ID: 1127078170

View in Genome Browser
Species Human (GRCh38)
Location 15:55348523-55348545
Sequence GAGAACTCACTTACTACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 7, 3: 40, 4: 298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127078170_1127078174 15 Left 1127078170 15:55348523-55348545 CCTGGAGTAGTAAGTGAGTTCTC 0: 1
1: 0
2: 7
3: 40
4: 298
Right 1127078174 15:55348561-55348583 ATGAGAGTTCCCCCGAGTGCTGG 0: 1
1: 0
2: 1
3: 6
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127078170 Original CRISPR GAGAACTCACTTACTACTCC AGG (reversed) Intronic
900839691 1:5038323-5038345 GAGAACTCACTCACTATCACAGG + Intergenic
902688986 1:18097838-18097860 TAGACCTCACTCACTACTTCAGG - Intergenic
903562795 1:24241223-24241245 GAGAACTCACTCACTATCACAGG + Intergenic
905538774 1:38743938-38743960 GAGAACTCACTTATTACCATGGG - Intergenic
906283697 1:44571501-44571523 TAGAACTTACTTTCTACTGCTGG - Intronic
909101284 1:71352410-71352432 GAGAACACACTTACTATCACAGG - Intergenic
911498353 1:98657735-98657757 AAGAACTCACTCACTACCACAGG + Intergenic
911511354 1:98810464-98810486 TAGAACTCACTTACTATCACAGG + Intergenic
912731907 1:112114713-112114735 GAGAACTCACTCATTACCACAGG + Intergenic
914283113 1:146195399-146195421 GAGAACTCACTCATTACTGTGGG - Intronic
914544143 1:148646119-148646141 GAGAACTCACTCATTACTGTGGG - Intronic
914622486 1:149424893-149424915 GAGAACTCACTCATTACTGTGGG + Intergenic
915294983 1:154913891-154913913 GAGAACTCACTCATTACCACTGG - Intergenic
915730821 1:158052993-158053015 GAGAACTCACTCATTACCCTGGG + Intronic
916604104 1:166324097-166324119 GAGAATTCACTCACTACTGCAGG - Intergenic
916782677 1:168052818-168052840 GAGAACTCCCTCAGTACACCAGG - Intronic
917072303 1:171165459-171165481 GAGAACTCACTCATTACCCTGGG - Intergenic
918834957 1:189450142-189450164 GAGAACTCACTTATTACCAAGGG - Intergenic
920016437 1:202913742-202913764 GAGTACTCTCTTACTCCCCCTGG - Intronic
920162601 1:204010748-204010770 GAGAACTCACTCACTACCACAGG - Intergenic
921253146 1:213316131-213316153 GAGAACTCACTCACTATCACAGG - Intergenic
921609219 1:217191061-217191083 AAGAACTCACTCACTATTGCAGG + Intergenic
921649352 1:217658249-217658271 GAGAACTCACTCATTACTGTGGG - Intronic
922107451 1:222524886-222524908 GAGAACTGAGTTCCTATTCCAGG + Intronic
923003179 1:230024280-230024302 GAGAACTCACTCATTACTGTGGG - Intergenic
923111702 1:230896033-230896055 GAGAAGTCACTCATTACTACAGG + Intergenic
924730874 1:246710520-246710542 GAGAGCTCACTTATTACTATGGG + Intergenic
1063329884 10:5147214-5147236 AAGAATTCACTCACTACTGCAGG + Intergenic
1063347581 10:5325983-5326005 GAGAACTCACTCATTACCTCGGG - Intergenic
1063738857 10:8795012-8795034 GAGAACTCACTCACTAGTATGGG + Intergenic
1065964671 10:30761528-30761550 GATAACTCACTCATTACTACAGG + Intergenic
1066062002 10:31732497-31732519 GAGAACTCACTCATTACTACTGG + Intergenic
1067412597 10:46078040-46078062 GAGCACTCACTCATTACTGCAGG - Intergenic
1067695092 10:48528730-48528752 GAGAACTCACTTATTGCCACAGG - Intronic
1067909861 10:50335265-50335287 GAGATCTCACTTCATCCTCCAGG - Intronic
1068359190 10:55953639-55953661 GAGAAATCACTGACTCCTACGGG + Intergenic
