ID: 1127085434

View in Genome Browser
Species Human (GRCh38)
Location 15:55420156-55420178
Sequence GATTTAGCTTTATCTTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127085434_1127085437 -3 Left 1127085434 15:55420156-55420178 CCTGGAGAAGATAAAGCTAAATC 0: 1
1: 0
2: 3
3: 22
4: 220
Right 1127085437 15:55420176-55420198 ATCAAAAGAAGGCTATTCTAGGG 0: 1
1: 0
2: 0
3: 17
4: 217
1127085434_1127085439 13 Left 1127085434 15:55420156-55420178 CCTGGAGAAGATAAAGCTAAATC 0: 1
1: 0
2: 3
3: 22
4: 220
Right 1127085439 15:55420192-55420214 TCTAGGGAGAGGAAACTATATGG 0: 1
1: 0
2: 4
3: 19
4: 213
1127085434_1127085436 -4 Left 1127085434 15:55420156-55420178 CCTGGAGAAGATAAAGCTAAATC 0: 1
1: 0
2: 3
3: 22
4: 220
Right 1127085436 15:55420175-55420197 AATCAAAAGAAGGCTATTCTAGG 0: 1
1: 0
2: 4
3: 33
4: 269
1127085434_1127085438 2 Left 1127085434 15:55420156-55420178 CCTGGAGAAGATAAAGCTAAATC 0: 1
1: 0
2: 3
3: 22
4: 220
Right 1127085438 15:55420181-55420203 AAGAAGGCTATTCTAGGGAGAGG 0: 1
1: 0
2: 1
3: 32
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127085434 Original CRISPR GATTTAGCTTTATCTTCTCC AGG (reversed) Intronic
900162499 1:1230943-1230965 GAACTAGCTTTATTTTCTCTAGG - Intronic
900684061 1:3936020-3936042 GATTTACCATTTTCTTCTCCAGG - Intergenic
900795237 1:4703829-4703851 CATTCAGATGTATCTTCTCCTGG - Intronic
906227331 1:44132688-44132710 GATTCATCTTTATCTGCCCCAGG - Intronic
906627643 1:47338360-47338382 GATTTGCCTTTACCTTCTCTAGG - Intronic
906844132 1:49172427-49172449 GATGTAGCATAATCTTCTCAGGG - Intronic
907718937 1:56953681-56953703 ACTTTAGCTTTATCATCTGCAGG - Intronic
908045727 1:60166438-60166460 TATTTATCTTTATGTTGTCCAGG + Intergenic
909097606 1:71307817-71307839 GATCTATCTTCATCTTCTGCAGG + Intergenic
910219844 1:84879244-84879266 TATTTAGCTTTATGTTCTGTAGG + Intronic
910228034 1:84956387-84956409 GATGTACCTTTATCGTCTTCTGG - Intronic
910716656 1:90238298-90238320 TTTATAGCTTTATCTTTTCCTGG + Intergenic
911002186 1:93178404-93178426 GATTAAATTTTATTTTCTCCAGG + Intronic
911207674 1:95108708-95108730 GATTTAACTTTATTTTTTCCAGG + Intergenic
913227970 1:116716958-116716980 CATTTAGCATTATATTATCCAGG - Intergenic
913614919 1:120548841-120548863 GATTAAGCTACAACTTCTCCAGG + Intergenic
914575350 1:148962066-148962088 GATTAAGCTACAACTTCTCCAGG - Intronic
917601052 1:176574287-176574309 GAATTAATTTTGTCTTCTCCAGG + Intronic
917756755 1:178109101-178109123 GACATAGCTTTATTTACTCCAGG + Intronic
918899540 1:190396144-190396166 TATTTAACTTTATTATCTCCTGG - Intronic
919698526 1:200606895-200606917 GATTTGTCTTTATTTTATCCAGG + Intronic
921807204 1:219469634-219469656 AATTTAACTTTATCTTCTTTTGG - Intergenic
