:110390208-110390230 CCTTCTGAGCAGAGAGAGGCAGG + Intergenic
936382752 2:112001546-112001568 CCTTCTAGGGTGACAGAAGATGG + Intronic
936731509 2:115386663-115386685 CCTTCCTGGTAGAGAGAGGAGGG + Intronic
939455783 2:142433119-142433141 TATTCTAAGTAGTCAGATGAGGG + Intergenic
940213974 2:151285653-151285675 CCTTCTCAGCAGACAGAGCTAGG - Intronic
940792371 2:158042693-158042715 CCTTATAGGAAGAGAGAGGAAGG + Intronic
940975000 2:159932639-159932661 CCTTCTTAGTATACAGAGCTTGG - Intronic
945510632 2:210698042-210698064 CCTTCTCAGCTGACAGAGCAAGG + Intergenic
946799299 2:223393090-223393112 CTTTCTAAGCAGACAGAAAAAGG + Intergenic
947116354 2:226775584-226775606 CCTTCTCAGCTGACAGAGCATGG - Intronic
947459197 2:230288280-230288302 CTTTCTGAGTAGTCAGAGGAAGG - Intronic
948383770 2:237568763-237568785 CCTTCCAAGTAGCCAAAGGGTGG + Intergenic
948730649 2:239961704-239961726 CCTTTTAAGTAGACATGGGCAGG + Intronic
1169001826 20:2173458-2173480 CCCTGTATGTAGACAGAGCAGGG + Intronic
1169334359 20:4743252-4743274 CCTTCTCAGATGACAGAGCAAGG - Intergenic
1170128454 20:12991395-12991417 CATCCGAAGTAAACAGAGGAAGG + Intergenic
1170723923 20:18908794-18908816 CTTTCTATCCAGACAGAGGAAGG - Intergenic
1171094561 20:22318982-22319004 CCGTCTAAGTGGACAGAGCTGGG - Intergenic
1173125800 20:40335005-40335027 CCTGTTAAGTACACAGAGGAGGG - Intergenic
1174170234 20:48613108-48613130 CCTTGTAAGGAGACACGGGAGGG + Intergenic
1175071066 20:56334340-56334362 CCTACTCAGTAGACTGAGGCAGG + Intergenic
1175430672 20:58900565-58900587 CCTTCTATGTATACAGCAGATGG - Intronic
1177673846 21:24270961-24270983 CCTTGAGAGTAGACAAAGGAGGG - Intergenic
1178162237 21:29931743-29931765 CCCTCTCAGCAGACAGAGCAAGG + Intronic
1178303803 21:31473810-31473832 CCAGCTAAGGTGACAGAGGAGGG - Intronic
1179111722 21:38452662-38452684 CCTTCTAGGATGAGAGAGGAAGG - Intronic
1179157527 21:38863163-38863185 CCCTCCATGTAGACAGAGGGGGG - Intergenic
1179165224 21:38930306-38930328 CCTTCTTGGTAGAGAAAGGAGGG + Intergenic
1179652275 21:42819233-42819255 CCTTCTCAGTGGACAGAGCAAGG - Intergenic
1181930844 22:26400354-26400376 CCTTCTAAGAAGGCAGGGGTAGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183213424 22:36464793-36464815 CCTTCTAAATATACAGAACATGG - Intergenic
1183350691 22:37333102-37333124 CCTTCGGAGTGGACAGAGGCTGG + Intergenic
1183905975 22:41040492-41040514 CCTTCTAATAAAACAGAGAAGGG - Intergenic
1184800365 22:46755189-46755211 CTTTCAGGGTAGACAGAGGAGGG - Intergenic
1184930265 22:47675588-47675610 CCTTCCCGGAAGACAGAGGAGGG + Intergenic
950272889 3:11633366-11633388 CCCTCCAAGAAGGCAGAGGAGGG + Intronic
950392227 3:12705653-12705675 CCTGCAAAGGAGACAGAGAAGGG + Intergenic
952384296 3:32828617-32828639 CCTTCTCAGAAGGCAGAGGTGGG - Intronic
953648681 3:44779399-44779421 CCTTCTCAGCAGACAGAGCTAGG + Intronic
955802958 3:62705077-62705099 CCTTCAAGTAAGACAGAGGAGGG + Intronic
958852616 3:99347279-99347301 CCTTCATAGTTGAAAGAGGAGGG + Intergenic
960320413 3:116228068-116228090 CCTTCTAATGGGAGAGAGGAAGG + Intronic
961518627 3:127454399-127454421 CCTTCTAAGAAGAGAGAATAAGG - Intergenic
962681115 3:137801426-137801448 TCTGCCAAGGAGACAGAGGAGGG + Intergenic
965126342 3:164634929-164634951 CCATCTAAGAAGACAGCAGAAGG + Intergenic
967675346 3:192291981-192292003 CCATTTAAGTAGAAATAGGAAGG + Intronic
967706014 3:192651802-192651824 CCTTTGATTTAGACAGAGGATGG + Intronic
969163515 4:5282654-5282676 CCTACTAATGAGACAGAAGAAGG + Intronic
970557488 4:17249216-17249238 CCTACTCAGGAGACTGAGGAGGG + Intergenic
