ID: 1127107594

View in Genome Browser
Species Human (GRCh38)
Location 15:55633518-55633540
Sequence ATTTTAATACAAATGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 438}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127107594 Original CRISPR ATTTTAATACAAATGGAACA AGG (reversed) Intronic
900880630 1:5378522-5378544 ATTTGAACCCAAATGGAAGAAGG + Intergenic
901564809 1:10105105-10105127 ATTATACTACAAATGCAACTGGG - Intronic
902560725 1:17275865-17275887 ATTTTCGTAAAAATTGAACATGG + Intronic
902968318 1:20028477-20028499 ACTTTAATATAAAAGGAAGAGGG + Intronic
903576703 1:24343804-24343826 ATATTTATACAAATGGACCTTGG + Intronic
907197797 1:52700693-52700715 AATTTAATAAACATGGAACATGG - Intergenic
908149550 1:61285741-61285763 ATTTTAACCCAAAGGGAACCAGG + Intronic
908348360 1:63259399-63259421 TTTTTATTACAAATAGAAGAAGG - Intergenic
909177169 1:72375704-72375726 AAATTAAAACAAATGGAATATGG - Intergenic
909224154 1:72994717-72994739 ATTTTAAGGCAAAAGGAAAATGG + Intergenic
909315565 1:74213584-74213606 ATTTTAGTGTAAAAGGAACAAGG - Intronic
909762276 1:79305338-79305360 ATTTTAATACAATTAGTAAATGG - Intergenic
910010900 1:82460818-82460840 ATTTTAGTAGAAATGTATCAAGG - Intergenic
910329568 1:86055437-86055459 TTTTCAATACAAATGGGAAAAGG + Intronic
910505632 1:87947279-87947301 ATTTAAACACATATGGAAAATGG + Intergenic
911286151 1:95995629-95995651 ATTTTAATAAAAATTAAAAAGGG + Intergenic
911685316 1:100769177-100769199 ATTTTAATACAAGTAGAAAATGG + Intergenic
911956274 1:104239254-104239276 ATTGTGTTACAAATGGAAAAGGG - Intergenic
912943234 1:114063354-114063376 ATTGGAATACAGCTGGAACAGGG + Intergenic
912987037 1:114444088-114444110 ATTTTATGATAACTGGAACAGGG + Intronic
913224208 1:116684585-116684607 ATTTTAATAGGAAAGTAACATGG + Intergenic
913492905 1:119398330-119398352 AACTTAACACAAATGGAACGAGG - Intergenic
915795080 1:158722134-158722156 ATTTTAATACAAACGGTGTATGG + Intergenic
916769782 1:167896993-167897015 ATTTTAATTCAAATAAAACCTGG + Intronic
916837904 1:168567593-168567615 ATTTTAATAAATATGAATCAGGG + Intergenic
917025330 1:170635730-170635752 AACTTAATAGACATGGAACATGG + Intergenic
918706430 1:187668525-187668547 ATTTTAATAAAAATGTAAATAGG + Intergenic
918706758 1:187672725-187672747 ATTTTAATACAAGTTTAATAAGG - Intergenic
918820306 1:189245771-189245793 ATTTTGATATAAATGAAGCAGGG - Intergenic
918875280 1:190033312-190033334 ATTTTAAGAAAAATGAAAGAAGG - Intergenic
919017189 1:192053821-192053843 ATTTAATTTCAAATGGAACTTGG + Intergenic
919367354 1:196679699-196679721 ATTTCAATATAAATGTAACATGG + Exonic
919447781 1:197730759-197730781 ATTTTAAAAGAAAATGAACATGG + Intronic
920773089 1:208908624-208908646 AGTTTAATACAAGTGGAATTGGG - Intergenic
921434083 1:215096732-215096754 ATTTTTAAAGATATGGAACATGG + Intronic
921699667 1:218254047-218254069 ATGTTAATACAATAGGAATATGG - Intergenic
921869166 1:220119816-220119838 ATTTTCATACACAAGGAACTAGG - Intronic
922710985 1:227832062-227832084 ACTTTAAAACAAATGTAACTAGG - Intronic
923690070 1:236183916-236183938 ATTTTCTTACAAATGTAAAATGG - Intronic
924146283 1:241078603-241078625 AATCTAATATATATGGAACAAGG - Intronic
924481301 1:244437136-244437158 AATTTTAAGCAAATGGAACATGG + Intronic
924884514 1:248199688-248199710 ATCTTAATACTAAAGGTACAGGG + Intergenic
1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG + Intronic
1063812400 10:9726677-9726699 TTTTTAATACAAATGGACATTGG - Intergenic
1064897119 10:20249846-20249868 ATTTTAATATAATTGAAACTGGG - Intronic
