ID: 1127100025

View in Genome Browser
Species Human (GRCh38)
Location 15:55554522-55554544
Sequence TTGGCTGAACTGACAGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1268
Summary {0: 1, 1: 0, 2: 17, 3: 224, 4: 1026}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127100025 Original CRISPR TTGGCTGAACTGACAGAGGT AGG Intronic
900084593 1:885700-885722 ATGGCTGAATTGACAAAAGTAGG - Intergenic
901165454 1:7218422-7218444 TTCGCTGCACTGACAGAAGAGGG - Intronic
902141455 1:14360432-14360454 TTTGATGAATTGACAGAAGTAGG - Intergenic
902416792 1:16244444-16244466 CAGGCTTAACTGACAGAGGGAGG + Intergenic
902449269 1:16486306-16486328 CTGGCTGAGCTCACAGAGGAAGG + Intergenic
902460309 1:16570097-16570119 TTTGATGAGCTGACAGAAGTAGG + Intronic
902468668 1:16633021-16633043 CTGGCTGAGCTCACAGAGGAAGG + Intergenic
902505476 1:16936971-16936993 CTGGCTGAGCTCACAGAGGAAGG - Intronic
902576567 1:17381691-17381713 TTCACTGAACTGATCGAGGTAGG + Intronic
903159645 1:21477265-21477287 TTTGATGAGCTGACAGAAGTAGG - Intronic
904299156 1:29542989-29543011 TTGACTGAAGTCACAGAGCTGGG - Intergenic
904415152 1:30356371-30356393 GTGGCTGAACTGACAGGGTGTGG + Intergenic
905952739 1:41965379-41965401 ATGGATGAACTGACAGAAGTAGG + Intronic
906320151 1:44810590-44810612 CTGGAGGAACTGAGAGAGGTGGG + Exonic
906890542 1:49708544-49708566 TTTGATGAATTGACAGAAGTAGG - Intronic
906894250 1:49754061-49754083 TTTGATGAATTGACAGAAGTAGG - Intronic
906901009 1:49836567-49836589 TTTGATGAATTGACAGAAGTAGG - Intronic
906903743 1:49865757-49865779 ATGGATGAACTGACAGAAGTAGG + Intronic
906946427 1:50298350-50298372 TTGGCTTAAGTCACAGAGGTTGG - Intergenic
906954429 1:50360237-50360259 ATGGATGAATTGACAGAAGTAGG + Intergenic
908129840 1:61064207-61064229 TCGGCTGAACTCACTGTGGTTGG - Intronic
908178284 1:61578368-61578390 TTTGATGAGCTGACAGAAGTAGG - Intergenic
908450847 1:64252913-64252935 ATGGTTGAATTGACAGAAGTAGG + Intronic
908584492 1:65553707-65553729 TTTGATGAATTGACAGAAGTAGG - Intronic
908813424 1:68008075-68008097 TTTGATGAGCTGACAGAAGTAGG - Intergenic
909047358 1:70727098-70727120 ATGGCTAAATTGACAGAAGTAGG - Intergenic
909384360 1:75037805-75037827 TTTGATGAATTGACAGAAGTAGG + Intergenic
909690012 1:78397228-78397250 TTTGATGAATTGACAGAAGTAGG - Intronic
909874483 1:80784694-80784716 TTTGATGAATTGACAGAAGTAGG + Intergenic
910016698 1:82534091-82534113 ATGGCTGAACTGACAGAAGTAGG - Intergenic
910518198 1:88087701-88087723 GTGGATGAACTGACAAAAGTAGG - Intergenic
910642138 1:89474383-89474405 ATGGCTGAAATGACAGAAGTAGG + Intergenic
910821857 1:91359254-91359276 ATGGCTGAATCGACAGAAGTAGG + Intronic
910912661 1:92253917-92253939 TTTGATGAACTGACAGAAGTAGG + Intronic
911148946 1:94579125-94579147 ATGGCTGAAATGACAGAAGTAGG - Intergenic
911242903 1:95484319-95484341 ACGGATGAACTGACAGAGGTAGG + Intergenic
911464475 1:98234086-98234108 ATGGCTGAATTGACAGAAGTAGG + Intergenic
911495307 1:98624216-98624238 TTTGATGAATTGACAGAAGTAGG - Intergenic
911508672 1:98784889-98784911 ATGGATGAACTGACAGCAGTAGG + Intergenic
911530815 1:99040714-99040736 TTTGATGAATTGACAGAAGTAGG + Intergenic
911632794 1:100201059-100201081 TTTGATGAACTGACACAAGTAGG + Intronic
911674993 1:100648251-100648273 CTGGCTGAAATGACAGAGTTAGG + Intergenic
911794640 1:102059781-102059803 ATGGCTGAAATGACAGAAGTAGG + Intergenic
911938451 1:104011165-104011187 TTTGATGAATTGACAGAAGTAGG - Intergenic
912006975 1:104916538-104916560 TTTGACGAACTGACAGAAGTAGG - Intergenic
912270899 1:108208415-108208437 TTTGATGAATTGACAGAAGTAGG - Intergenic
912893309 1:113558213-113558235 ATGGCTGAAATGAGAGAAGTAGG + Intronic
912894739 1:113575179-113575201 TTTGATGAATTGACAGAAGTAGG - Intronic
913020968 1:114789669-114789691 TTTGATGAATTGACAGAAGTAGG - Intergenic
913036167 1:114968667-114968689 TTTGATGAATTGACAGAAGTAGG - Intronic
913605107 1:120458484-120458506 TTTGATGAGCTGACAGAAGTAGG - Intergenic
913641973 1:120821221-120821243 TTTGATGAGCTGACAGAAGTAGG - Intronic
914083431 1:144430724-144430746 TTTGATGAGCTGACAGAAGTAGG + Intronic
914189454 1:145396002-145396024 TTTGATGAGCTGACAGAAGTAGG + Intronic
914211301 1:145581714-145581736 TTTGATGAGCTGACAGAAGTAGG + Intergenic
914218356 1:145655286-145655308 ATGGATGCACTGACAGAAGTAGG - Intronic
914276507 1:146129143-146129165 TTTGATGAGCTGACAGAAGTAGG + Intronic
914399537 1:147304974-147304996 TTTGATGAATTGACAGAAGTAGG + Intergenic
914441424 1:147711031-147711053 TTTGATGAGCTGACAGAAGTAGG - Intergenic
914458179 1:147855996-147856018 TTTGATGAATTGACAGAAGTAGG + Intergenic
914458835 1:147862782-147862804 TTTGATGAATTGACAGAAGTAGG + Intergenic
914470917 1:147977977-147977999 ATGGATGCACTGACAGAAGTAGG - Intronic
914537552 1:148580098-148580120 TTTGATGAGCTGACAGAAGTAGG + Intronic
914586468 1:149066550-149066572 TTTGATGAGCTGACAGAAGTAGG + Intronic
915046278 1:153019466-153019488 ATGGATGAACTGACAGAAGTAGG + Intergenic
915061229 1:153187692-153187714 TTTGATGAATTGACAGAAGTAGG - Intergenic
915579011 1:156802227-156802249 TTGAGTGAACTGAAGGAGGTGGG - Intergenic
915639670 1:157215094-157215116 ATGGATGAATTGACAGAAGTAGG - Intergenic
915659151 1:157388092-157388114 ATGGATGAATTGACAGAAGTAGG - Intergenic
915688578 1:157662776-157662798 TTTGACGAATTGACAGAGGTAGG + Intergenic
915990749 1:160513013-160513035 AAGGATGAACTGACAGAAGTAGG + Intronic
915995533 1:160558638-160558660 ATGGCTGCATTGACAGAAGTAGG + Intronic
916119090 1:161512140-161512162 TTGGCAGAGCTGGCAGAGGATGG + Intronic
916128849 1:161593799-161593821 TTGGCAGAGCTGGCAGAGGATGG + Intronic
916385123 1:164258435-164258457 TTTGCTGAAATGATAGAGCTTGG - Intergenic
916594646 1:166232619-166232641 ATGGCTGAAATGACAGATGTAGG - Intergenic
916614728 1:166428450-166428472 TTTGATGAATTGACAGAAGTAGG - Intergenic
916878600 1:168997587-168997609 TTTGATGAATTGACAGAAGTAGG - Intergenic
916985809 1:170190802-170190824 ATGGCTGAAATGACAGAATTAGG - Intergenic
917009647 1:170457034-170457056 TTTGACGAACTGACAGAAGTAGG - Intergenic
917023247 1:170613518-170613540 TTTGATGAAATGACAGAAGTGGG - Intergenic
917062670 1:171057116-171057138 ATGGATGAATTGACAGAAGTAGG + Intronic
917295563 1:173515651-173515673 ATGGATGAATTGACAGAAGTAGG - Intronic
917356301 1:174130460-174130482 ATGGGTGAATTGACAGAAGTAGG - Intergenic
917424658 1:174901662-174901684 ATGGCTGAAATGACAGAAGTAGG - Intronic
917573566 1:176296064-176296086 TTGGATGAGTTGACAGAAGTAGG - Intergenic
917582239 1:176391044-176391066 ATGGAAGAACTGACAGAAGTAGG - Intergenic
917915359 1:179695493-179695515 TTTGATGAATTGACAGAAGTAGG + Intergenic
918168868 1:181975954-181975976 ATGGATGAATTGACAGAAGTAGG + Intergenic
918501369 1:185200239-185200261 GTTGATGAACTGACAGAAGTAGG - Intronic
918775633 1:188626364-188626386 ATGTCTGAACTGACAGAAGAAGG + Intergenic
918945753 1:191062277-191062299 TTTGAAGAACTGACAGAAGTAGG - Intergenic
919146642 1:193644382-193644404 TTTGGTGAATTGACAGAAGTAGG - Intergenic
919342164 1:196325461-196325483 TTGGCTGAGCTGCCACAGGAGGG - Intronic
919461521 1:197883520-197883542 TTTGATGAACTGACAGAAGTAGG - Intergenic
920064525 1:203257630-203257652 TTTGATGAGCTGACAGAAGTAGG + Intronic
920495612 1:206453102-206453124 TTAGCTGAACTTACAGTGGTAGG - Intronic
920588918 1:207197104-207197126 TTTGATGAGCTGACAGAAGTAGG + Intergenic
920838557 1:209534609-209534631 GTGGGTGAAAGGACAGAGGTGGG + Intergenic
921004238 1:211076759-211076781 TTTGATGAGCTGACAGAAGTAGG + Intronic
921461413 1:215432143-215432165 TTTGATGAATTGACAGAAGTAGG - Intergenic
921881126 1:220255430-220255452 ATGGCTGAATTGACAGAAGTCGG + Intronic
921918821 1:220643104-220643126 ATGGATGAACTGACAGAAGTAGG + Intronic
922379889 1:225012953-225012975 TTTGATGAACTGACAGAAGTAGG - Intronic
922396922 1:225211154-225211176 TTTGATGAACTGACAGAAGTAGG + Intronic
922443706 1:225678417-225678439 CTGGGAGAAGTGACAGAGGTAGG - Intergenic
923377362 1:233377952-233377974 TCTGCTGAACTGACACAGGGCGG + Intronic
923416628 1:233769148-233769170 TTTGATGAACTGACAGAACTAGG - Intergenic
923421861 1:233823432-233823454 TTTGATGAATTGACAGAAGTAGG + Intergenic
924412513 1:243820451-243820473 TTAGATGAACTGACAGAAGTAGG + Intronic
924493865 1:244567831-244567853 TTTGATGAACTGACATAAGTAGG - Intronic
924779396 1:247132440-247132462 TTGGACAAACTGACAGAAGTAGG + Intronic
1062761921 10:28908-28930 ATGGCTGAATTGACAAAAGTAGG + Intergenic
1062765321 10:58324-58346 TTGGGTAAACAGGCAGAGGTTGG - Intergenic
1063462817 10:6225339-6225361 TGGGCTGACCTGAGAGAGGCTGG + Intronic
1063819818 10:9820801-9820823 ATGGCTGCACTGACAGAAATTGG + Intergenic
1064534183 10:16341866-16341888 GATGCTGAAGTGACAGAGGTGGG - Intergenic
1064848319 10:19681649-19681671 ATGGATGAACTGACAGAAGTCGG - Intronic
1066042793 10:31567791-31567813 TTTGATGAATTGACAGAAGTAGG - Intergenic
1066509641 10:36082563-36082585 ATGGCTGAAATGACAGAAGTAGG - Intergenic
1067162054 10:43835544-43835566 TTTGATGAATTGACAGAAGTAGG - Intergenic
1067579421 10:47432823-47432845 TTTGATGAATTGACAGAAGTAGG - Intergenic
1068126752 10:52850605-52850627 ATGGATGAATTGACAGAAGTAGG - Intergenic
1068302072 10:55156813-55156835 TGGGCTAAACAGAGAGAGGTTGG + Intronic
1068381032 10:56254442-56254464 ATGGATGAATTGACAGAGTTAGG - Intergenic
1068575282 10:58677201-58677223 TTTGATGAATTGACAGAAGTAGG + Intronic
1068609424 10:59042843-59042865 TTTGATGAGCTGACAGAAGTAGG - Intergenic
1068810967 10:61255953-61255975 ATGGCTGAAATGACAGAAGTAGG - Intergenic
1069023837 10:63519774-63519796 TTGGCTGAAAGAAGAGAGGTAGG + Intergenic
1069264166 10:66437692-66437714 TTTGATGAATTGACAGAAGTAGG - Intronic
1069371067 10:67747760-67747782 ATGGATGAATTGACAGAAGTAGG + Intergenic
1069840836 10:71338282-71338304 TTTGGGTAACTGACAGAGGTGGG + Intronic
1070064799 10:73022645-73022667 TTTGATGAGCTGACAGAAGTAGG + Intronic
1070781418 10:79139596-79139618 TTGGCGGCAGGGACAGAGGTGGG + Intronic
1070851962 10:79571520-79571542 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1071077094 10:81768131-81768153 ATGGATGAATTGACAGAAGTAGG - Intergenic
1071134437 10:82437528-82437550 ATGGATGAATTGACAGAAGTAGG - Intronic
1071272543 10:84021060-84021082 TTTGATGAATTGACAGAAGTAGG + Intergenic
1071341163 10:84650635-84650657 TTTGATGAATTGACAGACGTAGG - Intergenic
1072360712 10:94656407-94656429 ATGGCTGAACTGACAGAAATTGG - Intergenic
1072370076 10:94757419-94757441 TTTGATGAACTGACAGAGGTAGG - Intronic
1072375587 10:94812853-94812875 TTTGATGAATTGACAGAAGTAGG - Intronic
1072389456 10:94968499-94968521 TTTGATGAATTGACAGAAGTAGG - Intronic
1072493564 10:95933373-95933395 TTTGATGAATTGACAGAAGTAGG - Intronic
1072516123 10:96185293-96185315 TTTGATGAACTGACAGAAGTAGG - Intronic
1072557557 10:96533103-96533125 TGGGCTGACCTGACAGATTTCGG + Exonic
1072834603 10:98697152-98697174 ATGGATGAATTGACAGAAGTAGG + Intronic
1072854712 10:98935275-98935297 ATGGATGAACTGACAGAAGTAGG - Intronic
1073698263 10:105894594-105894616 TTTGATGAATTGACAGAAGTAGG + Intergenic
1073750882 10:106525984-106526006 ATGGCTCATCTTACAGAGGTTGG - Intergenic
1074022120 10:109594728-109594750 ATGCCTGAATTGACAGAAGTAGG + Intergenic
1075230556 10:120672388-120672410 ATGGATGAATTGACAGAAGTAGG + Intergenic
1075281974 10:121147022-121147044 ATGGATGAATTGACAGAAGTAGG - Intergenic
1075860709 10:125674411-125674433 ATGGATGAATTCACAGAGGTAGG - Intronic
1075899183 10:126025199-126025221 ATGGCTGACATGACAGAAGTAGG + Intronic
1075963480 10:126588855-126588877 ATGGCTGAACTGACAGAAGTAGG + Intronic