923108225 1:230870314-230870336 CATATATCTTTATCTACTCCTGG + Intergenic
1063130957 10:3176081-3176103 TATTTGCCTTTATCTTCACCTGG - Intergenic
1066100279 10:32111476-32111498 TATTTACCGTTATCTTCTCTTGG + Intergenic
1068214332 10:53964138-53964160 AATTTACCTTCCTCTTCTCCAGG + Intronic
1069220771 10:65880390-65880412 CATTTATTTTTATCCTCTCCTGG - Intergenic
1073416626 10:103389096-103389118 GAGTTGGCATTAGCTTCTCCAGG + Exonic
1074318801 10:112382051-112382073 GAATTGGCTTTATCTTCTACTGG + Intronic
1075308508 10:121390613-121390635 GAGTTAGCCTTATCCTTTCCTGG + Intergenic
1075773781 10:124965125-124965147 GCTTTAGCTTTGACTTCTCTAGG + Intronic
1075919962 10:126202527-126202549 GAGTGACCTTTATCTTCTTCTGG - Intronic
1076254326 10:129009201-129009223 AATTTTGCTTTATTCTCTCCTGG - Intergenic
1077682498 11:4255910-4255932 TATTTAACTTAATGTTCTCCAGG + Intergenic
1077687535 11:4310829-4310851 TATTTAACTTAATGTTCTCCAGG - Intergenic
1077692703 11:4362017-4362039 TATTTAACTTAATGTTCTCCAGG - Intergenic
1079164392 11:18025541-18025563 GAATTAGCTATATTTTCACCTGG - Intronic
1080249340 11:30215467-30215489 TATTTAGCATTATGTCCTCCAGG - Intergenic
1081107975 11:39095557-39095579 GATTTATATTTATATTTTCCAGG - Intergenic
1081191782 11:40112886-40112908 GATTTAGCATTGCCCTCTCCTGG + Intergenic
1081636206 11:44723895-44723917 GAGTCAGCCTTATCTTGTCCAGG + Intergenic
1084108453 11:66996977-66996999 CATTTAGCTTCTGCTTCTCCTGG - Intergenic
1089102678 11:115976720-115976742 GATGTGGCTTTATCTTCTCCAGG + Intergenic
1091082758 11:132687219-132687241 GATTTAGCTTTATCCTATTAAGG + Intronic
1092056916 12:5514968-5514990 TATTTATCTTTGTCATCTCCTGG - Intronic
1094311722 12:29091573-29091595 CACTTAGCTTAATGTTCTCCAGG - Intergenic
1095358117 12:41301625-41301647 GATTTAGCATTATCTTTTTTGGG - Intronic
1096239120 12:49950152-49950174 CATTAAGCTTCACCTTCTCCTGG - Intergenic
1096662825 12:53139244-53139266 GTTTTAGATTTTTCTTCTTCAGG + Intergenic
1098266378 12:68725049-68725071 GATCTAGCTTTGTTTTCTTCTGG - Intronic
1099201911 12:79688762-79688784 GCTTTCACTTTTTCTTCTCCTGG - Intronic
1099457153 12:82877829-82877851 GATTTTGTTTTTTCTTCTACTGG - Intronic
1099758562 12:86889238-86889260 CACTTAGGTTTATGTTCTCCAGG + Intergenic
1104080191 12:125423188-125423210 TAAATATCTTTATCTTCTCCTGG - Intronic
1106622376 13:31383125-31383147 CATTTAGCATAATGTTCTCCAGG + Intergenic
1107791337 13:44005181-44005203 ACTTTACCTTTATTTTCTCCAGG + Intergenic
1108691817 13:52865931-52865953 CATTCAGCTTTCTCTTCTCCAGG - Intergenic
1109133732 13:58621973-58621995 CATTTACCTCTATCTTCTTCAGG - Intergenic