1065227855 10:23563879-23563901 ATATTTATACGAATGGAACATGG - Intergenic
1065905263 10:30245414-30245436 TTTTTAATACAATTATAACAGGG - Intergenic
1067400217 10:45966010-45966032 ATGTTAATACATATGACACAGGG + Intergenic
1067563372 10:47319761-47319783 CTTTTCATACAAATGGACCCTGG - Intergenic
1067868544 10:49935298-49935320 ATGTTAATACATATGACACAGGG + Intronic
1068314046 10:55319340-55319362 TTGTTAACATAAATGGAACAAGG + Intronic
1068840501 10:61608424-61608446 ATTCTGATGCCAATGGAACATGG - Intergenic
1069891356 10:71654505-71654527 TTTTTAATACAAATGGCTCATGG + Intronic
1071806485 10:89127150-89127172 ATATTAATACAAATGGGAGGTGG - Intergenic
1071858436 10:89648688-89648710 GTTTTAATACAAATTTAAAAAGG - Intergenic
1072887190 10:99288380-99288402 ACTTTAATACAAAAGCAACTAGG + Intergenic
1073996450 10:109321220-109321242 ATTCTATTATAAATGGAAGAAGG - Intergenic
1075392246 10:122100745-122100767 ATTTTTATACCAAAGGAAAAGGG - Intronic
1078161840 11:8846811-8846833 ATCAAAATACAAATGGATCATGG - Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079428618 11:20366668-20366690 ATTATAATGCAAATGGTTCATGG + Intronic
1079701061 11:23549281-23549303 ATTATATGATAAATGGAACATGG - Intergenic
1079771433 11:24464441-24464463 TTTTTAATATAAATGTTACACGG + Intergenic
1080357503 11:31467790-31467812 TTTTTTTTACAAAGGGAACAAGG + Intronic
1081022360 11:37961912-37961934 ATTGTTATATAAATGGAAAACGG + Intergenic
1081150050 11:39616981-39617003 ATCTTAATAAAAATTAAACATGG + Intergenic
1081510333 11:43765790-43765812 ATTTTAATACAGAGAGAAAAAGG - Intronic
1086741343 11:90373222-90373244 ATCTTAATACTTATTGAACAAGG + Intergenic
1086761729 11:90639614-90639636 CTTTTGATGCAAATGGAAAAGGG - Intergenic
1086892654 11:92276183-92276205 ATATTAATACAAATAAAAAAGGG - Intergenic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1087283969 11:96244145-96244167 ATTTCAAAACATCTGGAACACGG - Intronic
1087392271 11:97552172-97552194 ACTTTAAAACAAATAGAAAATGG - Intergenic
1087393916 11:97572532-97572554 ATTTTAATAGAAATTGAATTAGG - Intergenic
1088082586 11:105936737-105936759 ACTTTAAAACAAATGCAATAAGG + Intronic
1088090304 11:106030722-106030744 ATTTTAATACAATTTGGAAATGG + Intergenic
1088102697 11:106172529-106172551 TTTTTAAAGCAAAGGGAACAAGG - Intergenic
1088962633 11:114684749-114684771 ATTTTAATTCATATGGAAAAAGG + Intronic
1089660020 11:119979660-119979682 GGTTTAATACGAATGGAACTGGG + Intergenic
1090252043 11:125258388-125258410 ATTTTAATAAAAATGAAATCTGG - Intronic
1090443140 11:126740812-126740834 ATTTTAATGTAAATCTAACAAGG - Intronic
1090766931 11:129884535-129884557 ATTTTAAAACAAAAGAAAAAAGG + Intronic
1091337398 11:134782697-134782719 ATTTTAATACTGATGGAAAATGG - Intergenic
1091993404 12:4974190-4974212 ATGTTTATAGAAATGGAAGAAGG - Intergenic
1092652469 12:10649362-10649384 ATTTTTATACAGTTGGACCATGG + Intronic
1092835301 12:12482274-12482296 ATTTTAATAAAAAAAGAAGAAGG + Intronic
1092872195 12:12815449-12815471 AATTTATTACAAGTTGAACAGGG + Intronic
1093172916 12:15879178-15879200 ATATTAAAATAAATGGAAAATGG - Intronic
1093417639 12:18938356-18938378 ATTCAAATACAAATCTAACACGG - Intergenic
1093703303 12:22247025-22247047 ATATAAATACAAATGGAGGAAGG - Intronic
1094291347 12:28853660-28853682 TTTTACATACAAATGGAATAAGG - Intergenic
1095881987 12:47147631-47147653 ATATCAATAGAAATAGAACATGG - Intronic
1096019304 12:48308862-48308884 ATTTTAAGGCAAATGGATCATGG + Intergenic
1096456667 12:51793047-51793069 GATTTAAAACAAATGGATCATGG - Intronic