1075983780 10:126766032-126766054 TTTGATGAATTGACAGAAGTAGG - Intergenic
1076740127 10:132478740-132478762 TTGGCAGAGGTGGCAGAGGTGGG - Intergenic
1077696569 11:4398009-4398031 TTTGATGAATTGACAGAAGTAGG + Intergenic
1077762351 11:5116062-5116084 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1078132344 11:8623231-8623253 TTGGCTGACATGGCAGAGGCTGG - Intronic
1078394168 11:10964367-10964389 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1078501793 11:11886247-11886269 ATGGCTGAATTGACAGAAGGAGG + Intronic
1078603232 11:12751600-12751622 ATGGCTGAAGGGACAGGGGTGGG + Intronic
1078732769 11:13991567-13991589 TTTGATGAATTGACAGAAGTAGG - Intronic
1078813982 11:14801144-14801166 TTTGATGAACTGACAGAAGTAGG - Intronic
1078834634 11:15015310-15015332 ATGGATGAATTGACAGAAGTAGG + Intronic
1078998477 11:16728731-16728753 TTTGATGAACTGACAGAAGTAGG + Intronic
1079276390 11:19041121-19041143 ATGGATGAATTGACAGAAGTAGG + Intergenic
1079437591 11:20473729-20473751 ATGGCTGAATTGACAGAAGTAGG - Intronic
1079654622 11:22973217-22973239 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1079993613 11:27272891-27272913 TTTGATGAATTGACAGAAGTAGG - Intergenic
1080292694 11:30688607-30688629 ATGGCTGAACTGACAGAAGTAGG + Intergenic
1080710178 11:34738944-34738966 TTTGATGAATTGACAGAAGTAGG + Intergenic
1081008868 11:37782208-37782230 ATGGTTGAACTGACAGAAGGAGG + Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1081956861 11:47100408-47100430 TTGTCTGAAGAGACAGATGTAGG - Intronic
1082743439 11:56936747-56936769 TTGACTCAACTGAGAGAGGAGGG + Intergenic
1082746399 11:56967993-56968015 ATGGTTGAATTGACAGAAGTAGG - Intergenic
1082876196 11:57991681-57991703 TTTGATGAATTGACAGAAGTAGG - Intergenic
1082903489 11:58282300-58282322 TTTGATGAACTCACAGAAGTAGG - Intergenic
1082994074 11:59234736-59234758 ATGGATGAACTGACAGAAGCAGG + Intergenic
1083062686 11:59891265-59891287 ATGGATGAACTGACAGAAGTAGG - Intergenic
1083385395 11:62305646-62305668 TTTGATGAATTGACAGAAGTAGG - Intergenic
1083523266 11:63336310-63336332 TCGGATGAACTGACAGATGTAGG - Intronic
1083723709 11:64617661-64617683 TTGGCTCCAGTGTCAGAGGTGGG - Intronic
1084310060 11:68311932-68311954 GTGGCTGAGCTGACACCGGTGGG + Intergenic
1085207989 11:74748626-74748648 CTTACTGAACTGAAAGAGGTGGG - Intergenic
1085335039 11:75687122-75687144 ATGGATTAACTGACAGAAGTAGG - Intergenic
1085433998 11:76482400-76482422 TTTGATGAATTGACAGAAGTAGG + Intronic
1085800820 11:79587237-79587259 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1086279880 11:85172617-85172639 ATGGCTGAATTGACAGAAGTAGG + Intronic
1086532230 11:87800173-87800195 TTTGATGAATTGACAGAAGTAGG - Intergenic
1086608577 11:88726037-88726059 TTTGATGAACTGACAGAAGTAGG + Intronic
1086610480 11:88749097-88749119 ATGGCTGAATTGACAGAAGTAGG + Intronic
1086741802 11:90378808-90378830 ATGGATGAAATGACAGAAGTAGG - Intergenic
1086789614 11:91019054-91019076 TTTGTTGAATTGACAGAAGTAGG - Intergenic
1086800602 11:91170107-91170129 ATGGATGAAATGACAGAAGTAGG + Intergenic
1086820618 11:91432582-91432604 ATGGCTGAAGTGACAGAAGTAGG - Intergenic
1086991207 11:93305075-93305097 ATGGCTGAAGTGACAGAAGTAGG + Intergenic
1087026480 11:93654693-93654715 ATGGCTCAAGTGACAGAGCTGGG - Intergenic
1087100581 11:94359871-94359893 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1087513621 11:99129102-99129124 ATGGGTGAACTGACAGAAGTAGG + Intronic
1087718642 11:101637102-101637124 ATGGATGAACTGACAGAAGTGGG + Intronic
1087868387 11:103261849-103261871 TTTGATGAACTGACAGAAGTAGG + Intronic
1087881399 11:103419785-103419807 ATGGCGGAATTGACAGAAGTAGG + Intronic
1088008448 11:104970078-104970100 ATGGATGAACTGACAGAAGTAGG + Intergenic
1088017949 11:105082634-105082656 ATGGATGAACTGACAGAAGTAGG + Intronic
1088020523 11:105112612-105112634 ATGGATGAACTGACAAAAGTAGG + Intergenic
1088037540 11:105335129-105335151 ATGGATGAATTGACAGAAGTAGG + Intergenic
1088078177 11:105877900-105877922 TTTGATGAATTGACAGAAGTAGG - Intronic
1088197819 11:107294841-107294863 TTTGCTGAGTTGACAGAAGTAGG + Intergenic
1088383258 11:109220693-109220715 TTGGATGAAGTGACAGAAGGAGG - Intergenic
1088701553 11:112417463-112417485 TTGGCGGTACTCGCAGAGGTAGG + Intergenic
1089128886 11:116196596-116196618 TTCCCTGAACTGAAAGATGTTGG + Intergenic
1089192960 11:116667903-116667925 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1089870215 11:121665817-121665839 TGAGATGAACTGACTGAGGTAGG - Intergenic
1089882322 11:121786811-121786833 TTTGATGAATTGACAGAAGTAGG - Intergenic
1090567246 11:128007632-128007654 ATGGCTAAATTGACAGAAGTAGG + Intergenic
1090723092 11:129494627-129494649 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1090895986 11:130976077-130976099 TTTGATGAATTGACAGAAGTAGG - Intergenic
1091213395 11:133884251-133884273 TTTGATGAATTGACAGAAGTAGG - Intergenic
1091417251 12:298699-298721 TTTGATGAATTGACAGAAGTAGG + Intronic
1092314070 12:7391369-7391391 TTTGATGAGCTGACAGAAGTAGG + Intronic
1092325425 12:7526844-7526866 ATGGATGAATTGACAGAAGTAGG - Intergenic
1092332279 12:7595347-7595369 TTTGATGAATTGACAGAAGTAGG + Intergenic
1092566628 12:9673054-9673076 ATGGATAAACTGACAGAAGTAGG - Intronic
1093074631 12:14745204-14745226 GAGGCTGAACTGAAAGGGGTAGG + Intergenic
1093335913 12:17905062-17905084 TTTGATGAATTGACAGAAGTAGG - Intergenic
1093835477 12:23824107-23824129 TTTGATGAATTGACAGAAGTAGG - Intronic
1094054761 12:26257317-26257339 ATGGATGAATTGACAGATGTAGG + Intronic
1094311931 12:29093507-29093529 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1094425372 12:30311185-30311207 ATGGCTGAATTGACAGAAGTAGG + Intergenic
1094694858 12:32808516-32808538 ATGGCTGAGTTGACAGAAGTAGG - Intronic
1094827169 12:34278452-34278474 TTTGATGAATTGACAGAAGTAGG + Intergenic
1095101484 12:38189567-38189589 TTGGGTAAACAGGCAGAGGTTGG + Intergenic
1095230235 12:39731145-39731167 TTTGATGAATTGACAGAAGTAGG - Intronic
1095356551 12:41281366-41281388 TTTGATGAATTGACAGAAGTAGG + Intronic
1095406423 12:41871305-41871327 TTTGATGAATTGACAGAAGTAGG + Intergenic
1095442659 12:42253871-42253893 TTTGATGAATTGACAGAAGTAGG - Intronic
1095595440 12:43952290-43952312 ATGGATGAACTGACAGAAGTAGG + Intronic
1095599963 12:44002765-44002787 TTGTCTGAACCCACAGTGGTAGG + Intronic
1095920497 12:47525567-47525589 TTTGATGAATTGACAGAAGTAGG - Intergenic
1096051641 12:48614918-48614940 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1096520009 12:52179697-52179719 TTGGCTGCACTGCCATAGCTTGG + Intronic
1096904332 12:54919972-54919994 CTGGCTGAAGTGACAGCAGTCGG + Intergenic
1097365041 12:58702458-58702480 TTTGATGAGCTGACAGAAGTAGG + Intronic
1097455199 12:59791889-59791911 ATGGCTGAACTGACAGAAGTAGG - Intergenic
1097517087 12:60618905-60618927 ATGGATGAACTGACAGACGTAGG + Intergenic
1097526751 12:60746590-60746612 TTTGATGAATTGACAGAAGTAGG + Intergenic
1097598404 12:61663303-61663325 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1097619633 12:61923738-61923760 TTTGACGAACTGACAGAAGTAGG + Intronic
1097763225 12:63493120-63493142 TTTGATGAATTGACAGAAGTAGG - Intergenic
1097948687 12:65402604-65402626 TTTGATGAATTGACAGAAGTAGG - Intronic
1098053065 12:66473981-66474003 TTTGATGAACTGACAGAAGTAGG + Intronic
1098193496 12:67976050-67976072 ATGGATGAATTGACAGAAGTAGG - Intergenic
1098246472 12:68524034-68524056 TTGACTTAAGTGACAGAGATGGG - Intergenic
1098438650 12:70496207-70496229 TTTGATGAATTGACAGAAGTAGG - Intergenic
1098667860 12:73186652-73186674 ATGGCTGAATTGACAGAAATAGG - Intergenic
1098674157 12:73267348-73267370 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1098764414 12:74468507-74468529 ATGGATGAACCGACAGAAGTAGG - Intergenic
1098993789 12:77095439-77095461 TTTGATGAGCTGACAGAAGTAGG - Intergenic
1099030968 12:77524912-77524934 TTTGATGAATTGACAGAAGTAGG + Intergenic
1099253594 12:80288890-80288912 TTTGATGAATTGACAGAAGTAGG - Intronic
1099344423 12:81480401-81480423 TTTGATGAATTGACAGAAGTAGG - Intronic
1099435133 12:82634171-82634193 TTTGATGAATTGACAGAAGTAGG - Intergenic
1099523621 12:83693803-83693825 TTTGATGAACTGACAGAAGTAGG + Intergenic
1099793139 12:87362646-87362668 ATGGATGAATTGACAGAAGTAGG - Intergenic
1099892358 12:88605480-88605502 TTAGATGAATTGACAGAAGTAGG + Intergenic
1100111181 12:91243705-91243727 TTTGATGAATTGACAGAAGTAGG + Intergenic
1100136410 12:91557935-91557957 TTCGATGAATTGACAGAAGTAGG + Intergenic
1100740173 12:97582536-97582558 TTTGATGAATTGACAGAAGTAGG + Intergenic
1101081464 12:101189679-101189701 TTGGATGAACGCACAGAGGTAGG - Intronic
1101601116 12:106211462-106211484 TTTGATGAACTGACAGAAGTAGG - Intergenic
1102323570 12:111958496-111958518 TTTGATGAATTGACAGAAGTAGG + Intronic
1102345441 12:112158198-112158220 TTTGATGAATTGACAGAAGTAGG - Intergenic
1106334952 13:28775883-28775905 TTTGATGAATTGACAGAAGTAGG - Intergenic
1106361752 13:29038003-29038025 TTTGATGAATTGACAGAAGTAGG - Intronic
1106387679 13:29303303-29303325 ATGGCTGAATTGACAGAAGTAGG + Intronic
1106391024 13:29336131-29336153 TTCGACGAACTGACAGAAGTAGG - Intronic
1106425633 13:29625917-29625939 ATGGCTGAATTCACAGAAGTAGG + Intergenic
1106426454 13:29635646-29635668 TTTGCCAAACTGACAGAAGTGGG - Intergenic
1106650982 13:31689434-31689456 TTTGATGAATTGACAGAAGTAGG + Intergenic
1106890005 13:34235213-34235235 ATGGATGAATTGACAGAAGTAGG - Intergenic
1107119369 13:36779835-36779857 ATAGCTGAAATGACAGAAGTAGG + Intergenic
1107243568 13:38265788-38265810 TTGGATGAAGTGATAGAAGTAGG + Intergenic
1107970722 13:45640167-45640189 TTTGATGAATTGACAGAAGTAGG - Intergenic
1108127073 13:47256175-47256197 TCAGCTGCACTGACAGAGGGTGG + Intergenic
1108153913 13:47565067-47565089 TTTGATGAATTGACAGAAGTAGG + Intergenic
1108160531 13:47633467-47633489 ATGGATGAACTGACAGAAGTAGG + Intergenic
1108173845 13:47772484-47772506 ATGCCTGAATTGACAGAAGTAGG - Intergenic
1108706694 13:52995109-52995131 TTAGCTAAGCTGACAGATGTTGG - Intergenic
1109033985 13:57231075-57231097 TTTGATGAATTGACAGAAGTAGG + Intergenic
1109163311 13:59003255-59003277 TTTGATGAATTGACAGAAGTAGG - Intergenic
1109188036 13:59292846-59292868 TTTGATGAATTGACAGAAGTAGG + Intergenic
1109361585 13:61300305-61300327 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1110020082 13:70458450-70458472 TTTGATGAATTGACAGAAGTAGG + Intergenic
1110135632 13:72063437-72063459 TTTGATGAATTGACAGAAGTAGG + Intergenic
1110567013 13:76967284-76967306 ATGGATGAAGTGACAGAAGTAGG - Intergenic
1110717338 13:78721233-78721255 CTGGCTGATCTGACAGAAGGCGG - Intergenic
1110790366 13:79581172-79581194 ATGGATGAATTGACAGAAGTAGG - Intergenic
1110824026 13:79951472-79951494 TTTGATGAATTGACAGAAGTAGG + Intergenic
1110942155 13:81363675-81363697 TTTGTTGAATTGACAGAAGTAGG + Intergenic
1110961401 13:81630807-81630829 TTTGATGAATTGACAGAAGTAGG + Intergenic
1111114336 13:83755525-83755547 TTTGATGAATTGACAGAAGTAGG + Intergenic
1111305777 13:86410516-86410538 ATGGATGAATTGACAGAAGTAGG + Intergenic
1111522699 13:89427025-89427047 ATGGCTAAATTGACAGAAGTAGG - Intergenic
1112231729 13:97594363-97594385 TTTGACGAACTGACAGAAGTAGG + Intergenic
1112913717 13:104521710-104521732 ATGGATGAATTGACAGAAGTAGG - Intergenic
1112976972 13:105332173-105332195 TCGGCAGATCTGACAGAGGTTGG + Intergenic
1113224851 13:108147991-108148013 TTGGCTGAATAGATGGAGGTTGG - Intergenic
1113539535 13:111095367-111095389 TTGGCAGCACTTACAGGGGTGGG + Intergenic
