ID: 1127088995

View in Genome Browser
Species Human (GRCh38)
Location 15:55448083-55448105
Sequence CTCAGTAAGCTAGATATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14147
Summary {0: 1, 1: 31, 2: 487, 3: 3648, 4: 9980}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127088995_1127088996 15 Left 1127088995 15:55448083-55448105 CCATCAATATCTAGCTTACTGAG 0: 1
1: 31
2: 487
3: 3648
4: 9980
Right 1127088996 15:55448121-55448143 GTGCTGTTGAATTTTGTCAAAGG 0: 120
1: 2127
2: 6333
3: 3633
4: 2293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127088995 Original CRISPR CTCAGTAAGCTAGATATTGA TGG (reversed) Intronic
Too many off-targets to display for this crispr