ID: 1127103368

View in Genome Browser
Species Human (GRCh38)
Location 15:55588646-55588668
Sequence GCGCTCCCTCGCCGACCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127103361_1127103368 -8 Left 1127103361 15:55588631-55588653 CCCGCCCCGCGCCCGGCGCTCCC 0: 1
1: 2
2: 22
3: 171
4: 1266
Right 1127103368 15:55588646-55588668 GCGCTCCCTCGCCGACCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1127103357_1127103368 4 Left 1127103357 15:55588619-55588641 CCTAGGGGCCGCCCCGCCCCGCG 0: 1
1: 1
2: 4
3: 44
4: 418
Right 1127103368 15:55588646-55588668 GCGCTCCCTCGCCGACCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1127103362_1127103368 -9 Left 1127103362 15:55588632-55588654 CCGCCCCGCGCCCGGCGCTCCCT 0: 1
1: 0
2: 6
3: 85
4: 577
Right 1127103368 15:55588646-55588668 GCGCTCCCTCGCCGACCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1127103360_1127103368 -7 Left 1127103360 15:55588630-55588652 CCCCGCCCCGCGCCCGGCGCTCC 0: 1
1: 5
2: 44
3: 198
4: 1205
Right 1127103368 15:55588646-55588668 GCGCTCCCTCGCCGACCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1127103352_1127103368 23 Left 1127103352 15:55588600-55588622 CCCGGGTGGGCAGCGCGCGCCTA 0: 1
1: 0
2: 0
3: 12
4: 109
Right 1127103368 15:55588646-55588668 GCGCTCCCTCGCCGACCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1127103359_1127103368 -4 Left 1127103359 15:55588627-55588649 CCGCCCCGCCCCGCGCCCGGCGC 0: 1
1: 4
2: 46
3: 370
4: 2060
Right 1127103368 15:55588646-55588668 GCGCTCCCTCGCCGACCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1127103353_1127103368 22 Left 1127103353 15:55588601-55588623 CCGGGTGGGCAGCGCGCGCCTAG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1127103368 15:55588646-55588668 GCGCTCCCTCGCCGACCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127103368 Original CRISPR GCGCTCCCTCGCCGACCGCC AGG Intronic
901798149 1:11692147-11692169 GCGCGCCCTCGCCGCCCTCTGGG + Intronic
910232267 1:84998291-84998313 GCCCTCCCTCCGCGCCCGCCGGG - Intergenic
912619415 1:111140114-111140136 GCGCTCCCGAGCAGACCGGCCGG + Intronic
920314821 1:205069894-205069916 GCACTCACTGGCAGACCGCCCGG + Exonic
921428148 1:215029281-215029303 TCCCTCCCTCCCCGACCGCATGG + Intronic
923171672 1:231422322-231422344 GCCCTCGCGCGCCGCCCGCCCGG - Exonic
924560381 1:245153768-245153790 TCGCGCCCTCGCCCACCCCCGGG + Intergenic
1065092730 10:22251875-22251897 GCGCTCCTTCGCCTAGCGCCTGG - Intergenic
1067790328 10:49282986-49283008 GCGCTCCCTCCCCACCCTCCCGG - Intergenic
1070497448 10:77037588-77037610 GTGCTCCCTCCCCAACCCCCAGG - Intronic
1070570422 10:77636833-77636855 GCTCCCTCTCGCCCACCGCCAGG + Intronic
1074377497 10:112951644-112951666 GCCCGCCCGCGCCGCCCGCCGGG + Intronic
1074399820 10:113132896-113132918 GCACTCCCTCACTGACCTCCAGG + Intronic
1077287128 11:1772655-1772677 CCGCTCCCTCTCCTACCTCCTGG - Intergenic
1077419895 11:2445159-2445181 GCGCTGCCCCGCCGGGCGCCTGG - Exonic
1078315961 11:10293833-10293855 GCCCCCCCACGCCCACCGCCAGG + Intronic
1080606519 11:33869253-33869275 GAGCCCCCTCGCGGGCCGCCCGG + Intronic
1085485643 11:76860871-76860893 GCGCTCGCTCGCGCCCCGCCCGG - Exonic
1086728757 11:90222690-90222712 GCGTTCCCTTGGCGAGCGCCCGG - Intronic
1090224012 11:125057827-125057849 GTGCCCCCCCGCCCACCGCCTGG - Intergenic
1090375179 11:126283201-126283223 GCGCTCCGTCGCCCACCCCACGG - Intronic