1113784045 13:112993164-112993186 GAGGCTGTACTGACAGAGGCTGG + Intronic
1114706099 14:24727669-24727691 ATGGATGAATTGACAGAAGTAGG + Intergenic
1114845021 14:26310065-26310087 TTTGATGAATTGACAGAAGTAGG + Intergenic
1115162210 14:30409460-30409482 TTTGATGAACTGACAGAAGAAGG - Intergenic
1115385337 14:32789871-32789893 ATGGCTGAATTGACAGAAGTAGG + Intronic
1115538190 14:34392664-34392686 TTTGATGAACTGACAGAAGTAGG + Intronic
1115842607 14:37489441-37489463 TTTGATGAACTGACAGAAGTAGG - Intronic
1116074260 14:40089657-40089679 TTTGATGAATTGACAGAAGTAGG + Intergenic
1116123855 14:40756447-40756469 GTGGTTGAATTGACAGAAGTAGG - Intergenic
1116227644 14:42172053-42172075 TTTGATGAATTGACAGAAGTAGG + Intergenic
1116301533 14:43189196-43189218 ATGGCTGAACTGATAGAAGTAGG + Intergenic
1116312200 14:43341633-43341655 ATGGATAAACTGACAGAAGTAGG - Intergenic
1116320473 14:43455262-43455284 ATGGCTGAAATGACAGAACTAGG + Intergenic
1116417277 14:44694051-44694073 TTTGATGAACTGACAAAAGTAGG + Intergenic
1116727128 14:48575220-48575242 TTTGATGAGCTGACAGAAGTAGG - Intergenic
1117299117 14:54406831-54406853 TTTGATGAACTGACAGAAGTAGG - Intronic
1117502996 14:56373296-56373318 ATAGCTGAATTGACAGACGTAGG - Intergenic
1117576096 14:57099760-57099782 TTTGATGAATTGACAGAAGTAGG + Intergenic
1117616947 14:57544077-57544099 TTTGATGAATTGACAGAAGTAGG - Intergenic
1117641172 14:57800516-57800538 ATGGCTGAATTGACAGAAGTAGG + Intronic
1117710829 14:58526705-58526727 TTTGATGAATTGACAGAAGTAGG + Intronic
1117857438 14:60050557-60050579 ATGGCTGAATTGATAGAAGTAGG - Intronic
1117930411 14:60836227-60836249 TTTGATGAACTGACAGAAGTAGG - Intronic
1117932070 14:60854291-60854313 ATTGATGAACTGACAGAAGTAGG - Intronic
1118926876 14:70199263-70199285 ATTGATGAACTGACAGAAGTAGG - Intergenic
1120058593 14:79954702-79954724 ATGGCTGAATTGGCAGAAGTAGG + Intergenic
1120065870 14:80039948-80039970 TTTGATGAATTGACAGAAGTAGG + Intergenic
1120444655 14:84579222-84579244 TTTGCTGAGCTGCCAGTGGTGGG + Intergenic
1120482958 14:85075513-85075535 TTTGCTGAAGTGAAAGAGGCAGG + Intergenic
1120799300 14:88670568-88670590 ATGGATGAATTGACAGAAGTAGG + Intronic
1121899113 14:97675718-97675740 TTTGATGAATTGACAGAAGTAGG + Intergenic
1123454003 15:20400194-20400216 ATGGCTGAAATGACAGAAGCAGG + Intergenic
1124419320 15:29505911-29505933 TTTGATGAACTGACGGAAGTAGG + Intronic
1124475870 15:30034088-30034110 TGGGCTGATCTGACTGAGGCTGG - Intergenic
1124918160 15:33996856-33996878 TTTGATGAGCTGACAGAAGTAGG + Intronic
1124923615 15:34049205-34049227 ATGGCTGAATTGACAGAACTAGG + Intronic
1125216528 15:37282274-37282296 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1125227298 15:37409297-37409319 TTTGATGAATTGACAGAAGTAGG + Intergenic
1125373312 15:39000930-39000952 ATGGATGAATTGACAGAAGTAGG + Intergenic
1125513483 15:40305387-40305409 TAGGCATAACAGACAGAGGTCGG + Intronic
1126071323 15:44866922-44866944 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1126278545 15:46915040-46915062 TTGGCTGAGAAGACAGAGTTCGG - Intergenic
1126956372 15:53937033-53937055 ATGGCTGAATTGACAGAAGTAGG + Intergenic
1127100025 15:55554522-55554544 TTGGCTGAACTGACAGAGGTAGG + Intronic
1127691796 15:61403892-61403914 TTGGGTGGACAGACAGAGGAAGG - Intergenic
1128075190 15:64821428-64821450 CTGGCTGAACTGCCAGCGGTTGG - Exonic
1128883811 15:71266610-71266632 TTTGATGAATTGACAGAAGTAGG + Intronic
1129126908 15:73449146-73449168 TTTGATGAACTGACAGAAGCAGG + Intronic
1129610970 15:77056634-77056656 TTGGTAGAAATGACAGAGCTTGG + Intronic
1130779309 15:87017798-87017820 ATGGCTAAATTGACAGAAGTAGG + Intronic
1131446819 15:92505191-92505213 TTGCCGGTACTGACAGAGATTGG - Intergenic
1132858292 16:2057355-2057377 TCTGTTGAACTGACAGAGGAAGG - Intronic
1133471595 16:6081252-6081274 TTGGCTGAGCTGAAAGGGGTAGG - Intronic
1134098236 16:11433788-11433810 TGGGCTGAACACACAGAGGGTGG + Intronic
1134479265 16:14603446-14603468 TTGGCTGGAGTGACATCGGTTGG - Intronic
1135922777 16:26666102-26666124 TTGCCTGAATTGACACAGCTAGG - Intergenic
1136662225 16:31772774-31772796 ATGGATGAATTGACAGAAGTAGG + Intronic
1136925685 16:34371479-34371501 ATGGCTGAAATGACAGAGGATGG + Intergenic
1136978889 16:35040327-35040349 ATGGCTGAAATGACAGAGGATGG - Intergenic
1137239366 16:46641657-46641679 TTTGATGAATTGACAGAAGTAGG + Intergenic
1137296456 16:47098176-47098198 TTTGATGAATTGACAGAAGTAGG + Intronic
1137336348 16:47553527-47553549 TTTGATGAACTGACAGAAGTAGG - Intronic
1137828232 16:51517929-51517951 TTAGATGAATTGACAGAAGTAGG + Intergenic
1137969859 16:52974558-52974580 TTTGATGAATTGACAGAAGTAGG - Intergenic
1138457370 16:57129133-57129155 CTGGAGGAACTGGCAGAGGTGGG + Intronic
1138512485 16:57516623-57516645 TTGGCTGAGCAGCCAGAGGCTGG + Intronic
1138799857 16:60013938-60013960 ATGGATGAACTGACAGAAGTAGG + Intergenic
1139702522 16:68717055-68717077 TTGTCTGAAGAGACAAAGGTTGG + Intronic
1140182575 16:72735546-72735568 ATGGATGAACTGACAGAAGTAGG - Intergenic
1140819544 16:78650086-78650108 CTGGCTGAAATGTCAGAGGAAGG + Intronic
1142439338 16:90084982-90085004 TTGGGTAAACAGGCAGAGGTTGG + Intronic
1142911707 17:3098678-3098700 ATGGCTGAATTGACAGAAATAGG + Intergenic
1143634989 17:8159453-8159475 TTGGGTGAACTGATTGAGGAAGG - Exonic
1144026936 17:11285763-11285785 GTGGCTGCAGTGACAGTGGTTGG + Intronic
1144431906 17:15199703-15199725 ATGGATGAACTGACAGAAGTAGG + Intergenic
1146742971 17:35302303-35302325 TTTGATGAATTGACAGAAGTAGG + Intergenic
1147525395 17:41217287-41217309 TTTGATGAATTGACAGAAGTAGG + Intronic
1148151234 17:45397442-45397464 TTGGCTGTATTAATAGAGGTAGG - Intronic
1148152003 17:45402557-45402579 TTGGCTGTATTAATAGAGGTAGG - Intronic
1148967524 17:51448137-51448159 TTTGATGAATTGACAGAAGTAGG + Intergenic
1149240250 17:54640344-54640366 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1149281140 17:55107428-55107450 TTTGATGAATTGACAGAAGTAGG - Intronic
1149377821 17:56063739-56063761 ATGGATGAATTGACAGAAGTAGG - Intergenic
1150884743 17:69071744-69071766 TTTGATGAATTGACAGAAGTAGG + Intergenic
1151955037 17:77375942-77375964 TTGGGTGGACAGACAGACGTGGG + Intronic
1152954829 18:29238-29260 ATGGCTGAATTGACAAAAGTAGG + Intergenic
1152958234 18:58674-58696 TTGGGTAAACAGGCAGAGGTTGG - Intronic
1153858235 18:9172709-9172731 ATGGCTGAACTGATAGAAGTAGG - Intronic
1154101417 18:11478429-11478451 TTTGATAAACTGACAGAAGTAGG - Intergenic
1155429964 18:25744589-25744611 ATGGATGAACTGACAGAAGTAGG + Intergenic
1156084720 18:33383862-33383884 ATGGATGAACTAACAGAAGTAGG + Intronic
1156166616 18:34428996-34429018 TTTGATGAACTGACAGATGTAGG - Intergenic
1156233195 18:35174871-35174893 ATGGCTGATCTGAGAGAGCTGGG + Intergenic
1156551669 18:38025569-38025591 TTGCCTGGAGTGACAGAGGGTGG + Intergenic
1156664706 18:39390920-39390942 ATGGATGAATTGACAGAAGTAGG + Intergenic
1156778595 18:40822800-40822822 TTGGATGAATTGACAGAAGTAGG + Intergenic
1157016433 18:43720236-43720258 ATGGATTAACTGACAGAAGTAGG + Intergenic
1157067828 18:44373107-44373129 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1157095937 18:44685438-44685460 TTGCCTGAAATGACACAAGTTGG + Intronic
1157178732 18:45476973-45476995 TTTGATGAATTGACAGAAGTAGG - Intronic
1157561573 18:48650128-48650150 TTTGATGAGCTGACAGAAGTAGG + Intronic
1157884668 18:51355029-51355051 ATGGCTGCAGAGACAGAGGTTGG + Intergenic
1158676855 18:59528456-59528478 ATGGATGAACTGACAGAAGTAGG - Intronic
1159235881 18:65672217-65672239 ATGGATGAAATGACAGAAGTAGG + Intergenic
1159554939 18:69935783-69935805 TTGGCTGAATTGATAGAGAATGG - Intronic
1159569510 18:70096289-70096311 TTTGGTGAATTGACAGAAGTAGG - Intronic
1159661105 18:71097114-71097136 TTTGATGAATTGACAGAAGTAGG - Intergenic
1160413029 18:78687817-78687839 TTGGCTGCAGTGACAGAGAGAGG - Intergenic
1162182640 19:8880594-8880616 ATGGATGAATTGACAGAAGTAGG + Intronic
1163888497 19:19990208-19990230 ATGGATGAAGTGACAGAAGTAGG + Intergenic
1164067657 19:21734214-21734236 ATGGATAAACTGACAGAAGTAGG + Intronic
1164091090 19:21952819-21952841 TTTGCTGAGTTGACAGAAGTAGG + Intronic
1164516274 19:28938870-28938892 TTTGATGAATTGACAGAAGTCGG - Intergenic
1164599880 19:29553606-29553628 ATGGATGAATTGACAGAAGTAGG + Intronic
1165254466 19:34567206-34567228 TTTGATGAATTGACAGAGGTAGG - Intergenic
1166179787 19:41099652-41099674 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1166588303 19:43970418-43970440 ATGGCTGAACTGACAGAAGTAGG + Intronic
1202676742 1_KI270711v1_random:13825-13847 TTTGATGAGCTGACAGAAGTAGG + Intergenic
925442189 2:3898439-3898461 ATGGCTGAATTGACAGAAGTAGG - Intergenic
926290356 2:11524352-11524374 TTGGGTGACATGACAGAGGGAGG + Intergenic
926453971 2:13041114-13041136 ATGGTTGAACTGACAAAAGTAGG + Intergenic
926481281 2:13399038-13399060 ATGGCTGAAATGACAGAAGCAGG - Intergenic
926943847 2:18167179-18167201 TTTGATGAATTGACAGAAGTAGG - Intronic
926987267 2:18638766-18638788 ATGGCTGAAATGACAGAAGCAGG - Intergenic
927182925 2:20459759-20459781 TTTGATGAATTGACAGAAGTAGG + Intergenic
927573723 2:24182863-24182885 ATGGCTGAACTGAGGGAGGGAGG - Intronic
928128759 2:28633970-28633992 CTGGATGAGCTGACAGGGGTGGG - Intronic
928750789 2:34467658-34467680 TTTGATGAATTGACAGAAGTAGG + Intergenic
928900126 2:36308723-36308745 ATGAATGAACTGACAGAAGTGGG + Intergenic
928900671 2:36314834-36314856 TTTGATGAGCTGACAGAAGTAGG - Intergenic
929062780 2:37940882-37940904 TTTGATGAATTGACAGAAGTAGG - Intronic
929256012 2:39812665-39812687 CTTGATGAACTGACAGAAGTGGG - Intergenic
929333398 2:40711913-40711935 TTTGATGAATTGACAGAAGTAGG - Intergenic
930175929 2:48301944-48301966 TTTGATGAACTGACAGAAGGAGG - Intergenic
930216879 2:48706882-48706904 TTTGATGAGCTGACAGAAGTAGG - Intronic
930223215 2:48766875-48766897 TTTGATGAATTGACAGAAGTAGG - Intronic
930523040 2:52492083-52492105 ATGGCTGAACTGACAAAAGTAGG - Intergenic
930638479 2:53830934-53830956 TTCCTTGAACAGACAGAGGTTGG + Intergenic
930951460 2:57147707-57147729 ATGGATGAACTGACAGAAGTAGG + Intergenic
932008265 2:67949382-67949404 CAGGTTTAACTGACAGAGGTTGG - Intergenic
932036323 2:68251209-68251231 TTGGCTGCAGCGACAGAGGCGGG + Intronic
932523302 2:72436892-72436914 TTTGATGAATTGACAGAAGTAGG - Intronic
932914008 2:75835136-75835158 TTTGATGAATTGACAGAAGTTGG + Intergenic
933166512 2:79082745-79082767 TTTGATGAATTGACAGAAGTAGG - Intergenic
933465273 2:82642872-82642894 ATGGCTGAACTGACAGAAGTAGG + Intergenic
933602401 2:84347039-84347061 ATGGATGAATTGACAGAAGTAGG - Intergenic
934548804 2:95241647-95241669 ATGGCTGAAGAGACAGAAGTAGG + Intronic
934622739 2:95825436-95825458 ATGGATGAATTGACAGAAGTAGG - Intergenic
934811039 2:97276667-97276689 ATGGATGAATTGACAGAAGTAGG + Intergenic
934826653 2:97431272-97431294 ATGGATGAATTGACAGAAGTAGG - Intergenic
934871946 2:97873871-97873893 TTTGACGAACTGACAGAAGTAGG + Intronic
934923548 2:98365888-98365910 ATGGATTAACTGACAGAAGTAGG - Intronic
935489297 2:103697574-103697596 CTGGATGAACTGACAGAAGTAGG - Intergenic
935566060 2:104608470-104608492 TTTGATGAGCTGACAGAAGTAGG + Intergenic
935929837 2:108112691-108112713 TTGGATGAATTGACAGAAGTAGG - Intergenic
936171639 2:110181789-110181811 ATGGCTGAACTTACAGAAGGAGG + Intronic
936448197 2:112613972-112613994 TTTGACGAACTGACAGAAGTAGG - Intergenic
936775231 2:115965006-115965028 TTTGATGAGCTGACAGAAGTTGG - Intergenic
936900244 2:117473679-117473701 TTTGATGAATTGACAGAAGTAGG + Intergenic
937033284 2:118759072-118759094 TTGGCTTTACAGTCAGAGGTAGG - Intergenic