1109831005 13:67788716-67788738 TCTTTAACTTTTTCTTCTCCTGG + Intergenic
1111265100 13:85800530-85800552 GATATAGTTTTATCGTCTCAGGG + Intergenic
1112966034 13:105195478-105195500 TATTTAGCTTTCTCTTGTCTTGG + Intergenic
1113221686 13:108111655-108111677 TATTTAGCTATATCTTCTGCAGG - Intergenic
1115632484 14:35259074-35259096 GATTTGGCTATTTCTCCTCCTGG + Intronic
1116341658 14:43730885-43730907 CATTTAGCATTATGTCCTCCAGG - Intergenic
1117444851 14:55794359-55794381 GATTTTGCTTTATCTTTTCTCGG - Intergenic
1119101327 14:71882688-71882710 GGATTAGCTTTCTTTTCTCCTGG - Intergenic
1120152312 14:81050256-81050278 GATTTAACTTTCCTTTCTCCTGG - Intronic
1123693176 15:22856258-22856280 TATTTAGCTTTATTTCCTTCTGG - Intronic
1126414850 15:48406833-48406855 GATCAACCTTTTTCTTCTCCTGG - Intergenic
1127085434 15:55420156-55420178 GATTTAGCTTTATCTTCTCCAGG - Intronic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1129427459 15:75474222-75474244 AAATTAGCTTTATCTTGGCCGGG + Intronic
1129943055 15:79515206-79515228 TATTTAGTTTTTTCTTCCCCTGG - Intergenic
1131522543 15:93127233-93127255 GACTTAATTTTATCTTCTCAAGG - Intergenic
1133599870 16:7328676-7328698 GATTTTGCTTTTTCTTAGCCAGG - Intronic
1134661895 16:15990599-15990621 CATTTAGCATAATGTTCTCCAGG + Intronic
1135131479 16:19857469-19857491 AATGTACCTTTATCTTCCCCCGG - Exonic
1137987448 16:53121293-53121315 GATTTAGATGCAACTTCTCCAGG + Intronic
1143310951 17:5988797-5988819 GATTTAACTCTAGCTTCACCAGG - Intronic
1144318500 17:14088569-14088591 AATTTATCTTTACCTTCCCCTGG - Intronic
1148088019 17:45006428-45006450 GATTTGGATTTATCTGCTCCTGG - Intergenic
1150259655 17:63778475-63778497 GATTTAGTTTTTCTTTCTCCTGG + Intronic
1156747670 18:40412012-40412034 GGGTTAGCTGGATCTTCTCCTGG - Intergenic
1160414376 18:78697891-78697913 TATTTAGCTTTCTCTTCTCTGGG + Intergenic
1160900060 19:1423413-1423435 TCTTTAGATTTCTCTTCTCCAGG + Intronic
1161169217 19:2804703-2804725 GATTTAGCTTTAACCTCTCTGGG + Intronic
1162043849 19:7985947-7985969 GAGGCAGCTTTGTCTTCTCCAGG - Intronic
1164727169 19:30473816-30473838 GTTTTAGCTGTCTCTCCTCCAGG + Intronic
1164909628 19:31995314-31995336 GATTTAGTTTTACTTTCTTCTGG - Intergenic
925171177 2:1751066-1751088 GCTTAAGCTTCATGTTCTCCGGG + Intergenic
925452884 2:3985717-3985739 GGTTCAGCTTTATCATCTCATGG - Intergenic
926856848 2:17266068-17266090 GATTTATCCATATCTTTTCCTGG + Intergenic
927433544 2:23047609-23047631 GGAACAGCTTTATCTTCTCCAGG - Intergenic
927464348 2:23325731-23325753 CATTTAGGTTTATTTTCTTCTGG - Intergenic
927761210 2:25756413-25756435 GATTCAGCTTTATTTTCTACTGG - Intronic
928173266 2:29017180-29017202 GCTTCAGCTGCATCTTCTCCCGG - Exonic