970653238 4:18201108-18201130 ATCTCTAAGGAGACAGAGGATGG - Intergenic
972350955 4:38235880-38235902 CATACTGAGTAGACGGAGGAGGG + Intergenic
976415620 4:84770674-84770696 TCTTCTAAGAAGACAGAGACTGG + Intronic
976623402 4:87152457-87152479 ACTACTCAGTAGACAGAGGTGGG + Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977033807 4:91924041-91924063 CCCTCTCAGTTGACAGAGGAAGG + Intergenic
978333271 4:107638667-107638689 TATTCTAAGAAAACAGAGGAAGG + Intronic
981278086 4:142925304-142925326 CCTTCTCAGTAGGCAGAGACAGG - Intergenic
981549590 4:145930294-145930316 CCTTCAAAGGAGACTGAAGAAGG - Intronic
981764080 4:148228026-148228048 CCTTCTCAGTAGACAGAACAAGG + Intronic
985410656 4:189680027-189680049 GCTTTTAAGCAGATAGAGGAAGG - Intergenic
989240864 5:39201990-39202012 CCTTCTAAGCTGACAGTGGGGGG - Exonic
989374879 5:40750444-40750466 CCTACTCAGGAGACAGAGGCAGG + Intronic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994744891 5:103665952-103665974 GGTTCTCAGTAGACAGAGGTAGG + Intergenic
995478226 5:112569322-112569344 CCCTCTAAGCAGACAGAGAATGG + Intergenic
996635907 5:125690346-125690368 CCTTCTCAGGAGACTGAGGCAGG - Intergenic
997637398 5:135423852-135423874 CCCTCTCAGTAGACAGAGCTAGG + Intergenic
998069510 5:139186075-139186097 CCTTCAAAGTAGCCAGAAGCAGG + Intronic
998437009 5:142119033-142119055 CCTTCTAAGCTGACAGAGCAAGG + Intronic
998455761 5:142271744-142271766 CTTTCTAAAAAGACAGAGTAAGG - Intergenic
998988521 5:147789237-147789259 CATTCTGAGTGGATAGAGGAAGG - Intergenic
999037152 5:148364758-148364780 CCTTTTAGGTAGAAAGAGGCTGG - Intergenic
999323024 5:150626319-150626341 TCTCCTAAGGAGACAGAGGAAGG - Intronic
999674307 5:153983525-153983547 CCTGCTAAGAAGTCACAGGAAGG - Intergenic
1001724503 5:173885726-173885748 CCTTATGTGTAGACAGAGGGAGG + Intergenic
1003665166 6:8104290-8104312 CCTTTTAAGTAAACAGAGCTAGG - Intergenic
1005850100 6:29814595-29814617 GCTGCAAAGTGGACAGAGGATGG + Intergenic
1006208094 6:32367682-32367704 TCTTGGAAGTAGACAGAAGATGG + Intronic
1006260825 6:32868329-32868351 CCTTCACAGTAGGCGGAGGAAGG + Intergenic
1006967105 6:37998927-37998949 CCCTCTCAGCAGACAGAGCAAGG - Intronic
1007565206 6:42844877-42844899 GATTCTTTGTAGACAGAGGAGGG + Intronic
1007582710 6:42968770-42968792 GCCTGTGAGTAGACAGAGGAGGG + Intronic
1008404669 6:51105467-51105489 GCTTCTAAGAAAACAGAGGATGG + Intergenic
1008925110 6:56884017-56884039 CCTTCTCAGGAGACAGAGGCAGG + Intronic
1010497179 6:76549109-76549131 CCTTCAAAGATGATAGAGGATGG + Intergenic
1010767105 6:79788135-79788157 GAATCTAAGGAGACAGAGGAAGG - Intergenic
1011850255 6:91618404-91618426 TATTCTAAGGATACAGAGGAGGG - Intergenic
1014405637 6:121047145-121047167 CCTTTTAAGTAGAAAGGGGCAGG + Intergenic
1014796062 6:125725603-125725625 CCTTCTCAGCAGACAGAGCTGGG - Intergenic
1014812976 6:125906180-125906202 CCTTAAAAGTACAGAGAGGAGGG + Intronic
1014878920 6:126697262-126697284 CCTTCTCTGTTTACAGAGGAGGG - Intergenic
1016434713 6:144024157-144024179 CCTTCTCAGTAGACAGAGCTAGG - Intronic
1017389082 6:153918862-153918884 CATTCTAATTAGAAAGAGGGGGG - Intergenic
1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG + Intergenic
1017716372 6:157216569-157216591 CCTCCTAAGAAGACAGAGCTGGG - Intergenic
1017943590 6:159075564-159075586 CCTTCAAAGTAGACTGGAGAAGG - Intergenic
1020710758 7:11601698-11601720 CCTTCTAAGCAGACTGATGACGG + Intronic
1022267151 7:28768192-28768214 CCTTCTGAGGAAACAGAAGAAGG - Intronic