1070059491 10:72968217-72968239 GAGAACTCAGTTCTTACTGCTGG + Intergenic
1070369713 10:75770842-75770864 TAGAACTCACTTTCTCCTCCTGG - Intronic
1070414008 10:76172117-76172139 GAGAACTCACTCACCACTGTAGG + Intronic
1071179892 10:82971135-82971157 GAGAACTCACTCATTACTGCAGG + Intronic
1072935804 10:99712064-99712086 GAGAACTCACTCATTACTATGGG + Intronic
1073080350 10:100855885-100855907 GAGAACTCACTCATTACTGTGGG - Intergenic
1073513178 10:104055312-104055334 GAAAACTCACTTCCAACTGCAGG + Intronic
1074699387 10:116079847-116079869 GAGAAGTCACTTGCTTCCCCTGG - Intronic
1078753488 11:14187191-14187213 GAGAACTCACTCATTACCTCAGG + Intronic
1079343944 11:19635706-19635728 GAGAACTCACCTACTTCTTTTGG + Intronic
1080422204 11:32120386-32120408 GAGAACTCACTCATTACTGTGGG - Intergenic
1080953217 11:37061701-37061723 TAGGAGTCACTTACTCCTCCTGG + Intergenic
1081175840 11:39925247-39925269 GAGAACTCACTCACTATCACAGG - Intergenic
1081327565 11:41764318-41764340 GAGAACTCAATTGCTACTGCAGG + Intergenic
1081788197 11:45763356-45763378 GAAAACTCACTTATTACCACGGG - Intergenic
1082930041 11:58593015-58593037 GAGAACTCACCTATTACCACAGG + Intronic
1085449147 11:76621623-76621645 CAGAACTCACATCCTACGCCAGG - Intergenic
1086483155 11:87267145-87267167 TAGACCTCACTTACCACTCATGG - Intronic
1086524751 11:87712049-87712071 GTGAACTCACTTATTACTGTAGG + Intergenic
1086812278 11:91325196-91325218 AAAAAATCACTTACTACTCTGGG + Intergenic
1087101096 11:94365444-94365466 GAGAACTCACTTACCACCAAGGG - Intergenic
1087446949 11:98267989-98268011 GAGAACTAACTCACTACCACTGG + Intergenic
1088679626 11:112227711-112227733 GAGAACTCACTCATTGCTTCAGG + Intronic
1089325552 11:117654470-117654492 GAAAAGTCACTTACTTCTCTGGG + Intronic
1091316308 11:134616312-134616334 GAGAACTCACTCATTACTCAAGG - Intergenic
1092458853 12:8669276-8669298 GAGAACTCACTAATTACTATGGG + Intergenic
1093124247 12:15308735-15308757 GAGAACTCACTCATTACCTCGGG - Intronic
1093698359 12:22189091-22189113 GAGAACTCACTTATTACCAAGGG - Intronic
1093794741 12:23297972-23297994 GAGAACTCTCTTAAATCTCCAGG + Intergenic
1095544013 12:43344185-43344207 GAGAACTCACTCACTATCACAGG + Intergenic
1097354517 12:58586499-58586521 AACAACTCAGTTACTACTCTTGG - Intronic
1097361316 12:58661574-58661596 GAGAACTCACTCATTACTGTTGG - Intronic
1097677969 12:62623290-62623312 GAGAACTCACTTATTACTGTGGG + Intergenic
1098239416 12:68451509-68451531 GAGCACTCTCTCACTCCTCCTGG + Intergenic
1104459480 12:128943169-128943191 GGAAACTCACTTACTGGTCCTGG + Intronic
1104542231 12:129676625-129676647 GAGAACTCACTTATTACTGCGGG + Intronic
1104611265 12:130229658-130229680 GAGAACCCACTCACTACCACAGG + Intergenic
1105074074 12:133260053-133260075 GAGAACTCACTCACTATCACAGG + Intergenic
1106024148 13:25941081-25941103 GAGAACTTTCTGACTCCTCCAGG + Intronic
1107167432 13:37299058-37299080 GAGAACTCACTTGTTACTGTAGG + Intergenic
1107354816 13:39555922-39555944 GAGAACTCACTTACCACCAAGGG - Intronic
1107673135 13:42767723-42767745 GAGAACTCACTCATTACTGTGGG + Intergenic
1107798540 13:44080423-44080445 GAGAACTCACTTACTAGTCAAGG - Intergenic
1108039415 13:46325365-46325387 GAGAACTCACTTATTACTACAGG - Intergenic
1108979613 13:56493572-56493594 GAGAACTCACTCACTATGACAGG + Intergenic
1109793252 13:67277384-67277406 GAGAACTCACTCACTATCACCGG + Intergenic
1111176182 13:84599340-84599362 GAGAACTCACTCACTATTACAGG - Intergenic
1111482460 13:88848879-88848901 CAGAACTCACTCATTACTGCAGG + Intergenic
1111814496 13:93133627-93133649 GAGAACTCACTTATAACTAAGGG - Intergenic
1113346807 13:109486133-109486155 GAGAACTCACTCACTATCACAGG - Intergenic
1113606329 13:111610187-111610209 GAGAACTCACTCACTAGTACAGG - Intronic
1113726840 13:112610388-112610410 GAGAACTCACTCACTATGGCAGG + Intergenic
1113809367 13:113128940-113128962 GAGAACCCCCTTACCATTCCAGG - Intronic
1114515010 14:23293517-23293539 GAGAACCCACTTACCTCTCCTGG + Intronic
1114590872 14:23863720-23863742 GAGAAATCACTGCCTCCTCCAGG + Intergenic
1114601712 14:23961017-23961039 GAGAACTCACTCACTGCCACAGG + Intronic
1114840925 14:26261045-26261067 GAGAACTCACTTACTATCATGGG - Intergenic
1115039110 14:28899432-28899454 GAGAACTCGCTCACTATTACAGG + Intergenic
1118302297 14:64626376-64626398 GAGAACTCACTCACTATCACAGG - Intergenic
1118387909 14:65271923-65271945 GATACCTCACTTACCTCTCCTGG - Intergenic
1119814028 14:77549139-77549161 GAGAACTCACTCATTACCCAAGG - Intronic
1120224513 14:81775885-81775907 TAGAACTCAGGTTCTACTCCTGG - Intergenic
1121383519 14:93495371-93495393 GAGAACTCACTCACTATCACGGG + Intronic
1122831452 14:104399129-104399151 GAGAACTCACTCACTACCATGGG - Intergenic
1126127320 15:45307496-45307518 GAGAATGCACTTACTCCTCCAGG - Intergenic
1126893017 15:53226636-53226658 GAGACTTCTCTTACTACTACAGG - Intergenic
1127078170 15:55348523-55348545 GAGAACTCACTTACTACTCCAGG - Intronic
1127708164 15:61567724-61567746 GAGAACTCACTCAATATTGCAGG + Intergenic
1128869329 15:71140806-71140828 TAGAACACATTTATTACTCCAGG + Intronic
1129232668 15:74205487-74205509 GAGAACTCACTCATTACCACAGG + Intronic
1129958759 15:79664186-79664208 GAGAACTCACTTATTACCGTGGG + Intergenic
1130104122 15:80916478-80916500 GAGAACTTACATATTACTTCTGG + Intronic
1131766434 15:95680890-95680912 GAGAACTCACTCACTACTGTGGG - Intergenic
1134064092 16:11215848-11215870 GAGAACTCACTCACTATCACAGG - Intergenic
1134502537 16:14780477-14780499 GAGAACTCACTCATTACTCAGGG + Intronic
1134578026 16:15348418-15348440 GAGAACTCACTCATTACTCAGGG - Intergenic
1134724562 16:16409128-16409150 GAGAACTCACTCATTACTCAGGG + Intergenic
1134846046 16:17441557-17441579 GAGTACCAACTTACTTCTCCTGG + Intronic
1134942869 16:18302731-18302753 GAGAACTCACTCATTACTCAGGG - Intergenic
1137703767 16:50519274-50519296 GAGAACACACCTTCTACTCGGGG - Intergenic
1139163088 16:64534895-64534917 GAGAACTCACTCACTATCACAGG - Intergenic
1140278535 16:73532827-73532849 GAGAACTCACTCACTATTATGGG - Intergenic
1141209990 16:81969618-81969640 GAGAACTCACTCATTACTGTAGG - Intergenic
1141381953 16:83584942-83584964 GAGAACTCACTCACTACTGTGGG + Intronic
1144452395 17:15391776-15391798 GAGAACTCACTTATAACTAAGGG - Intergenic
1144479560 17:15617600-15617622 GAGAACTCACTCATTACTGTGGG - Intronic
1144918742 17:18746139-18746161 GAGAACTCACTCATTACTGTGGG + Intronic
1145026717 17:19473314-19473336 GAGAACTCACTTATTACCATGGG - Intergenic