937389228 2:121468839-121468861 ATGGCTGAAATGACAGAAGTAGG - Intronic
937993558 2:127677139-127677161 TTGGCTGAACTGTGGGAGGCTGG - Intronic
938054956 2:128208028-128208050 GTGGCTGAACTGAGAGGGGGTGG + Intergenic
938221284 2:129569985-129570007 TTTGATGAATTGACAGAAGTAGG + Intergenic
938382203 2:130843045-130843067 TTAGCTGAGCTGCCAGAGGGTGG + Intronic
938952184 2:136265743-136265765 TTTGATGAATTGACAGAAGTAGG - Intergenic
939116777 2:138070328-138070350 TTTGATGAATTGACAGAAGTAGG - Intergenic
940030422 2:149256631-149256653 TTTGATGAATTGACAGAAGTAGG - Intergenic
940054414 2:149499206-149499228 TTTGATGAATTGACAGAAGTTGG - Intergenic
940273250 2:151914460-151914482 ATGGATGAATTGACAGAAGTAGG - Intronic
940821531 2:158360825-158360847 TTTGACGAACTGACAGAAGTAGG + Intronic
940964638 2:159823097-159823119 TTTGATGAATTGACAGAAGTGGG + Intronic
941076528 2:161011442-161011464 TTTGATGAATTGACAGAAGTAGG + Intergenic
941119726 2:161514328-161514350 TTTGATGAATTGACAGAAGTAGG + Intronic
941136279 2:161722171-161722193 ATGGATGAACTGACAAAAGTAGG - Intronic
941240948 2:163037038-163037060 ATGGCTGAAATGACAGAAGTAGG + Intergenic
941565236 2:167098533-167098555 TTTGATGAATTGACAGAAGTAGG - Intronic
941845432 2:170127055-170127077 TTTGATGAATTGACAGAAGTAGG + Intergenic
942200037 2:173561067-173561089 TTTGATGAATTGACAGAAGTAGG + Intergenic
942407344 2:175669467-175669489 TTTGATGAAATGACAGAAGTAGG + Intergenic
942576855 2:177373187-177373209 TTTGATGAATTGACAGAAGTAGG - Intronic
942638309 2:178033048-178033070 TTTGACGAACTGACAGAAGTAGG + Intronic
942732714 2:179077057-179077079 TTTGATGAATTGACAGAAGTAGG + Intergenic
942898888 2:181090370-181090392 TTTGATGAATTGACAGAAGTAGG + Intergenic
943001358 2:182332342-182332364 TTTGATGAATTGACAGAAGTAGG - Intronic
943112219 2:183620942-183620964 TTTGATTAACTGACAGAAGTAGG - Intergenic
943200505 2:184817556-184817578 ATGGCTGAATTGACAGAAGGAGG + Intronic
943350087 2:186786441-186786463 ATGGCTGAACTGACAGAAGTAGG + Intergenic
943350842 2:186794141-186794163 TTTGATGAATTGACAGAAGTAGG + Intergenic
943408631 2:187519133-187519155 TTTGATGAATTGACAGAAGTAGG - Intronic
943458818 2:188143532-188143554 TTAGCTGAACTGACAGATTAGGG + Intergenic
943552353 2:189356725-189356747 TTTGATGAATTGACAGAAGTAGG - Intergenic
943836961 2:192525626-192525648 TTTGATGAATTGACAGAAGTAGG + Intergenic
944035631 2:195291170-195291192 ATGGATGAACTGACAAAAGTAGG + Intergenic
944268037 2:197749388-197749410 TTTGATGAATTGACAGAAGTAGG + Intronic
944292172 2:198019385-198019407 TTTGATGAATTGACAGAAGTAGG + Intronic
944585727 2:201171802-201171824 TTGGCTGAGCTAACAGTGTTTGG - Exonic
944608065 2:201370780-201370802 TTTGATGAATTGACAGAAGTAGG + Intergenic
944764490 2:202850287-202850309 TTTGATGAATTGACAGAAGTAGG + Intronic
945161749 2:206899206-206899228 TTTGACGAACTGACAGAAGTAGG - Intergenic
945409313 2:209489441-209489463 TTTGATGAAATGACAGAAGTAGG + Intronic
945481444 2:210350530-210350552 TTTGATGAATTGACAGAAGTAGG - Intergenic
945533632 2:210986207-210986229 TTTCATGAACTGACAGAAGTAGG - Intergenic
945714232 2:213337372-213337394 ATGGATGAATTGACAGAAGTAGG + Intronic
945723327 2:213446252-213446274 ATGGCTGAAATGACAGACATTGG + Intronic
946065189 2:216981698-216981720 TTTGATGAACTGACATAAGTAGG - Intergenic
946111902 2:217427177-217427199 TTAGCTGAAGAGACAGTGGTGGG + Intronic
946648842 2:221869265-221869287 ATGGATGAATTGACAGAAGTAGG + Intergenic
946774398 2:223122779-223122801 TTGGTTGAACTGTCACAGGAAGG + Intronic
947098203 2:226591065-226591087 ATGGCTGAATTGACATAAGTAGG - Intergenic
947194255 2:227545451-227545473 TTAGACGAACTGACAGAAGTAGG - Intronic
947387225 2:229603615-229603637 TTTGCAGAGCTGAGAGAGGTGGG + Intronic
947565263 2:231189481-231189503 GGGGCTGTCCTGACAGAGGTTGG - Intergenic
948335847 2:237206509-237206531 TTGGCTGAGCTTTCTGAGGTTGG + Intergenic
1169396917 20:5240734-5240756 TTTGATGAACTGACAGAAGTAGG - Intergenic
1169508020 20:6233897-6233919 ATGGCTGAACTGATAGAGTATGG + Intergenic
1169695638 20:8384513-8384535 ATGGACGAACTGACAGAAGTAGG - Intronic
1169979105 20:11363803-11363825 ATGGATGAATTGACAGAAGTCGG - Intergenic
1170266259 20:14469919-14469941 TTTGATGAATTGACAGAAGTAGG - Intronic
1170496728 20:16931777-16931799 ATGGATGAACTGACAGAAGTAGG + Intergenic
1170730113 20:18966588-18966610 ATGGATGAATTGACAGAAGTAGG + Intergenic
1171777520 20:29382958-29382980 TTGGGTAAACAGGCAGAGGTTGG - Intergenic
1171816887 20:29793445-29793467 ATGGCTGAATTGACAAAAGTAGG + Intergenic
1171901458 20:30862533-30862555 ATGGCTGAATTGACAAAAGTAGG - Intergenic
1172273695 20:33668429-33668451 TTCTCTGAACTGGCAGTGGTTGG - Exonic
1172942447 20:38663838-38663860 TTTGCTGATCTCACAGAGGAGGG - Intergenic
1173071847 20:39775706-39775728 TTGGAAGAACTGAATGAGGTAGG - Intergenic
1173149502 20:40553908-40553930 ATGGATGAATTGACAGAAGTCGG + Intergenic
1173764455 20:45595019-45595041 ATGGATGAATTGACAGAAGTAGG - Intergenic
1175339627 20:58220088-58220110 ATGACTGAGCTGACAGAGGCTGG + Intronic
1175974069 20:62701677-62701699 CTGGGGGAACTGGCAGAGGTGGG - Intergenic
1176220815 20:63968736-63968758 TTGGCTGAAGTGGTAGTGGTGGG - Intronic
1176451111 21:6861972-6861994 TTTGATGAATTGACAGAAGTAGG + Intergenic
1176523071 21:7839231-7839253 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1176641819 21:9311886-9311908 TTTGATGAATTGACAGAAGTAGG + Intergenic
1176829280 21:13727023-13727045 TTTGATGAATTGACAGAAGTAGG + Intergenic
1176987539 21:15455360-15455382 ATGGATGAACTGACAGAAGTAGG - Intergenic
1177042562 21:16132189-16132211 TTTGATGAACTGACAGAAGTAGG - Intergenic
1177050408 21:16225759-16225781 TTTGATGAATTGACAGAGGTAGG + Intergenic
1177280215 21:18972468-18972490 ATGGCTGAATTGACAAAAGTAGG + Intergenic
1177388239 21:20434111-20434133 ATGGATGAATTGACAGAAGTAGG + Intergenic
1177763897 21:25434605-25434627 TTTGATGAATTGACAGAAGTAGG + Intergenic
1177878805 21:26668568-26668590 ATGGATGAATTGACAGAAGTAGG - Intergenic
1177912606 21:27051263-27051285 ATGGATGAACTGTCAGAAGTAGG - Intergenic
1178049333 21:28731012-28731034 ATGGGTGAAATGACAGAGGATGG + Intergenic
1178351649 21:31875935-31875957 TTGGCTGAACTGCCTGGGGGTGG + Intronic
1178657091 21:34469243-34469265 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1180250241 21:46581437-46581459 ATGGATGAACTGACAGAAGTAGG - Intergenic
1180334828 22:11568478-11568500 ATGGCTGAATTGACAAAAGTAGG - Intergenic
1180375109 22:12084636-12084658 TTTGATGAATTGACAGAAGTAGG + Intergenic
1181811510 22:25406041-25406063 GTGGCTGAGCTGACACCGGTGGG - Intergenic
1182686209 22:32122973-32122995 ATGGCTGCACTGCCAGAGGCAGG + Intergenic
1182690915 22:32161670-32161692 TTGGCTGAAAAGAGAGATGTGGG + Intergenic
1183414686 22:37675564-37675586 TTGGCTGAACTTTCAGGGGGCGG + Intergenic
1185160942 22:49229490-49229512 TTGGCTTAAATGACAGGTGTAGG - Intergenic
949173742 3:1034115-1034137 TTGGACGAATTGACAGAAGTAGG - Intergenic
949175921 3:1062774-1062796 TTTGATGAATTGACAGAAGTAGG - Intergenic
949222578 3:1653569-1653591 TTTGATGAATTGACAGAAGTAGG - Intergenic
949377789 3:3408719-3408741 TTTGATGAATTGACAGAAGTAGG + Intergenic
949592833 3:5511361-5511383 ATGGATGAATTGACAGAGGTAGG + Intergenic
949640303 3:6029293-6029315 TTTGATGAACTGACAGAAGTAGG - Intergenic
949683271 3:6540479-6540501 TGTGATGAATTGACAGAGGTAGG - Intergenic
949787587 3:7758877-7758899 TTGGTAGAATTGACATAGGTTGG - Intergenic
949801074 3:7905332-7905354 TTTGATGAATTGACAGAAGTAGG - Intergenic
949846228 3:8373035-8373057 TTTGATGAATTGACAGAAGTAGG + Intergenic
950876777 3:16282647-16282669 TTGGTAGAACTGAGAGAGCTTGG + Intronic
950995673 3:17493917-17493939 ATGGATGAACTGACAGAAATAGG - Intronic
951183040 3:19681669-19681691 TTTGATGAATTGACAGAAGTAGG - Intergenic
951237586 3:20253675-20253697 TTTGATGAATTGACAGAAGTAGG - Intergenic
951254363 3:20432109-20432131 TTTGATGAATTGACAGAAGTAGG - Intergenic
951503531 3:23417041-23417063 TTAGATGAACTGACAGAAGTAGG - Intronic
951741819 3:25932638-25932660 TTTGATGAATTGACAGAAGTAGG + Intergenic
951922650 3:27873179-27873201 TCTGCTGACCTGAGAGAGGTAGG - Intergenic
951957651 3:28275082-28275104 ATGGATGAACTGACAGAAGTAGG - Intronic
951996462 3:28735758-28735780 ATGGCTGAATTGACAGAAGTAGG - Intergenic
952098492 3:29984403-29984425 TTTGATGAATTGACAGAAGTGGG - Intronic
952517588 3:34121561-34121583 TTTGATGAGCTGACAGAAGTAGG - Intergenic
952634155 3:35506274-35506296 ATGGGTGAATTGACAGAAGTAGG + Intergenic
952673494 3:35999609-35999631 ATGGCTAAAATGACAGAAGTAGG - Intergenic
953053057 3:39363013-39363035 ATGGCTGAATTGACAGAAGTAGG + Intergenic
953264399 3:41371794-41371816 TTTGATGAATTGACAGAAGTAGG + Intronic
953555105 3:43939431-43939453 TTTGATGAATTGACAGAAGTAGG - Intergenic
953816429 3:46162281-46162303 ATTGCTGAAATGACAGAAGTAGG - Intergenic
954508065 3:51096634-51096656 TTTGGTGAATTGACAGAAGTAGG - Intronic
954525086 3:51262568-51262590 TTTGATGAATTGACAGAAGTAGG + Intronic
954950667 3:54469579-54469601 TTTGATGAACTGACAGAAGTAGG + Intronic
955119046 3:56037201-56037223 ATGGATGAACTGACAGAAGTAGG + Intronic
955361552 3:58280582-58280604 TTTGCTGAGCTGACAGAAGTAGG - Intronic
955441717 3:58963091-58963113 TTGACTGTACTGACAGAGCTGGG + Intronic
955447939 3:59033348-59033370 TTTGATGAACTGACAGAAGTAGG + Intronic
956243542 3:67155422-67155444 TTTGATGAACTGACAGAAGTAGG + Intergenic
956279494 3:67541206-67541228 TTTGATGAATTGACAGAAGTAGG + Intronic
956301775 3:67780588-67780610 TTTGATGAACTGACAGAAGTAGG - Intergenic
957008944 3:74983663-74983685 TTTGATGAATTGACAGAAGTAGG - Intergenic
957584208 3:82113865-82113887 ATGGATGAATTGACAGAAGTAGG - Intergenic
957629963 3:82706394-82706416 ATGGATGAATTGACAGAAGTAGG - Intergenic
958622092 3:96575277-96575299 TTTGATGAACTGACAGAAGTAGG - Intergenic
959025782 3:101237871-101237893 TTTGATGAAGTGACAGAAGTAGG + Intronic
959030962 3:101299382-101299404 ATGGATGAATTGACAGAAGTAGG - Intronic
959092940 3:101924035-101924057 TTTGATGAATTGACAGAAGTAGG - Intergenic
959256343 3:104019712-104019734 ATGGCAGAACTGGCAGAAGTAGG + Intergenic
959278330 3:104305452-104305474 TTTGATGAAGTGACAGAAGTAGG + Intergenic
959428551 3:106223379-106223401 TTTGATGAATTGACAGAAGTAGG - Intergenic
959452842 3:106524024-106524046 ATGGATGAATTGACAGAAGTAGG + Intergenic
959506048 3:107157146-107157168 TTTGATGAACTGACAGAAGTAGG + Intergenic
959848210 3:111057813-111057835 TTTGATGAACTGACAGAAGTAGG + Intergenic
960378009 3:116927284-116927306 TTTGATGAATTGACAGAAGTAGG - Intronic
960413859 3:117359878-117359900 ATGGATGAATTGACAGAAGTAGG + Intergenic
960491498 3:118321603-118321625 TTTGATGAATTGACAGAAGTAGG - Intergenic
960502378 3:118453938-118453960 ATGGCTGAAATAACAGGGGTAGG - Intergenic
960596663 3:119413742-119413764 TTTGCTGAACTGGCACAGGCTGG + Intronic
960759972 3:121062998-121063020 TTTGATGAATTGACAGAAGTAGG - Intronic
960770096 3:121184214-121184236 TTTGATGAACCGACAGAAGTAGG + Intronic
960835945 3:121907342-121907364 TTTGATGAGCTGACAGAAGTAGG - Intronic
962026824 3:131556411-131556433 TTGGCTAATTTGACAGAGCTTGG + Intronic
962244347 3:133779329-133779351 TTGGCTGAACATACAGAATTTGG + Intergenic
962512473 3:136115398-136115420 TTTGACGAACTGACAGAAGTAGG + Intronic
962841060 3:139232961-139232983 TTGGCCACACTGACAGAGGAAGG + Intronic
962956828 3:140274390-140274412 TTAGCTGAATGGACAGAGTTGGG - Intronic
962984336 3:140521127-140521149 TTGGCTGGACTGATAGAAGTAGG - Intronic
963756127 3:149236359-149236381 ATGGCTGAATTGACAAAAGTAGG + Intergenic