1091142064 11:133243903-133243925 CAGCTCCCTCGCCCACCTCCAGG - Intronic
1091724378 12:2835250-2835272 GCGCTTCCTCGCAAACCACCTGG - Intronic
1096796248 12:54079652-54079674 CCGCTGCCTCGCCGGCGGCCTGG + Intergenic
1102505443 12:113381595-113381617 GGGTTCCCTCACCCACCGCCTGG - Intronic
1104721133 12:131045774-131045796 CAGCTCCCTCGCTGGCCGCCTGG - Intronic
1106036885 13:26051640-26051662 GCGCTCCCTCGGCGACGTGCTGG - Intergenic
1106157356 13:27171380-27171402 GCGCCCCCTCCCCAGCCGCCTGG + Intronic
1114270671 14:21098317-21098339 CCGCTCCGCCGCCGCCCGCCCGG - Exonic
1118220765 14:63853133-63853155 GCGCTCACCCACCGTCCGCCCGG - Exonic
1120788146 14:88555113-88555135 GCGCCCCCTCCCCGGCGGCCGGG - Intergenic
1122275003 14:100586867-100586889 CCGCACCCTCGCCACCCGCCCGG + Intronic
1122624068 14:103075351-103075373 GCACCCCCTCCCAGACCGCCTGG + Intergenic
1122969852 14:105148082-105148104 CCGCTGCCTCTGCGACCGCCGGG - Intronic
1125516427 15:40323715-40323737 GCGCTCCGCCGCCGCCTGCCCGG - Intergenic
1125954050 15:43777091-43777113 GCTCTCCCCGGCCAACCGCCCGG + Exonic
1127103368 15:55588646-55588668 GCGCTCCCTCGCCGACCGCCAGG + Intronic
1127673897 15:61222212-61222234 GGGCTCCCTAGCTGACCACCAGG + Intronic
1128547635 15:68578838-68578860 CCGCTCGATCGCCGGCCGCCGGG - Intergenic
1128802339 15:70504791-70504813 GCGCTCCCTTGATGACTGCCAGG - Intergenic
1129082231 15:73051908-73051930 GCGCGCCCACGCCGGCCTCCCGG + Exonic
1130335252 15:82952576-82952598 GCGCTCGCTCTCCGCCCGCTCGG + Exonic
1132778998 16:1612709-1612731 GCTCTCCCGCGCCGCCCGACAGG - Intronic
1132837134 16:1959773-1959795 GGGCTCCCTCGCCGGCCTCTGGG + Intronic
1133232235 16:4372193-4372215 GCGCACCCTGGCCGGCCGCGGGG - Intronic
1136553283 16:30993090-30993112 GGGCTCCCCCGCCTACCCCCAGG + Intronic
1137591829 16:49698515-49698537 GCGCTGCCACGCCGCCCGCCTGG + Intronic
1139593383 16:67945138-67945160 GCGCTCCCACGACGCCCGCCTGG - Exonic
1139785043 16:69385860-69385882 GCGCGCCCTCCCCGCCCTCCCGG + Exonic
1141829758 16:86503513-86503535 GCGCTCCCTTGCTGGACGCCCGG - Intergenic
1142795479 17:2303797-2303819 GCGCGCGCTCGCCCACCTCCCGG + Exonic
1147676185 17:42207654-42207676 TCGGTCCCTAGCCGACCGCTTGG - Exonic
1149610480 17:57955191-57955213 GCGCTCCCGCGGCTCCCGCCCGG - Intronic
1150389351 17:64781501-64781523 GCGCTCCCTCCTCGACCGCGCGG + Intergenic
1150790084 17:68196385-68196407 GCGCTCCCTCCTCGACCGCGCGG - Intergenic
1151783766 17:76265358-76265380 CCGCTCCGCCGCCGCCCGCCCGG - Exonic
1151921783 17:77162150-77162172 TCCCTCCCCCGCCGAGCGCCAGG - Intronic
1152928851 17:83099970-83099992 GCTCTGCTTCCCCGACCGCCGGG + Intergenic
1153779326 18:8480037-8480059 TCGCCCCCTCGCCCACCCCCAGG + Intergenic
1155054495 18:22171786-22171808 GCGCGCCCGCGCCGCCCGCGTGG - Exonic
1160862630 19:1244229-1244251 GCGCTCCCTCCCCCGCAGCCTGG - Intronic
1161210328 19:3062352-3062374 GCGCCCCCTCCCCGCGCGCCCGG + Intronic
1161314757 19:3612654-3612676 GCGCTTCCCCGCCGAGCGACAGG + Intronic
1161457086 19:4374903-4374925 GGGCTCCCTCACCGCCCGTCTGG + Intronic
1163118366 19:15201059-15201081 GCGCGCCCCCGCCCCCCGCCCGG + Intergenic
1167133154 19:47600660-47600682 GCCCGCCCGCGCCGAGCGCCCGG - Intergenic
1167638419 19:50667870-50667892 GCGCTCGCTCGCGGGCGGCCAGG + Exonic
1168692775 19:58386740-58386762 GCGGCCCCTCCCCCACCGCCCGG - Intronic
938296404 2:130182158-130182180 GCGCTCCCGCCCCTCCCGCCAGG + Exonic