1145290983 17:21545718-21545740 AAGAACTCACTCACTACCACTGG - Intronic
1149438975 17:56659192-56659214 GAGAACAGACTTATTGCTCCTGG + Intergenic
1149632155 17:58135237-58135259 GAGAACTCACTTATTACCAAGGG + Intergenic
1150141870 17:62737113-62737135 GAGAACTCACTCAATACTTGAGG + Exonic
1150428216 17:65094122-65094144 GAGAACTCACTTACCACCAGGGG + Intergenic
1151102425 17:71571347-71571369 GAGAACTCACTCATTATTGCAGG - Intergenic
1151931848 17:77237328-77237350 GAGAACTCACTCACTATCTCGGG - Intergenic
1154179264 18:12117110-12117132 CTGAACTCACTTATTAGTCCTGG + Intronic
1155099731 18:22598648-22598670 GAGACCTCACTAAATACTCCTGG - Intergenic
1155677160 18:28442920-28442942 GAGAACTCACTTATTACCATGGG + Intergenic
1156632671 18:38988705-38988727 GAGAACTCACTTATTACCATGGG - Intergenic
1157049934 18:44151708-44151730 GAGAACTGACTTATTACTGAAGG + Intergenic
1157166429 18:45362075-45362097 GAGAACTCACTCACTACCATGGG - Intronic
1159120234 18:64160619-64160641 GAGAACTCACTCACTATCACAGG + Intergenic
1159824346 18:73188341-73188363 GAGAACTTACTCACTACCACAGG - Intronic
1164429289 19:28172746-28172768 GAGAACTCACTCATTACTTTAGG - Intergenic
1164675999 19:30102005-30102027 GAGAACTCACTCATTACCCCAGG + Intergenic
1165178282 19:33946111-33946133 GAGAACTCGCTCACCACTCTGGG - Intergenic
1165884355 19:39067078-39067100 GAGAACTCACTCACTACCAAGGG + Intergenic
1165957722 19:39512187-39512209 GAGAACTCACTCATTACTGTGGG + Intergenic
1166922164 19:46236398-46236420 GAGAACTCACTTATTACTATGGG - Intergenic
925461858 2:4070088-4070110 GAGAACTCACTCACTAATATAGG - Intergenic
925533922 2:4895283-4895305 AAGAACTCACTCATTACTTCAGG + Intergenic
927184303 2:20471145-20471167 GAGAACTCACTTATTACTAAGGG + Intergenic
927343545 2:22010079-22010101 GAGAACTCACTCATTACTGTGGG - Intergenic
929407373 2:41658286-41658308 GAGAACTCACTCACTACCAGAGG - Intergenic
929419460 2:41776017-41776039 GAGAACTCACTTATTACTGTGGG - Intergenic
930470082 2:51801427-51801449 GAGAACTCATTCATTACTGCAGG + Intergenic
930565039 2:53008243-53008265 ATAAACTCACTTTCTACTCCCGG - Intergenic
930622826 2:53662106-53662128 GAGAACTCACTTAACACTGAGGG + Intronic
930678739 2:54232802-54232824 GAGAACTCATTTACTATCACAGG + Intronic
930962588 2:57278576-57278598 AAAAACTCACTTATTACTACAGG - Intergenic
932982524 2:76687023-76687045 GAGAACTCACTTATCACTAAGGG - Intergenic
933108389 2:78362874-78362896 GAGCAATCACTTACTATACCAGG + Intergenic
933330287 2:80884830-80884852 GAGAACTCACTCATTACCACAGG + Intergenic
935181490 2:100694936-100694958 GAGAACTCACTCACTACCATTGG + Intergenic
937462651 2:122102838-122102860 AAGAACTCACTTACCACCACGGG + Intergenic
937935561 2:127241345-127241367 GAGAACTCACTCACTATCACAGG + Intergenic
938128294 2:128690277-128690299 GAGAACTCCCCTCCTACTTCCGG + Intergenic
938218732 2:129546729-129546751 AAGAACTCACTCATTACTGCAGG + Intergenic
940896442 2:159085730-159085752 GAGAACTCACTCATTACTGCTGG + Intronic
941429675 2:165398915-165398937 GAGAACTCACTCACTATCACTGG + Intergenic
941902464 2:170691551-170691573 GAGAAGTCAGTGACCACTCCAGG + Intergenic
942347306 2:175016910-175016932 GAGAACTCACTTATCACTAAGGG - Intergenic