964183432 3:153914144-153914166 ATGGCTGAAGTGACAGAAGTAGG + Intergenic
964295032 3:155224655-155224677 ATGGATGAATTGACAGAAGTAGG - Intergenic
964377901 3:156068153-156068175 TTTGATGAATTGACAGAAGTAGG - Intronic
965342987 3:167512612-167512634 ATGGATGAATTGACAGAAGTAGG + Intronic
965435724 3:168648597-168648619 ATGGCTGATCTGACAGAAGGTGG - Intergenic
965497398 3:169414534-169414556 TTTGATGAATTGACAGAAGTAGG + Intronic
965654911 3:170974286-170974308 TTTGATGAATTGACAGAAGTAGG - Intergenic
965725402 3:171710541-171710563 GTGGCTGATCTGACAGAAGGCGG + Intronic
966251206 3:177866871-177866893 TTTGATGAATTGACAGAAGTAGG + Intergenic
966291317 3:178362261-178362283 TTTGATGAATTGACAGAAGTAGG + Intergenic
966309557 3:178577519-178577541 TTTGATGAATTGACAGAAGTAGG + Intronic
966477679 3:180368504-180368526 TTTGATGAGCTGACAGAAGTAGG + Intergenic
966573684 3:181476378-181476400 ATGGCTGAATTTACAGAAGTAGG - Intergenic
966652226 3:182314626-182314648 AAGGATGAACTGACAGAAGTAGG - Intergenic
967574927 3:191078026-191078048 ATGGCTGAAATGATAGAAGTAGG + Intergenic
968358894 3:198132905-198132927 ATGGCTGAATTGACAAAAGTAGG - Intergenic
1202745075 3_GL000221v1_random:93132-93154 TTTGATGAATTGACAGAAGTAGG - Intergenic
968390244 4:186894-186916 ATGGCTGAAATGATAGAAGTAGG - Intergenic
968404497 4:328043-328065 ATGGCTGAAATGAGAGAAGTAGG + Intergenic
968437043 4:598918-598940 ATGGCTGAACTGACAGAAGCAGG - Intergenic
968860528 4:3165901-3165923 TTTGATGAATTGACAGAAGTAGG - Intronic
969123262 4:4925309-4925331 TTTGATGAATTGACAGAAGTAGG - Intergenic
969164687 4:5297772-5297794 TTTGATGAATTGACAGAAGTAGG - Intronic
969874659 4:10127145-10127167 TTGGCTGAACTAACAGGGCTAGG + Intergenic
969909060 4:10427101-10427123 TTTGATGAAGTGACAGAAGTAGG - Intergenic
969970896 4:11047244-11047266 TTTGATGAACTGACAGAAGTAGG - Intergenic
970412237 4:15819400-15819422 GTGGATGAATTGACAGAAGTAGG + Intronic
970494430 4:16610363-16610385 ATGGATGAATTGACAGAAGTAGG + Intronic
970864200 4:20739742-20739764 TTTGATGAGCTGACAGAAGTAGG + Intronic
970952611 4:21774936-21774958 ATGGATGAAATGACAGAAGTAGG - Intronic
971298901 4:25425712-25425734 ATGGCTGCACTCACAGAGCTCGG + Intergenic
971746314 4:30586234-30586256 ATGGATGAACTGACAGAAGTAGG - Intergenic
971790525 4:31164699-31164721 TTAGCTGAACCGATAGAGGTAGG - Intergenic
971943080 4:33240625-33240647 TTTGATGAACTGACAGAAGTAGG - Intergenic
971988836 4:33865084-33865106 TTTGATGAATTGACAGAAGTAGG + Intergenic
972219450 4:36936769-36936791 TTTGATGAATTGACAGAAGTAGG + Intergenic
972255746 4:37353836-37353858 TTTGATGAATTGACAGAAGTAGG - Intronic
973094260 4:46177132-46177154 ATGGCTGAACTGACTGAAATAGG + Intergenic
973321941 4:48818574-48818596 TTTGATGAATTGACAGAAGTGGG + Intronic
973545001 4:51972717-51972739 ATGGATGAACTGACAGAAGTAGG - Intergenic
973556693 4:52091279-52091301 TTTGATGAACTGACAGAAGTAGG - Intronic
973562773 4:52152650-52152672 TTTGATGAAGTGACAGAAGTAGG + Intergenic
973798526 4:54452343-54452365 TTTGATGAATTGACAGAAGTAGG + Intergenic
973837610 4:54825853-54825875 TTTGATGAATTGACAGAAGTAGG + Intergenic
974265632 4:59583251-59583273 TTTGATGAATTGACAGAAGTAGG - Intergenic
974280152 4:59781267-59781289 TTTGATGAATTGACAGAAGTAGG + Intergenic
974539664 4:63218322-63218344 ATGGCTGAATTGACAGAAGTAGG - Intergenic
974814553 4:66988430-66988452 ATGAATGAACTGACAGAAGTAGG - Intergenic
974851645 4:67411709-67411731 TTTGATGAATTGACAGAAGTTGG - Intergenic
974871864 4:67653685-67653707 TTTGATGAGCTGACAGAAGTAGG + Intronic
974885349 4:67810515-67810537 ATGGACGAATTGACAGAGGTAGG + Intergenic
974943958 4:68504090-68504112 TTTGATGAATTGACAGAAGTAGG + Intergenic
975153611 4:71046241-71046263 ATGGTTGAATTGACAGAAGTAGG + Intergenic
975178037 4:71309832-71309854 TTTGATGAATTGACAGAAGTAGG + Intronic
975219344 4:71796655-71796677 TTTGACGAACTGACAGAAGTAGG - Intronic
975424840 4:74214200-74214222 TTTGATGAATTGACAGAAGTAGG - Intronic
975489978 4:74977109-74977131 ATGGATGAATTGACAGAAGTAGG + Intronic
975513826 4:75222463-75222485 TTTGAAGAACTGACAGAAGTAGG + Intergenic
975582123 4:75916517-75916539 TTGGCTGAATTCCCAGAAGTAGG - Intronic
975744527 4:77463584-77463606 TTTGATGAGCTGACAGAAGTAGG - Intergenic
975998382 4:80341823-80341845 CTGCCTGAATTGGCAGAGGTAGG + Intronic
976065683 4:81184640-81184662 TTTGATGAATTGACAGAAGTAGG + Intronic
976159685 4:82185257-82185279 TTTGATGAATTGACAGAAGTAGG + Intergenic
976790365 4:88871294-88871316 TTTGATGAATTGACAGAAGTAGG + Intronic
976792908 4:88899783-88899805 ATGGCTGAATTGACAGAATTAGG + Intronic
976852758 4:89567575-89567597 TTTGATGAATTGACAGAAGTAGG - Intergenic
977039926 4:92002830-92002852 ATGAATGAACTGACAGAAGTAGG + Intergenic
977414932 4:96721231-96721253 GTGGTTGAACTGACGGAAGTAGG - Intergenic
977632847 4:99262783-99262805 TTTGATGAATTGACAGAAGTAGG - Intergenic
977671523 4:99700223-99700245 TTTGATGAATTGACAGAAGTAGG + Intergenic
977744553 4:100530219-100530241 TTTGATGATCTGACAGAAGTAGG - Intronic
977994591 4:103485904-103485926 TTTGATGAACTGATAGAAGTAGG + Intergenic
978055043 4:104253092-104253114 TTTGATGAACTGACAGAAGTAGG + Intergenic
978090424 4:104708004-104708026 TTTGATGAATTGACAGAAGTAGG + Intergenic
978118622 4:105050979-105051001 ATAGCTGAAATGACAGAAGTAGG + Intergenic
978328026 4:107580343-107580365 ATGGATGAACTGACAGAAGTAGG + Intergenic
978494131 4:109340744-109340766 TTTGATGAGCTGACAGAAGTAGG + Intergenic
978601281 4:110431161-110431183 TTTGATGAATTGACAGAAGTAGG - Intronic
978656966 4:111075707-111075729 ATGGATGAATTGACAGAAGTAGG + Intergenic
978664422 4:111165186-111165208 TCTGATGAACTGACAGAAGTAGG + Intergenic
978699638 4:111627444-111627466 TTTGATGAATTGACAGAAGTAGG - Intergenic
979012453 4:115388399-115388421 TTTGATGAATTGACAGAAGTAGG + Intergenic
979097061 4:116563829-116563851 ATGGCTGAAATGGCAGAAGTAGG + Intergenic
979115399 4:116816230-116816252 TTTGATGAATTGACAGAAGTAGG + Intergenic
979417582 4:120461806-120461828 TTTGATGAATTGACAGAAGTAGG + Intergenic
979421524 4:120510261-120510283 TTTGATGAATTGACAGAAGTAGG + Intergenic
979461486 4:120989682-120989704 TTTGATGAATTGACAGAAGTAGG - Intergenic
979576238 4:122294766-122294788 ATGGCTGAATTGACAGAAGTAGG + Intronic
979588116 4:122445300-122445322 TTTGACGAACTGACAGAAGTAGG - Intergenic
979732691 4:124044520-124044542 ATGGATGAAGTGACAGAAGTAGG - Intergenic
979735182 4:124073731-124073753 GTGGGTGAATTGACAGAAGTAGG + Intergenic
979742528 4:124168653-124168675 ATGGATGAACTGACAGAAGTAGG + Intergenic
979819244 4:125150847-125150869 TTGGATGAATTGACAGAAGTAGG - Intergenic
979952158 4:126906684-126906706 TTGGCTGAACTGACAGGAGGCGG - Intergenic
979967234 4:127089352-127089374 ATGGATGAAATGACAGAAGTAGG + Intergenic
979998572 4:127463138-127463160 TTTGATGAATTGACAGAAGTAGG - Intergenic
980007249 4:127557365-127557387 TGGGCTGTACTGATAGAGCTTGG - Intergenic
980100190 4:128534880-128534902 TTTGACGAACTGACAGAAGTAGG - Intergenic
980276016 4:130651526-130651548 TTTGATGAATTGACAGAAGTAGG + Intergenic
980333496 4:131440029-131440051 GTTGCTGAAATGACAGAAGTAGG - Intergenic
980562145 4:134491178-134491200 TAGGCTGAAATTAAAGAGGTGGG + Intergenic
980583603 4:134786158-134786180 TTTGATGAATTGACAGAAGTAGG - Intergenic
980645163 4:135634802-135634824 ATGGCTGAATTGACAGAAGTAGG - Intergenic
981395968 4:144249478-144249500 TTTGATGAATTGACAGAAGTAGG - Intergenic
981671680 4:147293619-147293641 TTTGACGAACTGACAGAAGTAGG + Intergenic
981789510 4:148520895-148520917 TTTGATGAACTGACAGAAGTAGG - Intergenic
981790816 4:148535102-148535124 ATGGCTGAATTGACAGGAGTAGG - Intergenic
981794823 4:148584592-148584614 TTTGACGAACTGACAGAAGTAGG - Intergenic
981846645 4:149176993-149177015 TTTAATGAACTGACAGAAGTAGG + Intergenic
982033263 4:151321967-151321989 TTGCCTGACCTGACAGAGAGTGG - Intronic
982528352 4:156506756-156506778 ATGGATGAATTGACAGAAGTAGG + Intergenic
982725460 4:158901978-158902000 TTTGATGAATTGACAGAAGTAGG - Intronic
982733545 4:158980859-158980881 TTTGATGAACTGACAAAAGTAGG + Intronic
982815272 4:159876883-159876905 TTTGATGAATTGACAGAAGTAGG - Intergenic
982859704 4:160433944-160433966 ATGGATGAATTGACAGAAGTAGG - Intergenic
983169470 4:164520028-164520050 ATAGATGAACTGACAGAAGTAGG - Intergenic
983298902 4:165901229-165901251 TTTGATGAATTGACAGAAGTAGG - Intronic
983543433 4:168936433-168936455 TTTGACGAACTGACAGAAGTAGG + Intronic
983596185 4:169471112-169471134 TTTGATGAATTGACAGAAGTAGG - Intronic
983602598 4:169547962-169547984 TTTGATGAATTGACAGAAGTAGG - Intronic
983631829 4:169857194-169857216 TTGGCTGATCTGACAGGAGGTGG + Intergenic
983717844 4:170807498-170807520 ATGGCTGAACTGACAGAAGTGGG - Intergenic
983821103 4:172193987-172194009 ATGGATGAATTGACAGAAGTAGG + Intronic
983840985 4:172456351-172456373 TTTGATGAATTGACAGAAGTAGG + Intronic
984269726 4:177536300-177536322 TTTGATGAACTGACAGAAATAGG - Intergenic
984493797 4:180469537-180469559 TTTGATGAATTGACAGAAGTAGG + Intergenic
984723462 4:182998486-182998508 ATGGATGAATTGACAGAAGTAGG + Intergenic
984854108 4:184178020-184178042 ATGGATGAACTGATAGAAGTAGG + Intronic
985443292 4:190001035-190001057 TTGGATAAACAGGCAGAGGTTGG - Intergenic
1202756702 4_GL000008v2_random:70083-70105 TTTGATGAATTGACAGAAGTAGG + Intergenic
986005877 5:3668912-3668934 TTTGATGAATTGACAGAAGTAGG - Intergenic
986484471 5:8221163-8221185 TTTGATAAATTGACAGAGGTAGG + Intergenic
986581798 5:9273008-9273030 TTTGATGAATTGACAGAAGTAGG + Intronic
986648071 5:9937911-9937933 TTTGATGAATTGACAGAAGTAGG + Intergenic
986675318 5:10178812-10178834 TTTGATGAATTGACAGAAGTAGG + Intergenic
986765846 5:10925584-10925606 TTTGATGAGCTGACAGAAGTAGG + Intergenic
986838698 5:11671769-11671791 TTTGATGAACTGACAGAAGTAGG - Intronic
988110596 5:26813857-26813879 ATGGATGAATTGACAGAAGTAGG + Intergenic
988306200 5:29497959-29497981 ATGGCTGAAGTGACAGAAATAGG - Intergenic
988618352 5:32796157-32796179 TTTGATGAATTGACAGAAGTAGG + Intergenic
989192500 5:38685043-38685065 TTGTCTGAACAGACAAAGGGAGG - Intergenic
989305565 5:39951361-39951383 ATGGATAAACTGACAGATGTAGG + Intergenic
990183642 5:53190349-53190371 TTTGATGAATTGACAGAAGTAGG - Intergenic
990283950 5:54280949-54280971 TTGGGTCAACTGACACAGGCTGG + Intronic
990619975 5:57549406-57549428 ATGGATGAATTGACAGAAGTAGG - Intergenic
990704865 5:58516303-58516325 ATGGCTGAATTGACAAAAGTAGG + Intergenic
990940606 5:61199802-61199824 ATGGATGAATTGACAGAAGTAGG - Intergenic
991199894 5:63979876-63979898 TTTGATGAGCTGACAGAAGTAGG - Intergenic
991223703 5:64244241-64244263 TTTGATGAATTGACAGAAGTAGG + Intronic
991280667 5:64909919-64909941 TTTGATGAGCTGACAGAAGTAGG - Intronic
991283106 5:64939098-64939120 TTTGATGAATTGACAGAAGTAGG - Intronic
991652203 5:68866421-68866443 TTTGATGAATTGACAGAAGTAGG + Intergenic
991910956 5:71560778-71560800 GTTGCTGAACTGAAAGAGGTGGG + Intronic
992292309 5:75292246-75292268 TTTGATGAATTGACAGAAGTAGG - Intergenic
992383714 5:76264424-76264446 TTTGATGAATTGACAGAAGTAGG - Intronic
992571824 5:78066315-78066337 ATGGATGAACTGACAGAAGTAGG + Intronic
992976764 5:82129333-82129355 TTTGATGAATTGACAGAAGTAGG - Intronic
993253486 5:85557171-85557193 ATGGATGAATTGACAGAAGTAGG + Intergenic
993265610 5:85722458-85722480 TTTGACGAACTGACAGAAGTAGG + Intergenic
993365410 5:87029441-87029463 ATGGATGAACTGACAGAAGCAGG - Intergenic
993375816 5:87148765-87148787 ATGGCTGAATTGACAAAAGTAGG - Intergenic