928236159 2:29542976-29542998 GATTTATCTTTGTTTTCTCTGGG + Intronic
930576512 2:53157030-53157052 GACTTAGCATTATCTCCTCAAGG + Intergenic
931650389 2:64463213-64463235 GACTTAACTTTCTCTTCTCTAGG + Intergenic
933449473 2:82428707-82428729 GCTTCAACTTGATCTTCTCCTGG + Intergenic
933627852 2:84622218-84622240 CATTTAGCTTAATATCCTCCAGG + Intronic
933634254 2:84689938-84689960 TTCTTAGCTTTATCTTCTCCAGG + Intronic
935819829 2:106883742-106883764 GATTGAGTTTTTTCTTTTCCTGG - Intronic
936492768 2:112987160-112987182 CATTTAGCATAATGTTCTCCAGG + Intergenic
936637100 2:114271436-114271458 GAGGTTGCTTTATCATCTCCAGG - Intergenic
938201871 2:129378719-129378741 GATCTTGCTTAATTTTCTCCAGG - Intergenic
938243157 2:129758600-129758622 GGATTAGCTTCAGCTTCTCCAGG - Intergenic
939457238 2:142453239-142453261 TATTTAACTTTAGCTTCTTCTGG - Intergenic
940548116 2:155115882-155115904 GGTTTAGCTTTTTGCTCTCCTGG - Intergenic
941172731 2:162159477-162159499 TATTTAGCATAATCTTCTCAAGG + Intergenic
941815392 2:169790689-169790711 GGTTTAGCTCTATGTTGTCCAGG + Intergenic
942784939 2:179689876-179689898 GAATTAGCTGTATCCTTTCCTGG + Intronic
942896929 2:181068638-181068660 GATTTACCTTTTCCTTCTCTTGG - Intronic
942934380 2:181537205-181537227 GATTTAGAACTGTCTTCTCCAGG + Intronic
944246257 2:197533323-197533345 AATTTAGCTGTATCTCCTCAAGG + Intronic
944528337 2:200642792-200642814 GATTTAGTATTACCTTCTCAGGG - Exonic
947087486 2:226471736-226471758 GATTTAGCTTTAGCTTTTTGGGG - Intergenic
947429652 2:230015124-230015146 GATTTAGTTTGTTCTTCTACTGG - Intergenic
1172455097 20:35064864-35064886 GAATAACCATTATCTTCTCCTGG + Intronic
1173397856 20:42697230-42697252 GATTCAGCCACATCTTCTCCAGG - Intronic
1174551348 20:51364353-51364375 GATGTATCTTTATCATCTTCTGG - Intergenic
1175015877 20:55790142-55790164 GAGTTAGGTATTTCTTCTCCCGG - Intergenic
1175572785 20:60036789-60036811 GATTTTGCTGTATCTCCCCCTGG + Intergenic
1177180172 21:17736315-17736337 GGTTTTGCTTTCTCTTCTCAAGG + Intergenic
1177623889 21:23633788-23633810 AATTTAGCTTTTATTTCTCCAGG - Intergenic
1178904552 21:36625617-36625639 CATTGAGATTTATCATCTCCAGG + Intergenic
1179170571 21:38969892-38969914 GATTTTGCTTTACCTGATCCGGG - Intergenic
1183138235 22:35911178-35911200 CATTTATCTTTATCTCCCCCAGG + Intronic
949742176 3:7248966-7248988 GATCTATATTTATTTTCTCCTGG - Intronic
950570847 3:13799058-13799080 GAGCTAGCTTTGTCTTTTCCTGG - Intergenic
951188756 3:19744887-19744909 AATCTAGCTTAACCTTCTCCTGG + Intergenic
951522059 3:23619491-23619513 GGTTTAGCTTTATTATCTCTGGG + Intergenic
951844001 3:27065954-27065976 GAGTTAGCTTTATCTAGTCATGG - Intergenic
951996076 3:28730736-28730758 GAATGAGCTTGTTCTTCTCCTGG - Intergenic