1023992197 7:45134912-45134934 TTTTCTAAGAAGACAGAGCAGGG - Intergenic
1027795799 7:82691639-82691661 ATGCCTAAGTAGACAGAGGAAGG - Intergenic
1028035711 7:85979127-85979149 CCTACTCAGAAGACAGAGGTGGG + Intergenic
1028351490 7:89855824-89855846 CCTTTTCAGTAGACAAAGCAAGG + Intergenic
1031880730 7:127195607-127195629 CCTTCTAAGTTGACAGGAGAGGG - Intronic
1032282517 7:130515894-130515916 CCACTCAAGTAGACAGAGGAAGG + Intronic
1032717558 7:134523190-134523212 CCTTTTCAGTAGAAAGAGGTAGG - Intergenic
1032907730 7:136390817-136390839 CCTTTTAAGTGGACAGAGCTAGG - Intergenic
1033099198 7:138456290-138456312 CCTACTCAGGAGGCAGAGGAGGG - Intergenic
1034835565 7:154349027-154349049 CCTTCCAACTGGGCAGAGGATGG + Intronic
1034868944 7:154665679-154665701 CCTTCTCAGTGGACAGACGCAGG + Intronic
1035757760 8:2046828-2046850 CTTTCTATGTAGACAGTAGAGGG + Intronic
1037790958 8:21941263-21941285 CCTTCTAGGGAGACCGAGGTAGG - Intronic
1038169435 8:25115705-25115727 CCTTCTAAGGATACATATGATGG - Intergenic
1038635149 8:29280342-29280364 CCTACTAAGTAGGCTGAGGAGGG + Intergenic
1038932814 8:32214109-32214131 CCTTCCTAGTAGAGAGGGGAGGG + Intronic
1040013175 8:42679189-42679211 CCTACTAAGGAGACTGAGGTGGG + Intergenic
1040467829 8:47711601-47711623 CCCTCTCAGTGGACAGAGGAAGG + Intronic
1041474936 8:58253868-58253890 CCTTCTGAGCCGACAGAGGTAGG - Intergenic
1043623939 8:82231095-82231117 GCTACTAAGTAGGCTGAGGAGGG + Intergenic
1044365343 8:91338717-91338739 CCTTCTTAGTGGCCAGAGGAAGG - Intronic
1044499345 8:92933091-92933113 CCTTCTAAGGAGAGAGAGCTAGG + Intronic
1044751235 8:95417683-95417705 CCTTCTCAGTGGACAGAGCTAGG + Intergenic
1044833177 8:96270018-96270040 CCTCCTCAGTAAACAGAGGATGG - Intronic
1045066207 8:98447421-98447443 ACTTCTAATTGGACAGAGTAAGG + Intronic
1047566725 8:126051922-126051944 CCTTCTGTGTAGGAAGAGGAGGG + Intergenic
1048016269 8:130500265-130500287 CCCTCGAAGCAGCCAGAGGATGG - Intergenic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1048979662 8:139696615-139696637 CCCACTGAGTACACAGAGGAGGG + Intronic
1049736850 8:144212457-144212479 CCTTTTCAGTAGACAGAGCTAGG + Intronic
1049839389 8:144761359-144761381 CCTGCTCTGTAGACAGAGCAGGG + Intergenic
1052052895 9:23867848-23867870 AATTCTAAGTAGATTGAGGAGGG + Intergenic
1052519839 9:29532292-29532314 ACATATAAGTAGAGAGAGGAAGG - Intergenic
1056672603 9:88643435-88643457 CCTTTTCAGTAGACAGAGCAAGG + Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057746350 9:97754883-97754905 CCTTCTCAGCAGACAGAGCAAGG + Intergenic
1058462442 9:105195685-105195707 ACTTCTGAGGAGAGAGAGGAGGG + Intergenic
1061103012 9:128506671-128506693 CCTTCTCAGTAGACAGAGCTAGG + Intronic
1062723061 9:138054432-138054454 CCTCCAAAGTAGACAGGAGAGGG + Intronic
1203672106 Un_KI270755v1:25399-25421 GCTTTTAAGCAGATAGAGGAAGG + Intergenic
1186524401 X:10235223-10235245 CTTTCTAAGTGGGAAGAGGAAGG + Exonic
1187350163 X:18506334-18506356 CCTTCTCAGCAGACAGAGCTAGG + Intronic
1188094786 X:26008036-26008058 CCCTCTGAGCAGACAGAGCAAGG - Intergenic
1189233935 X:39473456-39473478 CCTACTAAGGAGACTGAGGCAGG - Intergenic
1189967920 X:46393188-46393210 GCTTCTAGATAGAAAGAGGACGG + Intergenic
1192166215 X:68829190-68829212 TCTTCTAAGTACACTGAGCAGGG + Exonic
1197046785 X:122007242-122007264 CCTACTCAATAGAGAGAGGATGG + Intergenic
1197483286 X:127014030-127014052 CCTTCCATGTAGACAAAGCATGG - Intergenic
1198016196 X:132613821-132613843 CCGTCAAAGTAGACTGAGGCTGG + Intergenic
1201369150 Y:13241952-13241974 GCTACTAGGGAGACAGAGGAAGG + Intergenic