993380723 5:87204184-87204206 TTTGATGAATTGACAGAAGTAGG - Intergenic
993404075 5:87488961-87488983 TTTGACGAACTGACAGAAGTAGG + Intergenic
993410346 5:87566509-87566531 TTTGATGAAATGACAGAAGTAGG - Intergenic
993420904 5:87700184-87700206 ATGGATGAACTGACAGAAGGAGG - Intergenic
993497322 5:88622437-88622459 TTTGATGAGCTGACAGAAGTAGG - Intergenic
994015167 5:94956416-94956438 TTTGATGAATTGACAGAAGTAGG + Intronic
994137831 5:96308445-96308467 TTTGATGAATTGACAGAAGTAGG - Intergenic
994282388 5:97921289-97921311 TAGCCTGAACTGACAAAGGCAGG + Intergenic
994298926 5:98122533-98122555 GTGGGTGAATTGACAGAAGTAGG + Intergenic
994350811 5:98743456-98743478 ATGGATGAATTGACAGAAGTAGG + Intergenic
994551274 5:101238542-101238564 ATGGCTGAAATGACAAAAGTGGG - Intergenic
994991176 5:106999242-106999264 TTTGACGAACTGACAGAAGTAGG - Intergenic
995108333 5:108399918-108399940 TTTGATGAATTGACAGAAGTAGG + Intergenic
995263666 5:110135021-110135043 TTTGATGGACTGACAGAAGTGGG - Intergenic
995326087 5:110892045-110892067 TTTGATGAATTGACAGAAGTAGG - Intergenic
995329602 5:110932788-110932810 ATGGTTGAAGTGACAGAAGTAGG - Intergenic
995398571 5:111716183-111716205 TTTGATGAATTGACAGAAGTAGG - Intronic
995578916 5:113573951-113573973 ATGGCTAAAATGACAGAAGTAGG - Intronic
995620746 5:114022397-114022419 TTGGATGAATTGACAGAAGTAGG + Intergenic
995694944 5:114867921-114867943 ATGGCTGAATTGATAGAAGTAGG + Intergenic
995790519 5:115882191-115882213 TTTGATGAATTGACAGAAGTAGG - Intronic
995808699 5:116081329-116081351 TTTGATGAATTGACAGAAGTAGG + Intergenic
995811017 5:116107671-116107693 TTTGACGAACTGACAGAAGTAGG - Intronic
996036454 5:118763666-118763688 ATGGCTAAATTGACAGAAGTAGG + Intergenic
996182022 5:120431388-120431410 ATGGATGAATTGACAGAAGTAGG - Intergenic
996482105 5:123987602-123987624 ATGGATGAATTGACAGAAGTAGG - Intergenic
996675834 5:126173079-126173101 ATGGATGAAATGACAGAAGTAGG + Intergenic
996782092 5:127198310-127198332 TTTGATGAGCTGACAGAAGTAGG + Intergenic
996829828 5:127727692-127727714 ATGGATAAACTGACAGAAGTAGG + Intergenic
996893963 5:128456951-128456973 ATGGATGAATTGACAGAAGTAGG + Intronic
996965728 5:129305699-129305721 ATGGATGAATTGACAGAAGTTGG - Intergenic
997097572 5:130930179-130930201 ATGGATGAATTGACAGAAGTAGG + Intergenic
997188244 5:131902805-131902827 ATGGCTGAAATGACAGAAATAGG + Intronic
997809396 5:136953042-136953064 TTTGATGAATTGACAGAAGTAGG - Intergenic
999688440 5:154123308-154123330 TTTGATGAATTGACAGAAGTAGG + Intronic
1000376005 5:160583070-160583092 TTTGATGAATTGACAGAAGTAGG - Intronic
1000509782 5:162166184-162166206 ATGGCTGAAATGACAGAAGTGGG + Intergenic
1000590164 5:163147883-163147905 TTTGATGAACTGACAGAAGTAGG + Intergenic
1001372488 5:171219883-171219905 TTTGATGAATTGACAGAAGTAGG - Intronic
1001454425 5:171849728-171849750 TTGGCTGAAGTCACAGAGTGGGG - Intergenic
1001738998 5:174034571-174034593 ATGGATGAATTGACAGAAGTAGG - Intergenic
1001844163 5:174905545-174905567 ATGGCTGAAATGACAGAAGTTGG + Intergenic
1001980759 5:176035731-176035753 TTTGCTGCACTGCCAGAGGCAGG - Intergenic
1002236701 5:177808334-177808356 TTTGCTGCACTGCCAGAGGCAGG + Intergenic
1002655874 5:180746218-180746240 TTCGCTGAAATGACAGATTTGGG - Intergenic
1002672988 5:180885394-180885416 TTTGATGAATTGACAGAAGTAGG - Intergenic
1002677298 5:180927480-180927502 TTTGATGAATTGACAGAAGTAGG + Intronic
1002944978 6:1752034-1752056 TTTGATGAATTGACAGAAGTAGG + Intronic
1003248882 6:4406792-4406814 ATGGATGAATTGACAGAAGTAGG + Intergenic
1003434291 6:6071707-6071729 TTTGATGAATTGACAGAAGTAGG - Intergenic
1003902437 6:10667720-10667742 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1003987671 6:11452957-11452979 TTTGATGAGCTGACAGAAGTCGG + Intergenic
1004028123 6:11838346-11838368 TTTGATGAATTGACAGAAGTAGG + Intergenic
1004056173 6:12140519-12140541 TTTGATGAGCTGACAGAAGTAGG + Intronic
1004424722 6:15499564-15499586 CTGTCTCAACTTACAGAGGTAGG - Intronic
1004809124 6:19239839-19239861 TTTGATGAATTGACAGAAGTAGG + Intergenic
1005376162 6:25185024-25185046 TTTGATGAACTGACAGAAGTAGG - Intergenic
1005747247 6:28849591-28849613 TTTGATGAATTGACAGAAGTAGG + Intergenic
1006198267 6:32262374-32262396 TTTGATGAACTGACAGAAGTAGG - Intergenic
1006200131 6:32280675-32280697 TTTGACGAACTGACAGAAGTAGG + Intergenic
1006240993 6:32679061-32679083 ATGGATGACTTGACAGAGGTAGG - Intergenic
1006498177 6:34439243-34439265 TTGGTTCAGCTGAAAGAGGTGGG - Intergenic
1006609842 6:35287744-35287766 CTGGCCGTACAGACAGAGGTGGG + Exonic
1006703573 6:35997221-35997243 GTGGCTGATCTGACAGAAGGTGG - Intronic
1007133827 6:39501479-39501501 ATGGCTGAAATGACAGAAGTAGG + Intronic
1007305396 6:40900006-40900028 GTGGCTGATCTGACAGAGCAAGG - Intergenic
1007614140 6:43170772-43170794 TTGGCTGAGCGGAGAGAGCTTGG - Intergenic
1007858271 6:44880076-44880098 TTTGACGAACTGACAGAAGTAGG + Intronic
1008082775 6:47210897-47210919 ATGGCTGAATTGACAGAAGTAGG + Intergenic
1008298599 6:49806645-49806667 ATGGCTGAATTGACAGAAATAGG + Intergenic
1008317930 6:50069856-50069878 TTGGGTGAACTTTCATAGGTTGG + Intergenic
1008782606 6:55126107-55126129 TTTGACGAATTGACAGAGGTAGG - Intronic
1008785240 6:55159489-55159511 TTTGATGAATTGACAGAAGTAGG + Intronic
1009054445 6:58317583-58317605 TTTGATGAATTGACAGAAGTAGG + Intergenic
1009236691 6:61132992-61133014 TTTGATGAATTGACAGAAGTAGG - Intergenic
1009336195 6:62493170-62493192 TTTGATGAATTGACAGAAGTAGG + Intergenic
1009523820 6:64718200-64718222 TTAGCTGAACTGAGCTAGGTAGG + Intronic
1009570311 6:65375538-65375560 TTTGATGAACTGACAGAAGTAGG + Intronic
1009707010 6:67265561-67265583 ATGGATGAATTGACAGAAGTAGG - Intergenic
1009727731 6:67557349-67557371 TTTGATGAACTGACAGAAGTAGG - Intergenic
1009880633 6:69561613-69561635 TTGGAAGAATTGACAGAAGTCGG + Intergenic
1010459587 6:76098695-76098717 TTTGATGAATTGACAGAAGTAGG + Intergenic
1010488742 6:76449372-76449394 TTGGCTGAACTGTCAGAACTTGG + Intergenic
1010594715 6:77749270-77749292 TTTGATGAATTGACAGAAGTAGG + Intronic
1010718850 6:79260865-79260887 ATGGATGAATTGACAGAAGTAGG - Intergenic
1010727136 6:79347910-79347932 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1010822549 6:80432669-80432691 TTGGATGAATTGACAGAAGTAGG - Intergenic
1011062882 6:83292112-83292134 TTTGATGAATTGACAGAAGTAGG - Intronic
1011137277 6:84114567-84114589 TTTGACGAACTGACAGAAGTAGG - Intergenic
1011209294 6:84937163-84937185 TTTGCTGAGTTGACAGAAGTAGG + Intergenic
1011214269 6:84988116-84988138 ATGGCTGAATTGACAGAAGTAGG + Intergenic
1011340176 6:86305879-86305901 TTTGATAAACTGACAGAAGTAGG - Intergenic
1011815998 6:91191225-91191247 TTTGATGAATTGACAGAAGTAGG - Intergenic
1011848102 6:91591113-91591135 TTTGATGAACTGACAGAAGTAGG + Intergenic
1011916172 6:92509289-92509311 ATGGCTGAATTGACAGAAGTAGG + Intergenic
1012142751 6:95643695-95643717 ATGGCTGAATTGACAGAAGTAGG + Intergenic
1012572039 6:100741857-100741879 ATGGCTGAATTAACAGAAGTAGG - Intronic
1012644287 6:101660464-101660486 TTTGATGAATTGACAGAAGTAGG - Intronic
1012778145 6:103523043-103523065 TTTGATGAATTGACAGAAGTAGG + Intergenic
1012869538 6:104657186-104657208 TAGGCTGAAATGACAGAAGTAGG + Intergenic
1012878548 6:104757695-104757717 TTTGATGAACTGACAGAAGTAGG + Intronic
1013379790 6:109556974-109556996 ATGGATGAACTGACAGAGGTAGG - Intronic
1013390382 6:109680103-109680125 TTTGATGAACTGACAGAAGTAGG + Intronic
1013556126 6:111259186-111259208 TTAGCTGAGCTCACAGAGGCTGG - Intergenic
1013682724 6:112542501-112542523 TTTGATGAATTGACAGAAGTAGG + Intergenic
1013920348 6:115395914-115395936 ATGGATGAATTGACAGAAGTAGG - Intergenic
1014084906 6:117330991-117331013 ATGGATGAACTGACAGAAGTAGG + Intronic
1014122947 6:117746749-117746771 TTTGATGAATTGACAGAAGTAGG + Intergenic
1014278971 6:119419110-119419132 TTTGATGAATTGACAGAAGTAGG + Intergenic
1014422437 6:121261781-121261803 ATGGATGAACTGACAGAAGTGGG + Intronic
1014464382 6:121738011-121738033 ATGGATGAACTGACAGAAGTAGG - Intergenic
1014466462 6:121761645-121761667 TTTGATGAATTGACAGAAGTAGG + Intergenic
1014564251 6:122929533-122929555 ATGGCTGCACTGACAGAAGTAGG - Intergenic
1014584724 6:123183606-123183628 TTTGACGAACTGACAGAAGTAGG + Intergenic
1014864148 6:126506709-126506731 ATGGATGAAATGACAGAAGTAGG + Intergenic
1015047030 6:128788205-128788227 TTTGATGAATTGACAGAAGTAGG + Intergenic
1015109046 6:129570120-129570142 TTTGATGAATTGACAGAAGTAGG + Intergenic
1015211447 6:130702767-130702789 TTTGATGAATTGACAGAAGTAGG + Intergenic
1015290248 6:131531171-131531193 TTTGATGAGCTGACAGAAGTAGG - Intergenic
1015291215 6:131539716-131539738 TTTGAAGAATTGACAGAGGTAGG + Intergenic
1015387095 6:132636271-132636293 TTTGACGAACTGACAGAAGTAGG + Intergenic
1015585934 6:134776379-134776401 TTTGATGAATTGACAGAAGTAGG + Intergenic
1015587500 6:134790381-134790403 ATGGATGAACTGATAGACGTAGG + Intergenic
1015659998 6:135565231-135565253 ATGGATGAATTGACAGAAGTAGG - Intergenic
1016241994 6:141941239-141941261 TTTGACGAACTGACAGAAGTAGG + Intergenic
1016423669 6:143912253-143912275 ATGGTTGAAATGACAGAAGTAGG - Intronic
1016443379 6:144107923-144107945 TTAGCTGAACTGACTCAGCTAGG - Intergenic
1016483366 6:144507256-144507278 TTTGATGAATTGACAGAAGTAGG - Intronic
1016523775 6:144976707-144976729 TTTGATGAACTGACAGAAGTAGG - Intergenic
1016591014 6:145743082-145743104 TTTGATGAATTGACAGAAGTAGG + Intergenic
1016850281 6:148612246-148612268 TTGGCTGAACTTTTAGAAGTTGG - Intergenic
1016999373 6:149985474-149985496 TTGGGTGAAGAGGCAGAGGTCGG - Intergenic
1017038533 6:150288786-150288808 TAGGCTGAACTGACAGTAGCAGG + Intergenic
1017302991 6:152883792-152883814 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1018094399 6:160372989-160373011 TTTGATGAATTGACAGAAGTAGG - Intronic
1018147065 6:160901191-160901213 ATGGCTGAAGTGACAGACATAGG + Intergenic
1018761646 6:166898963-166898985 TTGGGTGAACTCACAGAGCTGGG + Intronic
1019163496 6:170084391-170084413 TTGAGTGATCTAACAGAGGTTGG + Intergenic
1020358141 7:7300302-7300324 TTTGATGAATTGACAGAAGTAGG - Intergenic
1020428757 7:8097274-8097296 TGTGATGAACTGACAGAAGTAGG + Intergenic
1020599058 7:10248984-10249006 TTGGATGAACTGACAGAAGTAGG + Intergenic
1020608486 7:10366724-10366746 TTTGATGAATTGACAGAAGTGGG - Intergenic
1020609188 7:10373686-10373708 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1020619233 7:10497637-10497659 ATGGATGAATTGACAGAAGTAGG + Intergenic
1020621918 7:10528758-10528780 TTGGATGAATTGACAGAAGTAGG + Intergenic
1020636096 7:10697014-10697036 TTTGACGAACTGACAGAAGTAGG + Intergenic
1020640027 7:10743069-10743091 TTTGATGAATTGACAGAAGTAGG + Intergenic
1020823681 7:13001695-13001717 TTTGACGAACTGACAGAAGTAGG - Intergenic
1020867814 7:13589617-13589639 ATGGCTGAATTAACAGAAGTGGG - Intergenic
1021065184 7:16164498-16164520 TTTGATGAACTGACAGAAGTAGG - Intronic
1021180777 7:17503320-17503342 TAGGCTGAACTAACTTAGGTTGG + Intergenic
1021749218 7:23778824-23778846 TTTGATGAATTGACAGAAGTAGG - Intronic
1021782175 7:24117313-24117335 TTTGATGAACGGACAGAAGTAGG - Intergenic
1021805764 7:24353291-24353313 TTTGATGAATTGACAGAAGTAGG + Intergenic
1022347350 7:29529141-29529163 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1022634780 7:32120879-32120901 ATGGACGAATTGACAGAGGTAGG + Intronic
1022869262 7:34458359-34458381 TTTGATGAATTGACAGAGGTAGG + Intergenic
1023051617 7:36257815-36257837 TTTGACGAACTGACAGAAGTAGG - Intronic
1023196079 7:37641282-37641304 ATGGCTGAATTGACAGAATTAGG - Intergenic