942486276 2:176443060-176443082 GAGAACTCACTTATTACCATGGG - Intergenic
942853052 2:180513221-180513243 GAAAACTCACTTACTACCACAGG - Intergenic
943832452 2:192479474-192479496 GAGAACTCACTCACTATCACAGG - Intergenic
945921206 2:215756371-215756393 GAGAACTCACTTATTACTATGGG - Intergenic
946388717 2:219402339-219402361 GGGAACTGACTTCCTCCTCCTGG - Intergenic
946468154 2:219931140-219931162 GAGAACTCACTCATTACCACGGG + Intergenic
946819382 2:223614512-223614534 GAGAACTCACTTATTACCAAGGG + Intergenic
948308849 2:236970105-236970127 CAGAACTCACTTTTCACTCCAGG - Intergenic
1168809351 20:694091-694113 GAGAACTCACTTATTACCAAGGG + Intergenic
1168878887 20:1189625-1189647 GAGAACTCACTTATTACCGTGGG - Intergenic
1169765135 20:9140607-9140629 AAGAACTCACTCATTACTACGGG - Intronic
1170213894 20:13872356-13872378 GAGAACTCACTCACTATCACAGG - Intronic
1170356925 20:15502855-15502877 GGGAACTGACTTACAAATCCGGG + Intronic
1170481486 20:16769430-16769452 CAGAACTCACTTACCCCTGCAGG + Intronic
1173715608 20:45201378-45201400 GAGAACTCACTCATTACTGCGGG - Intergenic
1176958417 21:15132336-15132358 GAGAACTCACGCATTACTGCTGG - Intergenic
1177026489 21:15926929-15926951 GAGAACTCACTCACTATCACAGG - Intergenic
1177155163 21:17494052-17494074 GAGAACTCACTTATTACCAAGGG + Intergenic
1179230512 21:39499903-39499925 GAAAACTCACATTCTTCTCCTGG - Exonic
1179952365 21:44716041-44716063 GAGAACTCACTCACTACCACGGG - Intergenic
1180607486 22:17070174-17070196 GAGAACTCATTCATTACTGCAGG + Intergenic
1183193116 22:36334555-36334577 GACAACTCACTTCCTGCACCTGG + Intronic
951153787 3:19324417-19324439 GAGAACTCACTCACTATCACAGG + Intronic
952010650 3:28897222-28897244 GAGAACTCACTTATTACTGCTGG + Intergenic
952139295 3:30459990-30460012 GAGAACTCACTCACTACCATGGG - Intergenic
952284052 3:31950721-31950743 GAGAACTCACTTATTACCATAGG - Intronic
952670541 3:35962003-35962025 GAGCACTCACTCACTACCACAGG + Intergenic
952989823 3:38821957-38821979 GAGAACTCATAAACTACTTCTGG - Intergenic
953072395 3:39534329-39534351 GAGAACTCACTCATTAGTGCAGG + Intergenic
956463573 3:69496337-69496359 GAGGACCCACTTTCTGCTCCAGG + Intronic
957922454 3:86763044-86763066 GAGAACTCACTCACTATCACGGG + Intergenic
959862399 3:111230516-111230538 GAGGACTCACTTATTACCACAGG - Intronic
960535996 3:118815217-118815239 GAGAACTCACTTATTACCAAGGG + Intergenic
960816254 3:121676242-121676264 GGCAAGTTACTTACTACTCCAGG + Intronic
961624041 3:128247144-128247166 GAGATCTCACTTACTAGGACGGG - Intronic
962914589 3:139888526-139888548 GAGAACTCACTCATTACTATGGG + Intergenic
963687171 3:148450955-148450977 AAGAACTCACTTACTACCGTAGG - Intergenic
964078921 3:152727201-152727223 GAGAACTCACTCATTACTACAGG + Intergenic
964895397 3:161589925-161589947 GAGAACTCACTTACTATCATGGG + Intergenic
965249896 3:166329330-166329352 GAGAACTCACTCACTATTTTGGG + Intergenic
965968481 3:174525483-174525505 GAGAACTCACTTATTACCAAGGG + Intronic
966271481 3:178112396-178112418 GAGAACTCACTCATTACCCCAGG - Intergenic
967406335 3:189119624-189119646 GAGAACTCATTCACTACCACAGG - Intronic
967586523 3:191221044-191221066 GAGAACTCACTGACTATCACAGG - Intronic
969220233 4:5754340-5754362 GGGAACTCCCTTCCTTCTCCTGG - Intronic