1097626050 12:62001913-62001935 GTTTTAATACAAATAAAACTTGG + Intronic
1097918635 12:65047147-65047169 ATTTTAATACTTTTTGAACAAGG + Intergenic
1098790934 12:74820807-74820829 ATTTTAATAGTAGTGCAACAGGG - Intergenic
1099070341 12:78038256-78038278 AATTTAATACTTATGGAAGAAGG - Intronic
1099130266 12:78820155-78820177 ATTTTAGTACAAATTGAAAAAGG - Intergenic
1100657000 12:96657790-96657812 AATGTAATAAAAATGTAACATGG - Intronic
1100751312 12:97701318-97701340 ATTTTAACAGCAATGGAACATGG + Intergenic
1100846821 12:98667683-98667705 TTTGTAATACATATGGAAAAAGG - Intronic
1101232925 12:102759938-102759960 AGTGTAATATTAATGGAACAGGG - Intergenic
1101254092 12:102960551-102960573 ATTTTCATAAAACTGGACCAGGG - Intergenic
1101300205 12:103471934-103471956 ATTTTAAGTCAAATGGGAAAAGG - Intronic
1102791442 12:115649726-115649748 GTCTTAATGCAAATGGAAGATGG - Intergenic
1104555441 12:129795984-129796006 AAAGTAATAGAAATGGAACATGG - Intronic
1105668192 13:22584080-22584102 ATTTGAAAACAATGGGAACAAGG - Intergenic
1105731193 13:23218745-23218767 GTATTAATACAAATAGACCAAGG + Intronic
1106074259 13:26443858-26443880 ATTTTAATCAAAAGGCAACAGGG - Intergenic
1106964290 13:35040710-35040732 ATTTTCACATAAATGGAAAAGGG - Intronic
1107195021 13:37641176-37641198 ATTTTAATACAAATATAAAAAGG + Intronic
1108345434 13:49541788-49541810 ATTCCAATACGACTGGAACATGG + Exonic
1108943947 13:55997769-55997791 ATTTTAAAACAAATTAATCATGG - Intergenic
1109634368 13:65094539-65094561 ATTTTAATACAAATTTAAATTGG - Intergenic
1110191733 13:72737819-72737841 ATTTTAATACAAATGACCAAAGG - Intronic
1110345710 13:74445569-74445591 TTTGTGATTCAAATGGAACAAGG - Intergenic
1111090218 13:83436707-83436729 ATTTTGGTTGAAATGGAACAAGG + Intergenic
1111315686 13:86555937-86555959 GCTTAAATACAATTGGAACAGGG - Intergenic
1111361067 13:87177399-87177421 ATTTTAATTAAAATAGAACATGG - Intergenic
1111717971 13:91904618-91904640 ATTATAATACAAATATTACATGG + Intronic
1112254680 13:97818999-97819021 TTGTTAATACTAATGGCACATGG - Intergenic
1112396733 13:99040498-99040520 ATTTTAAAAAAAATTGTACATGG + Intronic
1112539425 13:100293380-100293402 ATTTTTAAACAAATGGCAAAGGG - Intronic
1112939072 13:104838758-104838780 ATTGTAATATAAATGAAATATGG + Intergenic
1114860042 14:26505935-26505957 ATTTTAATACAAATGAAATAAGG - Intronic
1115052264 14:29077612-29077634 ATTTTTATACAAATGGGTGATGG - Intergenic
1115112895 14:29845668-29845690 ATTGTACTACAAATGCTACATGG - Intronic
1115327556 14:32158645-32158667 GTTTCAATACATATGGGACATGG + Exonic
1115793446 14:36905875-36905897 AGTTATATACAAATGGAAAAAGG + Intronic
1116266991 14:42705022-42705044 ATTTTAATTCAAAATGATCATGG + Intergenic
1116328312 14:43562387-43562409 ATTTAAATAAAAAAGGAATAAGG + Intergenic
1117489963 14:56236860-56236882 ATCTTGGTACAAATAGAACAGGG - Intronic
1118953005 14:70451998-70452020 AATTTAATACAATTGGAATTGGG - Intergenic
1120043237 14:79777333-79777355 ATCATAATACAAAAGGAACCTGG + Intronic
1120349638 14:83338464-83338486 ATTTTAACGAAAATAGAACAAGG + Intergenic
1121071266 14:91024124-91024146 ATTTAAATACAAATTTAATAAGG - Intronic
1122333460 14:100946320-100946342 ATTTTATTATAAATGTAAAAAGG + Intergenic
1124093075 15:26624320-26624342 ATTTCAATACGAGTGTAACATGG - Intronic
1124224155 15:27875548-27875570 ATTGTAATAAAAATTGAACTAGG - Intronic
1124937247 15:34184871-34184893 GTTTTAATAAAAATGAAACATGG - Intronic
1126149014 15:45505516-45505538 ATTTTTATTCAAAAGGAGCAAGG + Intronic
1126426963 15:48538090-48538112 ATTGCTATACAAATGTAACATGG + Intronic