952644786 3:35641938-35641960 GTTTTAGATTTATCCTCTCCAGG + Intronic
953179944 3:40585693-40585715 GAGTCTCCTTTATCTTCTCCTGG + Intergenic
954703212 3:52463238-52463260 CATTTAGCCTTATCTTTTCAAGG + Intronic
955170629 3:56561235-56561257 GGTTGATTTTTATCTTCTCCAGG + Intronic
957759954 3:84542473-84542495 TATTTAGCTTTCTGTTCTGCAGG - Intergenic
960165333 3:114395070-114395092 GAGACAGCTTTATCTTCACCTGG - Intronic
960253857 3:115489142-115489164 GCTTGATCTTTTTCTTCTCCTGG + Intergenic
962158206 3:132971502-132971524 CATTTAGCTTAATGTCCTCCAGG - Intergenic
963012306 3:140782104-140782126 TCTTTAGATTTATCTTCTCTGGG - Intergenic
964615433 3:158659271-158659293 GAATTAGCTATATTTTCTCAAGG + Intronic
965051689 3:163658180-163658202 GATATAGCTTGTTCTGCTCCTGG - Intergenic
965178345 3:165365575-165365597 TCTTTAGCTTTATATTCTCCAGG + Intergenic
967545372 3:190720221-190720243 GATTTATCTTTATCTTTTAAGGG + Intergenic
973777826 4:54259425-54259447 GAGTCACCTTTATCTTCTCTAGG + Intronic
974281218 4:59796531-59796553 GATTTTGCGTTATCTTTTCTAGG - Intergenic
974354408 4:60794096-60794118 GATTTAGCTTTTGTTTCTCCTGG + Intergenic
974370472 4:61010388-61010410 GATTTAGCTTTATTTATTCTAGG + Intergenic
975070143 4:70124893-70124915 CATTTAGCATAATGTTCTCCAGG - Intergenic
975084748 4:70324634-70324656 GACTTAACATTATCTTCTCCAGG - Intergenic
975621157 4:76298267-76298289 GACTTAGCTCAATTTTCTCCTGG + Intronic
976746968 4:88412834-88412856 GATTTCACTTTATTTTCTTCAGG + Intronic
976883459 4:89958877-89958899 TATTTAGCTTTCTCTTCAGCTGG - Intergenic
979134144 4:117086997-117087019 GACTTTCCTTTATCTGCTCCTGG - Intergenic
979738743 4:124123080-124123102 GATTTATGTTAAGCTTCTCCTGG + Intergenic
979771203 4:124526773-124526795 GAGTCAGCTTTTTCTTCTCATGG + Intergenic
979821176 4:125173400-125173422 TATTTAGGCTTCTCTTCTCCAGG + Intergenic
981141643 4:141276262-141276284 TATTTAGCTCTGTCTTCTTCAGG + Intergenic
981176710 4:141690964-141690986 GATTTATTTTTATCATCTCTAGG + Intronic
982302369 4:153892800-153892822 GTATTAGCTTTTTCTTCCCCAGG + Intergenic
982350625 4:154411096-154411118 GATTTAGCATAATGTTCTCCAGG - Intronic
984482167 4:180319365-180319387 GTTTTTGCTTTTTCTCCTCCTGG - Intergenic
985638570 5:1052518-1052540 GAGTGAGGTTTATCCTCTCCTGG + Intronic
985871322 5:2559645-2559667 CTTTTAACTTTATATTCTCCAGG + Intergenic
987784743 5:22485532-22485554 GATTTAACTTTATGTTGGCCAGG - Intronic
987978489 5:25047178-25047200 AATTTAGCTTGTTGTTCTCCTGG - Intergenic
988018025 5:25585091-25585113 GATTTTTTTTTTTCTTCTCCTGG + Intergenic
988116825 5:26904554-26904576 AATTTAGCTATATCATCTTCAGG + Intronic
