ID: 1127096303

View in Genome Browser
Species Human (GRCh38)
Location 15:55515089-55515111
Sequence AAGGGCCGGTTAAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127096303_1127096312 8 Left 1127096303 15:55515089-55515111 CCCCCAGAGTTTAACCGGCCCTT No data
Right 1127096312 15:55515120-55515142 ATAATGCTCCACGCACTTGGAGG No data
1127096303_1127096311 5 Left 1127096303 15:55515089-55515111 CCCCCAGAGTTTAACCGGCCCTT No data
Right 1127096311 15:55515117-55515139 TATATAATGCTCCACGCACTTGG No data
1127096303_1127096315 18 Left 1127096303 15:55515089-55515111 CCCCCAGAGTTTAACCGGCCCTT No data
Right 1127096315 15:55515130-55515152 ACGCACTTGGAGGGTTAGAAAGG No data
1127096303_1127096313 9 Left 1127096303 15:55515089-55515111 CCCCCAGAGTTTAACCGGCCCTT No data
Right 1127096313 15:55515121-55515143 TAATGCTCCACGCACTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127096303 Original CRISPR AAGGGCCGGTTAAACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr