ID: 1127098261

View in Genome Browser
Species Human (GRCh38)
Location 15:55535284-55535306
Sequence AACAGCCTTGGGTGTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127098251_1127098261 4 Left 1127098251 15:55535257-55535279 CCCAGGCCTGATTGAGCCTGCCT No data
Right 1127098261 15:55535284-55535306 AACAGCCTTGGGTGTCCTGGGGG No data
1127098252_1127098261 3 Left 1127098252 15:55535258-55535280 CCAGGCCTGATTGAGCCTGCCTG No data
Right 1127098261 15:55535284-55535306 AACAGCCTTGGGTGTCCTGGGGG No data
1127098249_1127098261 14 Left 1127098249 15:55535247-55535269 CCTCCTGGGGCCCAGGCCTGATT No data
Right 1127098261 15:55535284-55535306 AACAGCCTTGGGTGTCCTGGGGG No data
1127098250_1127098261 11 Left 1127098250 15:55535250-55535272 CCTGGGGCCCAGGCCTGATTGAG No data
Right 1127098261 15:55535284-55535306 AACAGCCTTGGGTGTCCTGGGGG No data
1127098248_1127098261 15 Left 1127098248 15:55535246-55535268 CCCTCCTGGGGCCCAGGCCTGAT No data
Right 1127098261 15:55535284-55535306 AACAGCCTTGGGTGTCCTGGGGG No data
1127098253_1127098261 -2 Left 1127098253 15:55535263-55535285 CCTGATTGAGCCTGCCTGTCAAA No data
Right 1127098261 15:55535284-55535306 AACAGCCTTGGGTGTCCTGGGGG No data
1127098247_1127098261 16 Left 1127098247 15:55535245-55535267 CCCCTCCTGGGGCCCAGGCCTGA No data
Right 1127098261 15:55535284-55535306 AACAGCCTTGGGTGTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127098261 Original CRISPR AACAGCCTTGGGTGTCCTGG GGG Intergenic
No off target data available for this crispr