988948555 5:36233428-36233450 GAGTTAGCTTTATCTCCTAGTGG - Intronic
989314187 5:40057801-40057823 GATTTAGCATTATATTTTACAGG - Intergenic
993223886 5:85140449-85140471 GGTTTAGTTTTATCTTTTCATGG + Intergenic
993385380 5:87256387-87256409 CATATAGCTTTATTTTCACCAGG - Intergenic
993398843 5:87423674-87423696 GATTTAACTATATCCTCTCTAGG - Intergenic
994432092 5:99679364-99679386 ATTCTAGCTTTTTCTTCTCCAGG - Intergenic
994773168 5:104009478-104009500 GATTTTGGTTTTTCTTCTCAAGG + Intergenic
996139044 5:119882209-119882231 CATTTAGCATGATATTCTCCAGG - Intergenic
996917304 5:128727536-128727558 AAATTAGCTTTTTCTTCTCTGGG + Intronic
998624583 5:143831646-143831668 GTTTTACCTATATCATCTCCTGG - Intergenic
998874217 5:146583131-146583153 GCTTTTCCTTTCTCTTCTCCTGG + Intronic
999618089 5:153446396-153446418 GATTTAGCATTTTCTTTTCCTGG - Intergenic
999939405 5:156524858-156524880 GATTTAGCTTAATGTTCTCCAGG + Intronic
1000903996 5:166940995-166941017 GATGTATCTTGATCTTCTCTAGG - Intergenic
1003450306 6:6224898-6224920 CATTTAGGTTTGTCTACTCCAGG + Intronic
1005054014 6:21712573-21712595 GAATTAACTTATTCTTCTCCAGG + Intergenic
1005275282 6:24210477-24210499 GAATTATCTTTATTTCCTCCTGG + Intronic
1005437150 6:25826454-25826476 GATGTACCTTTATATTATCCAGG + Exonic
1005899912 6:30208351-30208373 GACACAGCTTTTTCTTCTCCTGG - Intronic
1008910803 6:56730380-56730402 GATTTAGCTTTTGCTTTTCTCGG - Intronic
1010079980 6:71849716-71849738 CATTTATCTTTAGTTTCTCCAGG - Intergenic
1010983951 6:82401146-82401168 GATTGGGCTTTCTCTTATCCAGG + Intergenic
1012648677 6:101723217-101723239 GATTTATCTTTTTTTTCTCCAGG + Intronic
1014112411 6:117634093-117634115 GATGTAGCTTATTATTCTCCAGG - Intergenic
1021456234 7:20832129-20832151 AGTTTAGCTTTGTATTCTCCTGG + Intergenic
1022433151 7:30347800-30347822 AATCTAGATTTATATTCTCCAGG + Intronic
1023248445 7:38232300-38232322 GATTGAGTTATATATTCTCCTGG + Intergenic
1027348114 7:77282617-77282639 CATTTAGTTTCATCTTCTCTTGG - Exonic
1031672792 7:124570868-124570890 GATTTAGCCTAATGTCCTCCAGG + Intergenic
1032545750 7:132740634-132740656 GATTTAGCTCTATCACCTGCTGG - Intergenic
1032856701 7:135840263-135840285 TATTCAGTGTTATCTTCTCCAGG + Intergenic
1033218248 7:139509905-139509927 TATGTAGCTTTTTCTTCCCCAGG + Intergenic
1033883796 7:145919768-145919790 TTTTTATCTTTCTCTTCTCCTGG + Intergenic
1034487981 7:151378030-151378052 GATTTAGATATATTTTCTCCAGG + Exonic
1036102780 8:5805521-5805543 GATTGAGCCTTATCTTAGCCAGG - Intergenic
1036597016 8:10222699-10222721 CATTTAGCATAATGTTCTCCAGG - Intronic
1037335230 8:17785352-17785374 GCTCAAGCTTTATCTTCTTCTGG - Intronic
1038148227 8:24917872-24917894 GATTTGGCTTTCTCTTCCACTGG - Exonic