969543493 4:7808752-7808774 GAGAACTCCCTCATTACTACAGG - Intronic
970052957 4:11936958-11936980 GAGAACTCACTTATTACCATGGG + Intergenic
970571355 4:17386322-17386344 GAGAACTCACTCACTATCACAGG + Intergenic
970739398 4:19216381-19216403 GAGAACTCACTCACTATCACAGG - Intergenic
971729051 4:30352825-30352847 AAGAACTCACTCATTACTGCAGG - Intergenic
971930310 4:33073025-33073047 GAGAAATAACTTTCTACTTCAGG - Intergenic
974156023 4:58073852-58073874 GAGAACTCACTTATCACTAAGGG - Intergenic
974482416 4:62462800-62462822 GAGAACTCACTCACTATCACGGG - Intergenic
974563039 4:63546719-63546741 GAGAACTCACTTATTACCTCGGG + Intergenic
974586134 4:63879682-63879704 GACAACTCACTTACTCCAGCAGG - Intergenic
974778939 4:66526919-66526941 GAGACCTCACTAAATACTCAGGG - Intergenic
976228947 4:82820531-82820553 GTGAACTGACTTCTTACTCCTGG + Intronic
978206744 4:106089277-106089299 AAGAACTCACTTATTACCACTGG + Intronic
980547367 4:134284846-134284868 GAGAACTCACTCATTACTGAAGG + Intergenic
980888408 4:138787933-138787955 GAGAACTCACTTATCACTGAGGG - Intergenic
981158974 4:141474290-141474312 AAGAACTCACTCACCACTTCTGG - Intergenic
981171569 4:141631001-141631023 GAGAACTCACTTATTACCATGGG - Intergenic
981240344 4:142468568-142468590 GAGGACTCACTTACTCTCCCCGG - Intronic
981454776 4:144940778-144940800 GAGAAGTCAGTTCCTCCTCCAGG + Intergenic
981825481 4:148935843-148935865 GAGAACTCACTTATTACTGGGGG - Intergenic
982368231 4:154604043-154604065 GAGGACTCAATTACTACTGATGG + Intergenic
982400531 4:154962796-154962818 GAGAACTCACTCATTACTGTGGG - Intergenic
982699227 4:158640579-158640601 GAGAACTCACTTATTACTGCAGG + Intronic
983268296 4:165531085-165531107 GAGAACTCACTTATCACTCTGGG + Intergenic
983742799 4:171156141-171156163 GAGAACTCACTCACTATCACAGG + Intergenic
984026144 4:174546177-174546199 GAGAACTCACTCACTATTGGGGG + Intergenic
984348539 4:178562511-178562533 GAGAACTCACTCACTATCACGGG + Intergenic
984409074 4:179371850-179371872 GAGAACTCACTCATTACTGTGGG + Intergenic
985374219 4:189316440-189316462 GAGAACTCATTCATTACTGCAGG + Intergenic
986999104 5:13641050-13641072 GAGAACTCACTCTCTACCCGAGG - Intergenic
987951103 5:24677136-24677158 GAGAATTCACTTATTACTGTGGG - Intergenic
988159799 5:27504147-27504169 GAGAACTCACTCACTATTATGGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
989386048 5:40855511-40855533 GAGAACTCACTCACTATCACAGG - Intronic
989419290 5:41217257-41217279 TGGAACTCACTTACTATTGCCGG + Intronic
989603124 5:43218599-43218621 GAGAACTCACTCACTAACACAGG + Intronic
990068382 5:51747460-51747482 GAGAAGTCACTCATTACTACAGG + Intergenic
992229908 5:74654026-74654048 GAGGACTCACTGTCTACACCTGG - Intronic
993017028 5:82545565-82545587 GAGAACTCACTCACCACACAAGG - Intergenic
993397545 5:87409170-87409192 GAGAACTGACTTCCTAATACAGG - Intronic
993725563 5:91362708-91362730 GAAAACTCACTTATTACGCTGGG + Intergenic
994865079 5:105258286-105258308 GAGAACTCACTCTTTACTGCAGG + Intergenic
995249736 5:109978763-109978785 GAGAACTCACTCACTACCAGTGG - Intergenic
999471533 5:151859107-151859129 GAGAATTCACTAACTATGCCAGG - Intronic
1000424965 5:161079821-161079843 AAGAACTCACTCATTACTGCAGG - Intergenic
1000594734 5:163201917-163201939 GAGAACTCACTTATTACCATGGG - Intergenic
1001033569 5:168280547-168280569 GAGAACTCACTTATTACAGGAGG + Intergenic
1001627657 5:173149802-173149824 GAGAGCTCACTTACCACTAAGGG + Intronic
1003152787 6:3566620-3566642 GAGAACTCACTCACTACCTCGGG - Intergenic
1003788915 6:9520567-9520589 GAGAACTCACTTATTACTGCGGG + Intergenic
1005188965 6:23196279-23196301 GAGATCTCACTTACTACCAAGGG - Intergenic
1005797287 6:29378845-29378867 GAGCACTCATATACTCCTCCAGG + Intronic
1011694928 6:89903736-89903758 GAGAGCTCACTTATTACTGAGGG + Intergenic
1012251031 6:96981056-96981078 GAGAACTCACTCACTATCACAGG + Intronic
1012528380 6:100204696-100204718 GAGAACTCACTCATTACTATGGG + Intergenic
1014295416 6:119611565-119611587 GAGAATTCACTGAATACCCCAGG + Intergenic
1015190311 6:130465082-130465104 GAGAACTCACTCATCACTGCAGG + Intergenic
1016047244 6:139493331-139493353 GAGAACTCACTCACTATCACGGG + Intergenic
1018526283 6:164713445-164713467 GAGAACTCACTCACTATCACAGG - Intergenic
1018616234 6:165689527-165689549 GAGAACTCACTTACCACCACAGG - Intronic
1019074261 6:169374728-169374750 GAGAACTCACCTATTGCTCTGGG - Intergenic
1020863370 7:13523102-13523124 GAGAACTTACTTTCTACTGGAGG - Intergenic
1021117372 7:16759434-16759456 GAGAACTCACTTATCACTGAGGG + Intronic
1022218677 7:28290592-28290614 GAGAACTCACTCACTATCACAGG - Intergenic
1022361941 7:29669188-29669210 GAGAACTCCCTTATTACTGTGGG - Intergenic
1022409631 7:30128934-30128956 GAGAATTCACTCATTACTGCAGG + Intronic
1022699453 7:32744547-32744569 GAGAACTCCCTTATTACTGTGGG + Intergenic
1023215554 7:37858885-37858907 GAGAACTCACTCATTACTGTAGG - Intronic
1024391850 7:48822754-48822776 GAGAACTCACTCACTATTATGGG - Intergenic
1024838328 7:53551806-53551828 GAGAACTCACGTGCTCCTCATGG - Intergenic
1025908690 7:65810170-65810192 GAGAACTCACTTATTACCATGGG + Intergenic
1026288696 7:68986536-68986558 GAGAACTTACTCATTACTACTGG - Intergenic
1026655197 7:72250638-72250660 AAGAACTCACTCATTACTGCAGG - Intronic
1027148560 7:75716006-75716028 GAGAACTCACTCATGACTGCGGG + Intronic
1027710134 7:81590275-81590297 GGGAAGTCACTTAATACCCCTGG - Intergenic
1028289431 7:89046069-89046091 GAGAACTCACTCACTTATCACGG - Intronic
1029883104 7:103837590-103837612 GAGAAATCACTTACTATGCTAGG + Intronic
1029944365 7:104516256-104516278 GAGAACTCACTCACTATCACAGG + Intronic
1030834367 7:114264902-114264924 GAGAAGTCACTCACTATGCCAGG + Intronic
1030895354 7:115052922-115052944 GAGAACTCTCTTACTATCACAGG + Intergenic
1031571907 7:123369610-123369632 GAGAACTCACTCATTACCTCAGG - Intergenic
1033116895 7:138633372-138633394 GAGAACTCACTCGTTACTGCAGG - Intronic
1033845017 7:145421223-145421245 GAGAACTCACTCATTACCTCAGG - Intergenic
1034750845 7:153567713-153567735 GAGAACTCACTCATTACCACAGG + Intergenic
1035147056 7:156829390-156829412 GAGAACTCACTCATTACTGTAGG - Intronic
1035406608 7:158602737-158602759 GAGACCTCACTTGCTAGGCCTGG - Intergenic
1035494965 7:159316630-159316652 GAGAACTCACTCACTATCACAGG + Intergenic
1036134671 8:6149721-6149743 GACAACTCACTCACTACTGCAGG + Intergenic
1039083723 8:33759249-33759271 GAGAACACACTCATTACTGCAGG - Intergenic