1126639347 15:50809310-50809332 ATTTTAGAACCAATGAAACAGGG + Intergenic
1126872527 15:53004864-53004886 ATTTTAATGAAAACAGAACATGG + Intergenic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127554309 15:60072413-60072435 ATTTTAATAAAAAGGGAAAATGG - Intergenic
1127777262 15:62274592-62274614 ATTTTAAAATAAAAGGAAGATGG - Intergenic
1127853602 15:62936462-62936484 CAGTTAATACAAATGGAATATGG - Intergenic
1128197134 15:65768540-65768562 ACTTTTACATAAATGGAACATGG + Intronic
1128394743 15:67212800-67212822 ATTTTAATAAACATTGAACCAGG - Intronic
1129851284 15:78795343-78795365 CTTTTATTCCATATGGAACAGGG + Intronic
1130306016 15:82712540-82712562 ATTTTAGTACAAAGGGCACAGGG - Intergenic
1132191925 15:99871631-99871653 ATTTAGTTACAAATGGAACTAGG + Intergenic
1132371408 15:101301961-101301983 AGTTTAAAACAAATGCATCATGG + Intronic
1135636895 16:24085332-24085354 ATTTTCATACAAATGAATCTTGG - Intronic
1135980786 16:27145242-27145264 ATTTTAATACAAAATAAAAACGG - Intergenic
1137264904 16:46860689-46860711 ATTTTTGTACAAATGGAGAATGG + Intergenic
1138749700 16:59403820-59403842 AATTTACTATAAATGAAACATGG + Intergenic
1139010113 16:62621688-62621710 ATTTTAGTACCTATGAAACAGGG + Intergenic
1139817502 16:69687139-69687161 ACTTAAATAAAATTGGAACAAGG + Intronic
1141298133 16:82789108-82789130 ATTCCAAGACAAATGGAAAAAGG - Intronic
1143565854 17:7720101-7720123 ATTTTAAGACAGAAAGAACAAGG - Intronic
1144019500 17:11227700-11227722 ATGCAAATACAAAGGGAACAGGG - Intergenic
1145198837 17:20921461-20921483 ATTTTACTACAAGTGGTAAAGGG - Intergenic
1147595432 17:41714136-41714158 ATAGTAATACCAAAGGAACATGG - Intronic
1147623572 17:41884565-41884587 ATTTTAAAACAACTGCACCAGGG - Intronic
1147922958 17:43929731-43929753 ACTTTAATATAAAAGGAAGAGGG + Intergenic
1150019063 17:61592351-61592373 AGTTAAATACAAATGAAAGAGGG + Intergenic
1150071227 17:62152062-62152084 ATTTTAAGAAAAAGGGAAAAAGG - Intergenic
1150326912 17:64264578-64264600 ATTCTAATGCAAGTGGTACAAGG + Intergenic
1150795144 17:68230678-68230700 ATTTTATTAAGAAGGGAACAGGG + Intergenic
1151701751 17:75746628-75746650 ATCTTTATACAAGTGTAACAGGG - Intronic
1153990383 18:10393692-10393714 ATTATATTACAAATGGAGGAGGG + Intergenic
1155593015 18:27449685-27449707 ATTTTAAAACAAATAGAGGAAGG + Intergenic
1155635748 18:27953233-27953255 ATTTTAAGAAAAAAGAAACAAGG + Intronic
1155896756 18:31339195-31339217 ATTTTATATCAAATGGACCATGG - Intronic
1156097631 18:33554093-33554115 TTTTTAATAAAAAAGGAAAATGG + Intergenic
1156356485 18:36346457-36346479 ATGTTAATGCAAATGGTAAATGG + Intronic
1156358867 18:36366334-36366356 ACATTAAGACAAATGGAACGAGG + Intronic
1156380839 18:36559754-36559776 ATTTTTATACAACTTGCACAGGG - Intronic
1158376191 18:56871290-56871312 ACTTTATTACAAATAAAACAAGG + Intronic
1158755429 18:60318823-60318845 ATATAAAGACTAATGGAACAGGG - Intergenic
1159495885 18:69204109-69204131 ATGTTAATATAAATGAAATAAGG + Intergenic
1160376480 18:78417151-78417173 ATTTTAATGTAAAGGGAGCATGG + Intergenic
1162681027 19:12341538-12341560 ATAGTAATCCAAATAGAACAGGG + Intergenic
1165184480 19:34005420-34005442 ATCTTAAAACAAAAGGAACAAGG + Intergenic
1166037568 19:40180182-40180204 AGTTTAATATAAAGGGTACAAGG - Intergenic
925368577 2:3327481-3327503 ATTTTTTTAAAAATGGAAAAGGG - Intronic
925532564 2:4881045-4881067 AATTGTAAACAAATGGAACATGG - Intergenic
925582110 2:5421395-5421417 ATTTTACTACAAAGGGATTATGG + Intergenic
926078813 2:9966706-9966728 ATTATAATACAAGCAGAACATGG - Intronic