940971930 2:159904645-159904667 GCGACCCCTCGCCGCCCGGCGGG - Exonic
941929873 2:170929089-170929111 GCCCTCCCTCTCCGCCCTCCCGG + Exonic
947119730 2:226801204-226801226 GCGCTCCCCCGCGGCCCGCCGGG - Intergenic
947669422 2:231926896-231926918 GCGCTCCCGCCCTGACCGGCAGG - Intergenic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
1169800584 20:9508148-9508170 GCGCGCCCTCGGAGCCCGCCTGG + Intergenic
1176178677 20:63739899-63739921 GCGCTCCATGGCCGGCCGGCCGG - Exonic
1176242101 20:64079929-64079951 GCGCCCCCTCCCCGACTGTCGGG - Intronic
1178610138 21:34073201-34073223 GCACTCACTCGCCCGCCGCCCGG + Intergenic
1178707982 21:34889993-34890015 GGGGTCCCTCGCCGACCTCACGG + Intronic
1179508511 21:41857404-41857426 GCTCGCCCTCACTGACCGCCAGG + Intronic
1185278501 22:49960167-49960189 GCGCTACCTCCCCGCGCGCCCGG + Intergenic
949895936 3:8767722-8767744 GCGCCGCCGCACCGACCGCCTGG - Exonic
953909200 3:46883284-46883306 GCGCCCGCCCGCCGCCCGCCCGG + Intronic
958798619 3:98732485-98732507 GCGCGCCCTCGCCGGGCGCCGGG - Intronic
963236667 3:142963341-142963363 GCGCGCCCTAGCCGAGCCCCGGG - Exonic
968701170 4:2058995-2059017 CCGCTCCCACGCCGCGCGCCTGG - Intergenic
969021535 4:4142977-4142999 GCGCTCCGTCCCCGGCGGCCTGG + Intergenic
969632558 4:8346966-8346988 GCGCCCCCGGGCCGGCCGCCGGG - Intergenic
969732331 4:8964440-8964462 GCGCTCCATCCCCGGCGGCCTGG - Intergenic
971358347 4:25914273-25914295 GCCCTGACCCGCCGACCGCCCGG - Exonic
975395565 4:73869807-73869829 GCGCTGCCTCTGCCACCGCCGGG + Intronic
978749560 4:112231821-112231843 GGACTCCCTCGCCGTCCGCATGG - Exonic
979838622 4:125406968-125406990 GCGTTCCCTGTCCAACCGCCTGG - Exonic
997870214 5:137499417-137499439 GCGCTGCCTGCCCGACAGCCCGG + Intronic
1005322267 6:24666941-24666963 GCGCTCCCGCATCAACCGCCCGG + Exonic
1006717099 6:36127621-36127643 GGGCTCCCTCCCAGACTGCCTGG + Intergenic
1006814546 6:36840979-36841001 CCACTTCCTCGCCCACCGCCTGG + Intergenic
1007924819 6:45642552-45642574 GCGCTTCCACGCTGGCCGCCTGG + Intronic
1010265004 6:73856191-73856213 GAGCTCCCTCTCCCACCTCCTGG - Intergenic
1011517298 6:88167150-88167172 GCGCCCCCTCCCCGGCCACCCGG + Intergenic
1019153921 6:170026278-170026300 GCACTCCCTCCCCAACCCCCTGG - Intergenic
1019605862 7:1909913-1909935 CCGCTCCCTGGCCCACCACCTGG + Intronic
1021521528 7:21543422-21543444 GCGCTTCCTCGGCGGCCGCCTGG + Exonic
1027592696 7:80135300-80135322 CCGGTCCCCCGCCGACCCCCGGG - Intronic
1034456367 7:151173153-151173175 GCGCTCCCTCCCCAGCCTCCTGG - Intronic
1035091695 7:156318559-156318581 GCGCTCCCTCACTGAGTGCCTGG + Intergenic
1044207075 8:89503089-89503111 GCTCTCTCTTGCCCACCGCCAGG + Intergenic
1045510871 8:102810893-102810915 GCCCCCGCTCGCCGAGCGCCCGG - Intergenic
1049406221 8:142452848-142452870 GCGGCCCCGCGCCGGCCGCCTGG - Intronic
1049434833 8:142581662-142581684 GCGCTCCCCTGCCTGCCGCCTGG - Intergenic
1054174574 9:61866289-61866311 CCGCTGCCTCGCCGGCAGCCTGG + Intergenic
1054662964 9:67714502-67714524 CCGCTGCCTCGCCGGCAGCCTGG - Intergenic
1059443658 9:114324985-114325007 GCCCTCCCTGGCCTCCCGCCGGG + Intronic
1059444858 9:114331762-114331784 GCCCTCCCTGGCCTCCCGCCGGG + Intronic
1061261428 9:129482784-129482806 GCGGTCCCCCGCCCTCCGCCCGG - Intergenic
1062537765 9:137028347-137028369 GCGCTCCGTCCGCGCCCGCCAGG + Intronic
1192237553 X:69305710-69305732 GCGCGGCCTCGCCGCCTGCCCGG + Intergenic