1023666554 7:42528402-42528424 ATGGCTGTACTGACAGAAGTAGG + Intergenic
1024133571 7:46383476-46383498 TTGCCTGAGGTGACAGAGGAAGG + Intergenic
1024153092 7:46592097-46592119 TTTGGCGAACTGACAGAAGTAGG + Intergenic
1024374067 7:48618185-48618207 CTGACTGAACCGACAGAGGGTGG - Intronic
1024551030 7:50562436-50562458 ATGGCTGAACTCACAGTGTTTGG - Intronic
1024697674 7:51872915-51872937 AGGGCTGAAATGACAGAAGTAGG - Intergenic
1024703229 7:51927489-51927511 TTTGATGAATTGACAGAAGTAGG - Intergenic
1024795202 7:53011989-53012011 ATGGATGAACTGACAAAAGTAGG - Intergenic
1024831916 7:53470652-53470674 TTGGAAGCATTGACAGAGGTAGG - Intergenic
1024950388 7:54855009-54855031 TTTGATGAATTGACAGAAGTAGG - Intergenic
1024990431 7:55231080-55231102 ATGACTGAAATGACAGAAGTAGG - Intronic
1025637804 7:63339109-63339131 TTTGATGAATTGACAGAAGTAGG - Intergenic
1025644893 7:63408990-63409012 TTTGATGAATTGACAGAAGTAGG + Intergenic
1025788014 7:64661037-64661059 TTTGATGAATTGACAGAAGTAGG + Intergenic
1026236318 7:68529949-68529971 GTGGCTAAACTAACAGAGGAAGG + Intergenic
1027510217 7:79070935-79070957 TTTGATGAATTGACAGAAGTAGG - Intronic
1028144432 7:87305503-87305525 TTTGATGAATTGACAGAAGTAGG + Intergenic
1028145755 7:87318510-87318532 TTGGACGAATTGACAGAAGTAGG - Intergenic
1028238588 7:88391283-88391305 TTGGCTAAAGTGACAGTGTTTGG + Intergenic
1028429814 7:90734802-90734824 TTTGACGAATTGACAGAGGTAGG - Intronic
1028442639 7:90881092-90881114 ATGGATGAATTGACAGAAGTAGG + Intronic
1028523772 7:91760210-91760232 TTTGATGAATTGACAGAAGTAGG + Intronic
1028626913 7:92888337-92888359 ATGGATGATTTGACAGAGGTAGG - Intergenic
1028648390 7:93122490-93122512 TTTGATGAATTGACAGAAGTAGG + Intergenic
1028652718 7:93169421-93169443 TTTGATGAATTGACAGAAGTAGG - Intergenic
1028998242 7:97125824-97125846 TTTGATGAATTGACAGAAGTAGG - Intronic
1029039625 7:97558670-97558692 ATGGATGAATTGACAGAAGTAGG + Intergenic
1030198125 7:106873402-106873424 TTGGTTGAATTTACAGATGTAGG - Intronic
1030438339 7:109553075-109553097 ATGACTGAAATGACAGAAGTAGG + Intergenic
1030612502 7:111705204-111705226 TTTGATGAATTGACAGAAGTAGG - Intergenic
1030692059 7:112546441-112546463 ATTGATGAACTGACAGAAGTAGG - Intergenic
1030736404 7:113054035-113054057 TTTGATGAATTGACAGAAGTAGG - Intergenic
1030830097 7:114210120-114210142 ATGGATGAATTGACAGAAGTAGG - Intronic
1031157191 7:118123372-118123394 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1031711135 7:125047449-125047471 TTTGATGAATTGACAGAAGTAGG + Intergenic
1031803567 7:126279035-126279057 TTTGATGAGCTGACAGAAGTAGG - Intergenic
1032312449 7:130801520-130801542 TTTGATGAACTGACAGAAGTAGG - Intergenic
1032893437 7:136223630-136223652 TTTGATGAATTGACAGAAGTAGG + Intergenic
1033180410 7:139172377-139172399 CTGGCGGCTCTGACAGAGGTAGG - Intronic
1033525752 7:142211341-142211363 TTTGATGAACTGACAGAAATAGG + Intronic
1033565166 7:142570966-142570988 ATGGCTGAATTGACAGAAGTAGG + Intergenic
1033791633 7:144797633-144797655 ATGGATGAACTGACAGAGGTAGG + Intronic
1033887647 7:145967694-145967716 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1033977064 7:147115800-147115822 ATGGCTGAAATGACAGAAGTAGG - Intronic
1034689010 7:152999248-152999270 TTTGATGAACTGGCAGAAGTAGG - Intergenic
1035491819 7:159285677-159285699 ATGGATGAATTGACAGAAGTAGG + Intergenic
1035710888 8:1713032-1713054 TTTGATGAATTGACAGAAGTAGG + Intergenic
1035998180 8:4573109-4573131 TTTGATGAATTGACAGAAGTAGG - Intronic
1037285345 8:17293447-17293469 TTTGATGAATTGACAGAAGTAGG - Intronic
1037398444 8:18468037-18468059 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1038073823 8:24047217-24047239 ATGGATGAACTGATAGAAGTAGG + Intergenic
1038706852 8:29902202-29902224 ATGGATGAACTGACAGAGGTAGG + Intergenic
1038917104 8:32036923-32036945 ATGGATGAATTGACAGAAGTAGG - Intronic
1039133980 8:34298722-34298744 TTTGATGAATTGACAGAAGTAGG + Intergenic
1039145306 8:34439669-34439691 TTTGATGAACTGACAGAAGTAGG + Intergenic
1039265284 8:35816847-35816869 ATGGATGAACTGACAGAAGTAGG + Intergenic
1039293722 8:36126934-36126956 ATAGATGAACTGACAGAAGTAGG - Intergenic
1039801917 8:40965157-40965179 TTTGACGAACTGACAGAAGTAGG + Intergenic
1040085248 8:43333259-43333281 TTTGATGAGCTGACAGAAGTAGG - Intergenic
1040383467 8:46895097-46895119 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1040519969 8:48168353-48168375 TTTGATGAATTGACAGAAGTAGG - Intergenic
1040540779 8:48352849-48352871 TTTGACGAGCTGACAGAGGTAGG + Intergenic
1040614058 8:49017524-49017546 ATGGATGAATTGACAGAGGTAGG - Intergenic
1041241704 8:55853883-55853905 ATGGCTGCAGTGACAGAGGGAGG + Intergenic
1041423685 8:57696324-57696346 TTTGATGAATTGACAGAAGTAGG + Intergenic
1041482110 8:58332872-58332894 ATGGATGAACTGACATAAGTAGG + Intergenic
1041615433 8:59900400-59900422 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1041747467 8:61224158-61224180 ATAGATGAATTGACAGAGGTAGG - Intronic
1042473251 8:69215160-69215182 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1042489654 8:69382310-69382332 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1042753626 8:72185351-72185373 TTTGATGAACTGACAGAAGCAGG + Intergenic
1042759795 8:72257989-72258011 ATGGTTGAACTGACAGAAGTAGG + Intergenic
1042773771 8:72406309-72406331 ATGAATGAACTGACAGAAGTAGG + Intergenic
1042969183 8:74390172-74390194 TTTGATGAATTGACAGAAGTAGG - Intronic
1043025079 8:75056836-75056858 ATGGATGAATTGACAGAAGTAGG + Intergenic
1043036544 8:75207317-75207339 TTTGATGAATTGACAGAAGTAGG - Intergenic
1043324712 8:79035073-79035095 AGGGCTGAAATGACAGGGGTAGG + Intergenic
1043495920 8:80799815-80799837 ATGGCTGAATTGACAGAAGTAGG + Intronic
1043532568 8:81166813-81166835 TTTGATGAATTGACAGAAGTAGG + Intergenic
1043703722 8:83322760-83322782 TTGGAAGAATTGACAGAAGTAGG + Intergenic
1043725266 8:83602856-83602878 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1043803885 8:84646619-84646641 TGGGCTGAACTGAAAGAAGTGGG - Intronic
1044018242 8:87073292-87073314 ATGGCTGAATTGACAGAAGTAGG - Intronic
1044117118 8:88349526-88349548 ATGGCTGAATTCACAGAAGTAGG - Intergenic
1044378002 8:91499346-91499368 TTTGATGAATTGACAGAAGTAGG - Intergenic
1044447475 8:92296099-92296121 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1044508440 8:93048495-93048517 ATGGCTGAACTGACAGAATTAGG - Intergenic
1045071049 8:98505382-98505404 TTTGATGAGCTGACAGAAGTAGG - Intronic
1045595424 8:103649911-103649933 ATGGCTGAAGTGACAAAAGTAGG - Intronic
1045705312 8:104916002-104916024 ATGGATGAATTGACAGAAGTGGG - Intronic
1045840897 8:106579454-106579476 TAGGCTGAACTGAGAGAATTAGG + Intronic
1046047844 8:108985553-108985575 TTTGATGAACTGACAGAAGTAGG - Intergenic
1046067852 8:109218005-109218027 TTTGATGAATTGACAGAAGTAGG - Intergenic
1046277939 8:111986728-111986750 TTTGACGAATTGACAGAGGTAGG + Intergenic
1046416215 8:113916962-113916984 GTGGATGAATTGACAGAAGTAGG - Intergenic
1046986986 8:120398653-120398675 ATGGCTGAACTGACAGAAGTAGG + Intronic
1047369443 8:124244535-124244557 TTTGATGAATTGACAGAAGTAGG - Intergenic
1048324841 8:133430837-133430859 TTGGGTGAGATTACAGAGGTAGG - Intergenic
1048429187 8:134353236-134353258 ATGGATGAATTGACAGAAGTAGG - Intergenic
1048481123 8:134794587-134794609 TTGCCTGAACTGCCTGAGGCAGG + Intergenic
1048913968 8:139164668-139164690 TTTGATGAATTGACAGAAGTAGG - Intergenic
1049000487 8:139822808-139822830 TTGCCTGAACTGACTGTGGCAGG - Intronic
1049882353 8:145074990-145075012 ATGGCTGAATTGACAAAAGTAGG - Intergenic
1050398260 9:5223020-5223042 ATGGCTGAATTGACAGAAATAGG + Intergenic
1051003508 9:12314519-12314541 GTGAATGAACTGACAGAAGTAGG - Intergenic
1051354049 9:16224483-16224505 TTTGATGAATTGACAGAAGTAGG + Intronic
1051447268 9:17154146-17154168 TTTGACGAACTGACAGAAGTAGG - Intronic
1051458985 9:17292791-17292813 ATGGATGAACTGACACAAGTAGG - Intronic
1051703883 9:19856274-19856296 ATGCATGAACTGACAGAAGTAGG - Intergenic
1051814443 9:21088363-21088385 TTTGATGAATTGACAGAAGTAGG + Intergenic
1051914052 9:22186191-22186213 ATGGCTGGAATGACAGAAGTAGG + Intergenic
1051940092 9:22495439-22495461 TTTGATGAATTGACAGAAGTAGG - Intergenic
1052052582 9:23865598-23865620 TTTGATGAACTGACAGAAATAGG - Intergenic
1052115619 9:24645815-24645837 ATGGATGAATTGACAGAAGTAGG - Intergenic
1052176632 9:25471381-25471403 ATGGCTGAAATGACAGAAGTAGG - Intergenic
1052199872 9:25764716-25764738 ATGGATGAACTGACAGACGTAGG + Intergenic
1052281090 9:26734558-26734580 TTTGATGAATTGACAGAAGTAGG - Intergenic
1052369373 9:27646333-27646355 TTGGACGAATTGACAGAAGTAGG + Intergenic
1052382204 9:27784197-27784219 TTTGATGAATTGACAGAAGTAGG - Intergenic
1052387014 9:27834842-27834864 ATGGATGAACTGACAGAAGTAGG - Intergenic
1052515201 9:29471737-29471759 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1053039278 9:34856263-34856285 AAGGCTGAAATGACAGAAGTAGG - Intergenic
1054719646 9:68592168-68592190 TTTGATGAATTGACAGAAGTAGG - Intergenic
1054890093 9:70241452-70241474 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1055210436 9:73784160-73784182 TTTGATGAATTGACAGAAGTAGG + Intergenic
1055239362 9:74164775-74164797 TTTGATGAATTGACAGAAGTAGG + Intergenic
1055390817 9:75820739-75820761 TTTGATGAATTGACAGAAGTAGG - Intergenic
1055509671 9:76984036-76984058 ATGGCTGAATTAACAGAAGTAGG - Intergenic
1056062973 9:82903651-82903673 TTGGCTGTAGTGACAGAGCGGGG - Intergenic
1056095773 9:83251517-83251539 ATGGATGAATTGACAGAAGTAGG + Intronic
1056176656 9:84043068-84043090 TTTGACGAACTGACAGAAGTAGG - Intergenic
1056385014 9:86089746-86089768 TTTGATGAACTGACAGAAGTAGG - Intronic
1058029394 9:100178279-100178301 TTTGATGAATTGACAGAAGTAGG + Intronic
1058067408 9:100564873-100564895 GTGGTTGAACTCACAGATGTTGG + Intronic
1058199936 9:102027230-102027252 ATGGCTGAAATAACAGAAGTAGG - Intergenic
1058374434 9:104306064-104306086 ATGGATGAATTGACAGAAGTAGG + Intergenic
1059262580 9:112993058-112993080 ATGGATGAATTGACAGAAGTAGG - Intergenic
1059509872 9:114835416-114835438 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1059595498 9:115715774-115715796 TTTGCTGAAATGGCAGAGATTGG + Intergenic
1059954721 9:119503328-119503350 TTTGATGAACTGACAGAAGTAGG + Intronic
1060320982 9:122561329-122561351 ATAGATGAACTGACAGAGGCAGG - Intergenic
1060340255 9:122768737-122768759 ATGGCTGAATTGACAGAAGTAGG + Intergenic
1060870421 9:127035364-127035386 TTGGATCAACTGAGGGAGGTAGG + Intronic
1062739928 9:138165933-138165955 TTGGGTAAACAGGCAGAGGTTGG + Intergenic
1062743024 9:138192034-138192056 ATGGCTGAATTGACAAAAGTAGG - Intergenic
1062743273 9:138194035-138194057 ATGGCTGAATTGACAAAAGTAGG - Intergenic
1062743522 9:138196036-138196058 ATGGCTGAATTGACAAAAGTAGG - Intergenic
1203518070 Un_GL000213v1:22545-22567 TTTGATGAATTGACAGAAGTAGG - Intergenic
1203713700 Un_KI270742v1:123082-123104 TTTGATGAATTGACAGAAGTAGG - Intergenic
1203537496 Un_KI270743v1:54939-54961 TTTGATGAATTGACAGAAGTAGG + Intergenic
1186369884 X:8936388-8936410 TTTGATGAATTGACAGAAGTAGG - Intergenic
1186431067 X:9504450-9504472 ATGGATGAATTGACAGAAGTAGG + Intronic
1186443851 X:9608867-9608889 CTGGCTGAACTGACCAAGGCGGG - Intronic
1186593381 X:10954108-10954130 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1186740877 X:12517196-12517218 ATGGATGAATTGACAGAAGTAGG - Intronic
1186960820 X:14735222-14735244 TTTGATGAATTGACAGAAGTAGG - Intergenic
1187605327 X:20875749-20875771 ATGGATGAACTGACAGAAGTAGG + Intergenic
1187635561 X:21224240-21224262 TTTGATGAATTGACAGAAGTAGG - Intergenic
1187729662 X:22239389-22239411 TTTGATGAATTGACAGAAGTAGG + Intronic
1187818277 X:23256733-23256755 ATGACTGAATTGACAGAAGTAGG + Intergenic
1188099796 X:26070518-26070540 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1188669911 X:32869401-32869423 ACGGCTGAATTGACAGAAGTAGG + Intronic
1188860745 X:35252287-35252309 ATGGATGAATTGACAGAAGTAGG + Intergenic
1188884469 X:35532219-35532241 ATGGATGAATTGACAGAAGTAGG + Intergenic
1188900949 X:35733018-35733040 ATGGCTGAAATGACAGAAGTAGG - Intergenic
1189039636 X:37529446-37529468 TTCGATGAATTGACAGAAGTAGG - Intronic
1189581577 X:42413077-42413099 ATGGGTGAAATGACAGAAGTAGG - Intergenic
1189702475 X:43726665-43726687 TTTGATGAATTGACAGAAGTAGG - Intronic
1189721728 X:43926786-43926808 TTTGATGAATTGACAGAAGTAGG - Intergenic
1189754261 X:44254271-44254293 TTTGATGAATTGACAGAAGTAGG + Intronic
1189861301 X:45275463-45275485 ATGGCTGAATTGAGAGAAGTAGG - Intergenic
1189940022 X:46112139-46112161 ATGGATGAACTGACAGAAGTAGG - Intergenic
1189978343 X:46485360-46485382 TTTGATGAATTGACAGAAGTAGG - Intronic
1190924370 X:54888628-54888650 ATGGATGAATTGACAGAAGTAGG + Intergenic
1190995562 X:55605509-55605531 TTTGATGAACTGACAGAGGTAGG - Intergenic
1191022738 X:55879444-55879466 ATGGATGAATTGACAGAAGTAGG + Intergenic
1191034498 X:56009610-56009632 ATGGATGAATTGACAGAAGTAGG + Intergenic
1191037585 X:56043793-56043815 ATGGCTAAATTGACAGAAGTAGG - Intergenic
1191061527 X:56302701-56302723 TTAGCCGAATTGACACAGGTAGG - Intergenic
1191065411 X:56342619-56342641 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1191071904 X:56410010-56410032 TTTGATGAATTGACAGAAGTAGG - Intergenic
1191093808 X:56654026-56654048 ATGGCAGAATTGACAGAAGTAGG - Intergenic
1191096192 X:56674822-56674844 TTTGATGAATTGACAGAAGTAGG + Intergenic
1191119854 X:56891772-56891794 TTTGATGAATTGACAGAAGTAGG + Intergenic
1191185422 X:57606733-57606755 ATGGATGAACTGACAGAAGTAGG - Intergenic
1191194690 X:57708398-57708420 TTGGATGAATTGACAGAAGTAGG + Intergenic
1191198021 X:57745273-57745295 TTGGATGAATTGACAGAAGTAGG + Intergenic
1191651095 X:63538176-63538198 TTGGATGAACTGACAGAATTAGG + Intergenic
1191686855 X:63900577-63900599 TTTGATGAATTGACAGAAGTAGG + Intergenic
1191701706 X:64048853-64048875 ATGGATGAACTGACAGAAGTAGG + Intergenic
1191766450 X:64704192-64704214 ATGGATGAACTGATAGAAGTGGG - Intergenic
1191799803 X:65066132-65066154 TTTGACGAACTGACAGAAGTAGG - Intergenic
1191815494 X:65240555-65240577 GTGGCTGAATTAACAGAAGTAGG - Intergenic
1191832255 X:65428743-65428765 ATGGCTGAAATAACAGAAGTAGG - Intronic
1191872810 X:65764385-65764407 TTTGATGAATTGACAGAAGTAGG - Intergenic
1191889228 X:65924349-65924371 ATGGCTGAAATAACAGAAGTAGG - Intergenic
1191931233 X:66375631-66375653 TTTGATGAACTGACAGAAATAGG - Intergenic
1191950089 X:66581117-66581139 ATGGCTGAAATGACAGAAGTAGG + Intergenic
1191962616 X:66719762-66719784 TTTGATGAATTGACAGAAGTAGG + Intergenic
1191984959 X:66969607-66969629 TTTGATGAACTGACAGAAGTAGG + Intergenic
1192018579 X:67358894-67358916 TTTGATGAATTGACAGAAGTAGG + Intergenic
1192020696 X:67387396-67387418 TTTGATGAATTGACAGAAGTTGG + Intergenic
1192064152 X:67863725-67863747 TTTGATGAATTGACAGAAGTAGG - Intergenic
1192292960 X:69816346-69816368 ATGGCTGAATTGACAGAAGTAGG + Intronic
1192678957 X:73230996-73231018 TTTGATGATCTGACAGAAGTAGG + Intergenic
1192692238 X:73375828-73375850 TTTGATGAATTGACAGAAGTAGG + Intergenic
1192694869 X:73402499-73402521 TTTGATGAATTGACAGAAGTAGG + Intergenic
1192718504 X:73668350-73668372 ATAGCTGAAATGACAGAAGTAGG - Intronic
1192723283 X:73723109-73723131 ATGGCTGAAATGATAGAAGTAGG - Intergenic
1192878727 X:75259272-75259294 TTTGATGAATTGACAGAAGTAGG + Intergenic
1192883503 X:75313158-75313180 TTTGATGAATTGACAGAAGTAGG - Intergenic
1192897712 X:75460939-75460961 ATGCCTGAATTGACAGAAGTAGG + Intronic
1192930140 X:75798465-75798487 ATGGATGAATTGACAGAAGTAGG - Intergenic
1192977168 X:76299116-76299138 TTTGATGAACTGACAGAAGTAGG - Intergenic
1192992243 X:76472388-76472410 TTTGATGAGTTGACAGAGGTAGG + Intergenic
1192994121 X:76493796-76493818 TTTGATGAATTGACAGAAGTAGG + Intergenic
1193034596 X:76935379-76935401 TTTGATGAATTGACAGAAGTAGG + Intergenic
1193040333 X:76997976-76997998 TTTGATGAATTGACAGAAGTAGG - Intergenic
1193048253 X:77076106-77076128 ATGGATGAACGGACAGAAGTAGG - Intergenic
1193060029 X:77196449-77196471 TTTGATGAATTGACAGAAGTTGG - Intergenic
1193081457 X:77411025-77411047 TTTGATGAATTGACAGAAGTAGG - Intergenic
1193091230 X:77495313-77495335 ATGGATGAATTGACAGAAGTAGG + Intergenic
1193120991 X:77822913-77822935 TTTGATGAATTGACAGAAGTAGG - Intergenic
1193176593 X:78401439-78401461 ATGGCTGAATTGACAGAAGTAGG + Intergenic
1193190227 X:78562712-78562734 ATGGATGAACTGACAGAAATAGG - Intergenic
1193270837 X:79529401-79529423 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1193334775 X:80274881-80274903 TTTGATGAACTGACAGAAGTAGG + Intergenic
1193351913 X:80474147-80474169 TTTGATGAATTGACAGAGGTAGG - Intergenic
1193355855 X:80520190-80520212 TTTGATGAATTGACAGAAGTAGG - Intergenic
1193361579 X:80585863-80585885 TTTGATGAACTGACAGAAATAGG - Intergenic
1193377008 X:80773349-80773371 TAGGTTGAAATGACAGAGGTGGG - Intronic
1193394603 X:80968756-80968778 TTTGATGAATTGACAGAAGTAGG + Intergenic
1193402712 X:81064793-81064815 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1193435842 X:81474456-81474478 TTTGATGAGCTGACAGAAGTAGG - Intergenic
1193528201 X:82619525-82619547 ATGGCTGAATTGAGAGAAGTAGG + Intergenic
1193615880 X:83687905-83687927 TTTGATGAATTGACAGAAGTTGG - Intergenic
1193647535 X:84088148-84088170 ATGGCTGAATTGACAGAAGTGGG - Intronic
1193719375 X:84970641-84970663 ATGGATGAATTGACAGAAGTAGG - Intergenic
1193729215 X:85082081-85082103 TTTGACGAACTGACAGAAGTAGG - Intronic
1193758670 X:85439792-85439814 ATGTCTGAAATGACAGAAGTAGG - Intergenic
1193830136 X:86279668-86279690 TTTTATGAACTGACAGAAGTAGG + Intronic
1193933162 X:87581860-87581882 ATGGCTGAAATGACAGAACTAGG + Intronic
1194118860 X:89936808-89936830 TTTGATGAACTGACAGAAGTAGG - Intergenic
1194133015 X:90105716-90105738 ATGGATGAACTGACAGAAGTAGG - Intergenic
1194139990 X:90197110-90197132 TTTGATGAATTGACAGAAGTAGG + Intergenic
1194263872 X:91732782-91732804 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1194330586 X:92579733-92579755 ATGGCTGAATTGACAGAAGTAGG - Intronic
1194537046 X:95118665-95118687 ATGGCTGAAATGATAGAAGTAGG - Intergenic
1194580723 X:95666966-95666988 ATGGCTGAATTGACAGAATTAGG + Intergenic
1194596841 X:95868778-95868800 ATGGATGAATTGACAGAAGTAGG + Intergenic
1194608189 X:96006832-96006854 ATGGCTAAAATGACAGAAGTAGG + Intergenic
1194643255 X:96428564-96428586 TTTGATGAATTGACAGAAGTAGG - Intergenic
1194837340 X:98698099-98698121 TTTGATGAATTGACAGAAGTAGG - Intergenic
1195102436 X:101567986-101568008 TTTGATGAATTGACAGAAGTAGG + Intergenic
1195212986 X:102668832-102668854 ATGGATGAACTGACAGCAGTAGG - Intergenic
1195414355 X:104603453-104603475 TTTGATGAATTGACAGAAGTAGG + Intronic
1195457264 X:105082951-105082973 TTTGATGAATTGACAGAAGTAGG + Intronic
1195615740 X:106910459-106910481 TTGGGTGATCTGCCCGAGGTGGG + Intronic
1195774691 X:108390721-108390743 TTTGATGAACTGACAGAAGTAGG - Intronic
1195812792 X:108852343-108852365 ATGGATGAATTGACAGAAGTAGG + Intergenic
1195833612 X:109088246-109088268 TTTGATGAATTGACAGAAGTAGG - Intergenic
1195844120 X:109208328-109208350 TTTGATGAACTGACAGAGGTAGG - Intergenic
1195983243 X:110601895-110601917 ATGGATGAAGTGACAGAAGTAGG + Intergenic
1196229187 X:113202132-113202154 ATGGATGAATTGACAGAAGTAGG - Intergenic
1196281043 X:113824536-113824558 TTTGATGAATTGACAGAAGTAGG - Intergenic
1196435735 X:115672737-115672759 TTTGATGAATTGACAGAGGTAGG + Intergenic
1196467191 X:115984139-115984161 TTTGATGAATTGACAGAAGTAGG + Intergenic
1196513686 X:116545522-116545544 ATGGCTGAATTGACAGAAGTAGG - Intergenic
1196555743 X:117083128-117083150 ATGGATGAATTGACAGAAGTAGG - Intergenic
1196559028 X:117123822-117123844 ATGGATGAACTGACAGAAGTAGG + Intergenic
1196589298 X:117467200-117467222 TTTGATGAACTGACAGAAGTAGG - Intergenic
1196602819 X:117622072-117622094 TTTGATGAATTGACAGAAGTAGG - Intergenic
1197023080 X:121715421-121715443 ATGACTGAATTGACAGAAGTAGG - Intergenic
1197046345 X:122003321-122003343 ATGGATGAATTGACAGAAGTAGG - Intergenic
1197395465 X:125922327-125922349 TTTGATGAATTGACAGAAGTAGG - Intergenic
1197455339 X:126671450-126671472 ATGGCTGAATTCACAGATGTAGG + Intergenic
1197522828 X:127520682-127520704 ATGGCTGAATTGACAGAAGAAGG + Intergenic
1197606969 X:128596668-128596690 ATGGATGAATTGACAGAAGTAGG - Intergenic
1197847174 X:130814896-130814918 TTTGATGAATTGACAGAAGTAGG + Intronic
1198002143 X:132450656-132450678 TTTGATGAATTGACAGAAGTAGG - Intronic
1198062727 X:133062878-133062900 TTTGATGAATTGACAGAAGTAGG + Intronic
1198328456 X:135597913-135597935 TCTGCTGAACTCACAGCGGTAGG - Intergenic
1198338004 X:135687143-135687165 TCTGCTGAACTCACAGCGGTAGG + Intergenic
1198490072 X:137130586-137130608 TTTGACGAACTGACAGAAGTGGG + Intergenic
1198519135 X:137434518-137434540 TTTGATGAATTGACAGAAGTAGG + Intergenic
1198595581 X:138231864-138231886 TTTGATGAGCTGACAGAAGTAGG + Intergenic
1198725716 X:139675291-139675313 TTTGATGAGCTGACAGAAGTAGG - Intronic
1198819716 X:140634070-140634092 TTTGATGAATTGACAGAAGTAGG + Intergenic
1199012011 X:142769457-142769479 TTTGATGAATTGACAGAAGTAGG - Intergenic
1199074911 X:143515613-143515635 GGGGCTCAACTGTCAGAGGTTGG - Intronic
1199401750 X:147406423-147406445 ATGGATGAATTGACAGAAGTAGG + Intergenic
1199524778 X:148780740-148780762 TTTGACGAACTGACAGAAGTAGG - Intronic
1199589153 X:149450527-149450549 ATGGCTGAAATGACAGAAGTAGG - Intergenic
1200321617 X:155196059-155196081 ATGGATGGACTGACAGAAGTAGG - Intergenic
1200407742 Y:2830419-2830441 TTTGATGAATTGACAGAAGTAGG + Intergenic
1200471735 Y:3594362-3594384 TTTGATGAACTGACAGAAGTAGG - Intergenic
1200478803 Y:3675791-3675813 ATGGATGAACTGACAGAAGTAGG - Intergenic
1200485736 Y:3766079-3766101 TTTGATGAATTGACAGAAGTAGG + Intergenic
1200639292 Y:5698803-5698825 ATGGCTGAACTGACAGAAGTAGG - Intronic
1200732456 Y:6757652-6757674 TTTGTTGAATTGACAGAAGTAGG - Intergenic
1201070122 Y:10140493-10140515 ATGGCTGAATTGACAAAAGTAGG - Intergenic
1201312942 Y:12613180-12613202 TTTGATGAATTGACAGAAGTAGG + Intergenic
1201333377 Y:12852506-12852528 TTTGATGAGTTGACAGAGGTAGG - Intronic
1201371357 Y:13268517-13268539 TTTGATGAACTGACAGAAGTAGG - Intronic
1201394638 Y:13535828-13535850 TTTGATGAATTGACAGAAGTAGG - Intergenic
1201491009 Y:14540953-14540975 TTTGATGAATTGACAGAAGTGGG + Intronic
1201493213 Y:14565170-14565192 TTTGATGAACTGACAGAAGTAGG + Intronic
1201563464 Y:15342853-15342875 TTTGATGAACTGACAGAAGTAGG - Intergenic
1201609829 Y:15828618-15828640 TTGCCTGGAATGACAGAAGTTGG + Intergenic
1201756809 Y:17494906-17494928 ATGGCTGAATTGACAAAAGTAGG + Intergenic
1201783434 Y:17746889-17746911 TTTGATGAGTTGACAGAGGTAGG + Intergenic
1201818119 Y:18159098-18159120 TTTGATGAGTTGACAGAGGTAGG - Intergenic
1201844744 Y:18411078-18411100 ATGGCTGAATTGACAAAAGTAGG - Intergenic
1201979230 Y:19889949-19889971 TTTGATGAATTGACAGAAGTAGG - Intergenic
1202057203 Y:20847680-20847702 TTTGATGAATTGACAGAAGTAGG - Intergenic