928817251 2:35312988-35313010 TCTTTAAAACAAATAGAACAAGG + Intergenic
929080089 2:38113861-38113883 ATTTAAATACAATTGGAAGAGGG - Intergenic
929210999 2:39357033-39357055 ATTATAACACAGTTGGAACAAGG - Intronic
930535803 2:52644719-52644741 ATTTCAAAACAAAAGGAAGAAGG - Intergenic
930821156 2:55648892-55648914 ATTTTTAAACAAATGAAAGATGG - Intronic
931303618 2:61006143-61006165 ATTTTACTCCAAAGGGAAGAAGG + Intronic
931635647 2:64338649-64338671 TTTTTAATATAAATGGGACAGGG - Intergenic
932119438 2:69084729-69084751 CTTTAAATAAAAATGGAATATGG - Intronic
933464393 2:82634079-82634101 GATTCAATACAAAGGGAACAGGG + Intergenic
935065549 2:99644130-99644152 ATTTCAATATAAATGGATCTTGG + Intronic
935133179 2:100276707-100276729 ATTTTAATAATAATGGAAATTGG - Exonic
935891194 2:107680454-107680476 ATTTAAAGACAAATGGTAGAGGG - Intergenic
936224666 2:110637281-110637303 ATTGTAATGCTAAGGGAACAAGG + Intergenic
937550863 2:123088711-123088733 TTTTAAATAAAAATGGAAAATGG - Intergenic
938918946 2:135974841-135974863 TTTTTAATAAAATAGGAACAGGG + Intronic
938973044 2:136449520-136449542 ATTTGCAGAGAAATGGAACAGGG - Intergenic
939569929 2:143829162-143829184 ATTTCCATACAGATGGAAAAGGG + Intergenic
939632242 2:144538785-144538807 ATTTTAATAAAGATGGAGCCAGG + Intergenic
939739216 2:145885505-145885527 ATGTTAATATAAATTGAATATGG - Intergenic
939771883 2:146331269-146331291 ATTTTAATACAATGGAAAAAGGG + Intergenic
940058219 2:149535913-149535935 ATTTGAATAAAAATGTACCAGGG + Intergenic
940747682 2:157587500-157587522 ATCTTAATGAAAATGGAAAAAGG + Intronic
940849858 2:158678030-158678052 GTTTTAATACAAAAGGAACTTGG - Intronic
940991976 2:160106536-160106558 TTTTTAAAACAACTGGAAAAAGG - Intronic
942203741 2:173598663-173598685 ATTTAAATACAAATCTTACATGG + Intergenic
942349352 2:175036883-175036905 ATTTAAAGACAAATAAAACAGGG - Intergenic
942426379 2:175864752-175864774 ATTTTAAGACAAGTGAAACAAGG - Intergenic
943225090 2:185163035-185163057 ATGTTGATACAAATGTAAAATGG - Intergenic
943415684 2:187600243-187600265 ATTTTATTACAAAAGGGAAAAGG - Intergenic
943502852 2:188713287-188713309 ATTTGAAAAAAAATGGAAAAAGG - Intergenic
943749733 2:191498863-191498885 AGATGAATACAACTGGAACAAGG + Intergenic
943767625 2:191678891-191678913 ATTTTAATACATCTGGAAGGTGG - Intronic
944055605 2:195519182-195519204 ATTTTAAAAGAATTGGAACAAGG + Intergenic
944345623 2:198661697-198661719 ATTTATATATAAATGGAAAAAGG - Intergenic
944613435 2:201434841-201434863 ATTTGAAAACAAATGGATGATGG - Intronic
944821071 2:203431885-203431907 ATTTTAAGAAAAATGGTGCATGG - Exonic
945751995 2:213798726-213798748 AATTAAATAAAAATGGATCACGG - Intronic
945816142 2:214607356-214607378 ATTTAAGTACAAATGTAACTAGG + Intergenic
946668444 2:222075953-222075975 ATTTAAATACAGTTGGAAAAGGG - Intergenic
946906528 2:224422318-224422340 ATTTTAATACAGGTGGAAGTTGG - Intergenic
946980102 2:225203013-225203035 ATTTGAAAACAAATGGACAATGG - Intergenic
947479274 2:230482925-230482947 ATTTCAATAAAAATTCAACAGGG - Intronic
948017760 2:234703718-234703740 AACTTAATTCAAAAGGAACACGG + Intergenic
948371206 2:237490090-237490112 ATCTAAACAGAAATGGAACAAGG + Intronic
948985805 2:241522417-241522439 ATTTTTATACAAATGGTAGCCGG + Intergenic
1169558507 20:6773683-6773705 ATTTTAAAAAAAATACAACAAGG - Intronic
1169645963 20:7810287-7810309 ATTTTAAAATAAGTGCAACATGG + Intergenic
1169735232 20:8830726-8830748 ATTTTACTACAATTAGTACATGG - Intronic
1169776290 20:9257541-9257563 ATTTTAATCCAAATGTTTCATGG + Intronic
1170168829 20:13388519-13388541 GTTTAAATATAAATGGAAAAAGG + Intergenic
1171100917 20:22383283-22383305 ATTTTTCTACAACCGGAACAGGG - Intergenic
1175760080 20:61556543-61556565 AATTGAGAACAAATGGAACAAGG + Intronic
1176207659 20:63898456-63898478 ATTTGTAGAGAAATGGAACATGG + Intronic
1176312757 21:5162227-5162249 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312783 21:5162383-5162405 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312794 21:5162461-5162483 ATTTCAATACAGATAGAACCAGG + Intergenic
1176924854 21:14735957-14735979 AATTTAAGAAAAATGGAAAATGG - Intergenic
1176991217 21:15498517-15498539 ATTTGAATACAAATAGAAATTGG - Intergenic
1177545721 21:22556029-22556051 ATTTTCCTTAAAATGGAACATGG + Intergenic
1177902831 21:26937897-26937919 ATGTTAAAACAAAAGGAAGAAGG - Intronic
1179431944 21:41327513-41327535 ATCTTAAGACAAATGGAAATGGG - Intronic
1179844254 21:44099569-44099591 ATTTCAATACAGATAGAACCAGG - Intronic
1179844265 21:44099647-44099669 ATTTCAATACAGATAGAACCAGG - Intronic
1179844291 21:44099803-44099825 ATTTCAATACAGATAGAACCAGG - Intronic
1182023037 22:27097191-27097213 ATTTTTGTAAAATTGGAACATGG - Intergenic
1183887075 22:40892932-40892954 ATATTATAACAGATGGAACATGG + Intronic
1185112349 22:48907369-48907391 AACTTTATAGAAATGGAACAGGG + Intergenic
949199522 3:1358152-1358174 ATTTTAATAAAAATAGGAGATGG - Intronic
949265275 3:2149928-2149950 GTTTTAATGCAAATTCAACAGGG + Intronic
949606143 3:5656422-5656444 ATTTAAAAATACATGGAACAAGG + Intergenic
949713061 3:6894201-6894223 ATTTTAATCTCAATGTAACAAGG - Intronic
949762434 3:7486231-7486253 ACTTAAATACAAATAAAACAAGG - Intronic
951637534 3:24796099-24796121 ATGATAAGACAAATGGAAAAAGG + Intergenic
951874913 3:27412861-27412883 ATATTAAGAGAAATGAAACAAGG + Intronic
952031955 3:29153802-29153824 ATTTTAATAAAACAGGGACAAGG - Intergenic
952049924 3:29372395-29372417 ATTATAAAACAAATAGAACCCGG - Intronic
952356188 3:32586652-32586674 TTTTTAGTAAAAATGGAAAATGG + Intergenic
952544892 3:34408299-34408321 AATATTATGCAAATGGAACAAGG - Intergenic
953108161 3:39906198-39906220 ACTTTCCTACAAATGGGACATGG - Intronic
953121521 3:40047421-40047443 CTTAAAATAAAAATGGAACAAGG - Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954279506 3:49566217-49566239 ATTTGAAAACAAAAGGAGCAAGG - Intronic
954853561 3:53623987-53624009 ATTTTAATAAAAGATGAACAAGG + Intronic
955613473 3:60781479-60781501 ATTTTAAAAAAAATAGAAAAGGG + Intronic
955644001 3:61117148-61117170 AGATTAATACAAATAGAAAATGG + Intronic
956300382 3:67765241-67765263 ATTTTATAATAAAAGGAACAAGG + Intergenic
956757429 3:72402748-72402770 GTTTTAAGACAAATTAAACAGGG - Intronic
957455885 3:80443980-80444002 TTTTAAATAAAAATGGAATATGG + Intergenic
960219711 3:115091555-115091577 ATTTTAAGATAAAAGGAAGAAGG + Intronic
960370740 3:116835131-116835153 ATTTTAATAAAAAATGAAAATGG - Intronic
961910295 3:130308107-130308129 ATTTTTGTAAAAATGGAAAAAGG - Intergenic
963424140 3:145102337-145102359 AGTTAAATAAAAATGTAACAAGG + Intergenic
963513352 3:146276741-146276763 ATTTTAATATAATTAAAACAAGG - Intergenic
964117711 3:153154165-153154187 ATTTTAAAACACATGTAAAATGG - Intergenic
964331135 3:155604588-155604610 GGTTTAATACAAATAGAAAAAGG - Intronic
964795122 3:160488592-160488614 ATTATTATACAACTGCAACATGG - Intergenic
965341100 3:167492310-167492332 ATTTGAATACTATTTGAACAGGG + Intronic
966101380 3:176272981-176273003 ATTTTTATATAAATAGAACATGG + Intergenic
967413329 3:189189464-189189486 ATTTTAAAAAAATTGGAATAAGG + Intronic
967665024 3:192160908-192160930 ACTTTGACACAAATGGAGCAAGG + Intronic
967874076 3:194254665-194254687 ATCTTAAAATAAATTGAACAAGG - Intergenic
968344294 3:197987747-197987769 CTTTTAAAAAAAATGTAACATGG - Intronic
969634926 4:8362960-8362982 TTTTTAGTAAAAATGGAAAATGG + Intergenic
970008596 4:11433876-11433898 CTTCTATTACAAATGGAACTAGG - Intergenic
970778936 4:19712160-19712182 ATTTTGATACAAAGGGAGGAAGG - Intergenic
970951696 4:21764482-21764504 ATTTATATAAAAATGAAACAAGG + Intronic
971234370 4:24828051-24828073 ATTATACTACAAATGGAATGAGG - Intronic
971464841 4:26946142-26946164 ATCTTTATACAACTGAAACATGG - Intronic
971940126 4:33203174-33203196 GATTTAATACAAATGGAGGAAGG - Intergenic
972071469 4:35023059-35023081 ATTTTAATACAATTCTAACTTGG + Intergenic
972340626 4:38149480-38149502 ATTTTATTACAAAGGGAAGAAGG + Intergenic
972540285 4:40033455-40033477 ATTTTAATACAAAATAGACATGG + Intergenic
972601582 4:40577578-40577600 TTTTTAAAAAAATTGGAACAGGG - Intronic
972760586 4:42099511-42099533 AGTTTATTATAAATGGAATAAGG + Intergenic
973159455 4:46997091-46997113 GTTTTAATACAAATGAGAAAAGG - Intronic
974384514 4:61187567-61187589 ATTTTAATACATATGTTACCTGG - Intergenic
974391446 4:61275148-61275170 CTGTTCATACAACTGGAACAAGG + Intronic
975953279 4:79801779-79801801 ATTTTTATAAATATTGAACATGG + Intergenic
976840605 4:89428505-89428527 ATTATTATTCAAATGGAACAAGG - Intergenic
976948049 4:90794658-90794680 TTTAAAATTCAAATGGAACAAGG - Intronic
977133367 4:93270274-93270296 TTTTAAATACAAATGTAAAAGGG + Intronic
977489112 4:97689948-97689970 ATTATAATACAAAAGAAAAATGG - Intronic
978329900 4:107601077-107601099 AATTTAATACAAATGGGCCAAGG + Intronic
978449042 4:108809010-108809032 ATTAAAATAAAAATTGAACAGGG + Intergenic
978779238 4:112532640-112532662 ATTTTAAAACAAATCAAACTGGG - Intergenic
978834382 4:113131018-113131040 ATTTAAATAGAAATGGTACAAGG - Intronic
980759202 4:137206584-137206606 ATATTAATATAAATAGCACATGG - Intergenic
981181764 4:141754421-141754443 ATTTTATTAGAAAAGTAACAAGG + Intergenic
981621165 4:146700270-146700292 ATTTTGATAAAAATGGAATCAGG + Intergenic
981816893 4:148840932-148840954 ATTTTAAAACATATGGATAAAGG - Intergenic
982626321 4:157771032-157771054 ATTTTTAAAAAAATGAAACATGG + Intergenic
982689626 4:158532978-158533000 GTTTTAATACCAAAGGGACAGGG + Intronic
983245851 4:165285854-165285876 ATTAGGATACAAAGGGAACACGG + Intronic
983723211 4:170884444-170884466 AATATAATACAAATGGAATATGG + Intergenic
983725968 4:170926306-170926328 ATTTATATACATATAGAACAAGG + Intergenic
984286419 4:177735544-177735566 ATTTTATTAAAAATTGAAAATGG + Intronic
985012194 4:185594441-185594463 ATGTTAATTCAAATGTAGCATGG - Intronic
985095768 4:186411589-186411611 AGTTTACAACAAATGGAATAGGG + Intergenic
985234258 4:187855859-187855881 ATTAGAATACAAGTGCAACAGGG - Intergenic
986436454 5:7736908-7736930 TTTTTTTTATAAATGGAACAAGG - Intronic
986488777 5:8268220-8268242 AGTTTCATAAGAATGGAACATGG + Intergenic
986567857 5:9133148-9133170 TTTTTAACTGAAATGGAACAAGG - Intronic
986593620 5:9397023-9397045 AGTTCTATACAAATGGAACAAGG + Intronic
987749553 5:22021685-22021707 ATTTTCATTCAATTGGAATAGGG + Intronic
987781174 5:22436956-22436978 ATTTTATTAAAAATAAAACATGG + Intronic
988103666 5:26714647-26714669 ATTTTAATAGAATAGTAACAAGG - Intergenic
988414623 5:30930507-30930529 ATTTTCATTCAAATGGAAAATGG - Intergenic
989305468 5:39950390-39950412 ATATGCATATAAATGGAACAAGG + Intergenic
989577014 5:42997951-42997973 ATTGTACTACAAAGGGATCAAGG + Intergenic