1038261414 8:25999154-25999176 TATTTTGCTTTCTCTTCTCAAGG - Intronic
1040406012 8:47103016-47103038 GATTTAGTTTTATCTTTTTTTGG - Intergenic
1040820288 8:51548229-51548251 GTTTTAGATTTCTCTTCTTCAGG - Intronic
1042468397 8:69155043-69155065 AATTTAGATTGATCTACTCCAGG - Intergenic
1042821376 8:72933766-72933788 GATTTATCTAAATCTTCTCAAGG + Intronic
1043613927 8:82102181-82102203 GATTTAAGTTTATATTCTCTGGG - Intergenic
1045147013 8:99357032-99357054 GAATTAGCTTTATTTTTTCAGGG - Intronic
1046642629 8:116749567-116749589 GAATTAGCTTGATCTTGTCTAGG + Intronic
1046659864 8:116938006-116938028 GACTCAGCTTAAACTTCTCCTGG + Intergenic
1047518264 8:125574192-125574214 AAGTTAGCGTTTTCTTCTCCTGG + Intergenic
1052446154 9:28564348-28564370 TATTTAGAATTATCTACTCCCGG - Intronic
1052530414 9:29676124-29676146 GATTTACATTTCTCTTCTGCAGG + Intergenic
1053473690 9:38365472-38365494 CCTTTAGTTTTATCTTTTCCAGG + Intergenic
1054750693 9:68902856-68902878 GATTTATCTTTAGCTTTTCTGGG - Intronic
1055041483 9:71878393-71878415 GTCTTATCTTTATTTTCTCCTGG - Intronic
1055732443 9:79292238-79292260 GATCTAGCTATATTTTCTGCTGG - Intergenic
1058226387 9:102369716-102369738 CACTTAGCATTATGTTCTCCAGG - Intergenic
1059629446 9:116104847-116104869 TATTTAGCTTTGTGGTCTCCTGG + Intergenic
1061011651 9:127959352-127959374 GATTTAGCTTCATGTTTTCAAGG - Intronic
1061248621 9:129414029-129414051 GATTTGGCTTTTCCTTCCCCCGG - Intergenic
1185907402 X:3948487-3948509 TATATAACTTTATCTTCCCCAGG - Intergenic
1188140568 X:26545392-26545414 GAGTGAGCTTTAACTTCTTCAGG - Intergenic
1189352777 X:40289204-40289226 CATTTACCTTTATCTTCTCCAGG + Intergenic
1189396371 X:40626609-40626631 GATTTAGCCTATTCTTCACCAGG - Intergenic
1189463296 X:41259610-41259632 GATTTAGCTTTTGCTGCTGCCGG + Intergenic
1189673178 X:43433944-43433966 CATTTAGCATAATGTTCTCCAGG - Intergenic
1190751261 X:53363688-53363710 GTTTTGACTTTATCTTCTACTGG - Intergenic
1192616031 X:72623601-72623623 GATTTATCTTCATTCTCTCCAGG - Intronic
1192769630 X:74174118-74174140 GAGTTGGCATTAGCTTCTCCAGG - Intergenic
1193305003 X:79938682-79938704 CACTTAGCATTATGTTCTCCAGG + Intergenic
1195091032 X:101459234-101459256 GATTTAATTTTAACTTCTGCAGG + Intronic
1197055362 X:122112662-122112684 CATTTAGATTTATCTTCTGCAGG + Intergenic
1198137551 X:133769096-133769118 CATTTAGCATAATGTTCTCCAGG - Intronic
1198440153 X:136655248-136655270 GACTGAGCTTTTTCTTCTCCAGG + Intronic
1198493521 X:137167240-137167262 GATTTAGCTTTAATTTTTCCAGG + Intergenic
1198789805 X:140332084-140332106 CATTTAGCATAATTTTCTCCAGG + Intergenic
1201984939 Y:19955652-19955674 TACTTAGCTTAATTTTCTCCAGG + Intergenic