1039837312 8:41266932-41266954 GAGAAATCAGTTTCTACTACTGG + Intronic
1042860868 8:73312469-73312491 GAGAACTCAGTCACTGTTCCTGG - Intronic
1044619317 8:94173314-94173336 GAGAACTCACTTACCACCAAGGG - Intronic
1044620151 8:94182593-94182615 GAGAAGTCACCTTCTATTCCTGG - Intronic
1046221395 8:111220497-111220519 CAAAACTCACTTACTATTCAAGG + Intergenic
1046223951 8:111252034-111252056 GAGAACTCACTCACTATCACAGG + Intergenic
1046282127 8:112047645-112047667 GAGAATTCAAGTACTACTCAGGG + Intergenic
1046853001 8:118996935-118996957 GAGAACTCACTCATTACCACAGG + Intronic
1048190089 8:132280492-132280514 GAGAACTCACTCACTATAGCGGG + Intronic
1049051872 8:140204120-140204142 GAGAACTCACTCATTACTGTGGG - Intronic
1050181026 9:2923177-2923199 GAGAGCACACTTACTACTATTGG + Intergenic
1050657495 9:7845089-7845111 CAGAACTCACTCATTACTGCAGG + Intronic
1054865516 9:69996401-69996423 GAGAACTCACTCATTACCGCAGG - Intergenic
1055856353 9:80692381-80692403 GAGAACTCACTTGCAACTCAAGG - Intergenic
1056056142 9:82826108-82826130 GAGAGGTCACTTAGAACTCCTGG + Intergenic
1056969272 9:91189043-91189065 GAGAACTCACTTCTTACTGTGGG + Intergenic
1057837961 9:98461923-98461945 GAGAACTCACTTGCTACCAAAGG + Intronic
1058711325 9:107681927-107681949 GAGAACACCCTTCCTCCTCCCGG + Intergenic
1058753608 9:108063813-108063835 GAGAACTCACTCACTATTATCGG + Intergenic
1059143114 9:111873131-111873153 GAGAACTCACTCACTATCCCCGG - Intergenic
1059475229 9:114541139-114541161 GAGAACTCACTTATCACTAAGGG - Intergenic
1061307526 9:129740673-129740695 GAAAACTCACCTACTTCTGCTGG + Intronic
1186289364 X:8079959-8079981 GAGAACTCACTCACTATAACGGG - Intergenic
1186385570 X:9107188-9107210 GATAACTCACTCATTACTGCAGG - Intronic
1188292568 X:28407085-28407107 GAGAACTCACTCACTATCACGGG + Intergenic
1188475737 X:30589729-30589751 GAGAACTCACTCATTACTGCAGG + Intergenic
1189285508 X:39849560-39849582 GAGAACTCACTTATCACTGAAGG - Intergenic
1189410484 X:40766045-40766067 GAGAACTCACTTACCACCAAGGG - Intergenic
1190366653 X:49700952-49700974 GAGAACTCACTCACTGTTACAGG - Intergenic
1191857487 X:65639036-65639058 GATATCTCACTTGCTCCTCCTGG + Intronic
1195567182 X:106354576-106354598 GAGAACTCACTTACTACCACAGG - Intergenic
1196087832 X:111705519-111705541 GAGAACTCACTGCCTAACCCAGG + Intronic
1196173507 X:112615925-112615947 GAGAACTCACTCACTATGACGGG - Intergenic
1196231420 X:113227232-113227254 GAGAATTCACTTACTATTGTGGG + Intergenic
1196605792 X:117655669-117655691 GATAACTCACTCACTATTACAGG + Intergenic
1196754079 X:119142865-119142887 GAGAACTCACTCATTACCACTGG + Intronic
1197134529 X:123045605-123045627 GTGAACTCACTCACTATTACAGG - Intergenic
1197538166 X:127717935-127717957 GAGAACTCACTCACTATTACAGG + Intergenic
1198817388 X:140607022-140607044 GAGAACTCACTTATTACCATGGG + Intergenic
1198937531 X:141914331-141914353 GAGAACTCACTCACTACAAGGGG - Intergenic
1198961521 X:142188535-142188557 GAGAACTCACTCACTACAAGGGG + Intergenic
1199320931 X:146438225-146438247 GAGAACTCACTCATTACCACGGG + Intergenic
1200885184 Y:8260561-8260583 GACAACTCACTTATTACCCATGG + Intergenic
1201345959 Y:12985003-12985025 GAGAACACACTCACTTTTCCTGG + Intergenic