989819339 5:45776310-45776332 ATTTTAATAAAACTACAACATGG + Intergenic
990264288 5:54058999-54059021 ATGTTGTGACAAATGGAACAAGG - Intronic
990996284 5:61735281-61735303 ATTTCAATATAAATAAAACATGG + Intronic
992385448 5:76280120-76280142 ATTTGAAGAGAAATGGAAAAAGG + Intronic
992858994 5:80892798-80892820 CTTTTAATACAAAGGGCGCATGG + Intergenic
993593488 5:89824988-89825010 TTTTTAATATAACTGGAACTGGG - Intergenic
994042207 5:95271896-95271918 ATTATAAAACAATTGGAAGACGG - Intronic
994864253 5:105245442-105245464 ATATTAGAACAAATGGAAGATGG + Intergenic
995963675 5:117877078-117877100 TTTTTAAAACAAATTTAACAAGG + Intergenic
996585110 5:125078977-125078999 GTTTTAATACAAAGAGAATAAGG - Intergenic
997091289 5:130861854-130861876 ATTTCAATATAAAAGGAAAAAGG - Intergenic
998330264 5:141319846-141319868 ATTTTGAGGCCAATGGAACACGG + Exonic
998535629 5:142928279-142928301 ATTTTAAGACAGATAAAACATGG + Intronic
999900526 5:156081692-156081714 ATATTTATAAAAAGGGAACATGG - Intronic
1002574367 5:180163710-180163732 ATTTTTGTTCATATGGAACATGG + Intronic
1002682446 5:180977780-180977802 CTTTTAATAAACATGGAAAACGG - Intergenic
1002691718 5:181054558-181054580 TTTTTAATGCAAATGGCACTAGG + Intronic
1003579513 6:7326978-7327000 TTTTTATTACATATGGAAAAGGG + Intronic
1004040969 6:11975243-11975265 ATTATTATAAAAATGAAACAAGG + Intergenic
1004137991 6:12987092-12987114 ATTTTAAAAGAAATGTAATATGG + Intronic
1004285852 6:14320024-14320046 ATCTTTTTACAAATGGAGCAAGG - Intergenic
1004747501 6:18525560-18525582 ATTGTAACACAAAAGCAACATGG - Intergenic
1004783141 6:18935119-18935141 ATTGCAATACAAATGGACTAAGG + Intergenic
1005183962 6:23142010-23142032 AATTTAATACAAATAAATCATGG - Intergenic
1005842805 6:29755267-29755289 CTTTGAGTATAAATGGAACAGGG - Intergenic
1007542067 6:42655888-42655910 ATTTTTATAAAAATGTATCAGGG - Intronic
1007795980 6:44347981-44348003 ATAATAATAGAAATGAAACAAGG - Intronic
1008362658 6:50639833-50639855 ATTTTAATTTATATGTAACAAGG - Intergenic
1009315114 6:62209430-62209452 ATCTATATACATATGGAACATGG - Intronic
1009442240 6:63694994-63695016 ACTTAAATACTAATGGAAGAAGG + Intronic
1009552791 6:65120549-65120571 ATTTTAATACAAACTCCACATGG - Intronic
1009590672 6:65665468-65665490 ATTTTCTTAAAAATGGCACAAGG + Intronic
1010338247 6:74715179-74715201 AATTTAAAACAAATGGAAGAGGG - Intergenic
1010364142 6:75030384-75030406 TTTTTAACACTAATGTAACAGGG + Intergenic
1010452150 6:76015167-76015189 AATTTAATACAAATGTCAAAAGG - Intronic
1010576883 6:77542631-77542653 AATTAAATAAAAATGGATCATGG + Intergenic
1010729765 6:79378699-79378721 ATTTTAATACATATGTAAAGAGG - Intergenic
1011372736 6:86655735-86655757 AAATTAATACAAATAGATCATGG + Intergenic
1011403824 6:86994823-86994845 ATTTTATTATAAATGGAAAGAGG + Intronic
1011511191 6:88103154-88103176 ATTTTAATACAAAAGTGAAAGGG - Intergenic
1011831365 6:91375564-91375586 ATTTTAATACTAAATAAACATGG - Intergenic
1011892109 6:92177137-92177159 ATTTTAATAGAATGGGAACTAGG - Intergenic
1012470196 6:99564089-99564111 CTGTTAATACAAATGGAAATTGG - Intronic
1013446528 6:110234287-110234309 ATATTAAAACAAATAAAACATGG - Intronic
1013450627 6:110276857-110276879 ATTATAATACAAATAGAATTAGG + Intronic
1013731025 6:113167695-113167717 ATTTTTAAACTAAAGGAACAAGG - Intergenic
1014076014 6:117234977-117234999 ATTTTTATACAAAGAGAAAAAGG - Intergenic
1014076258 6:117238768-117238790 ATATTTAGACAAATGGTACATGG + Intergenic
1014408468 6:121082892-121082914 ATTTTAATACACATTTAAAAAGG + Intronic
1016379142 6:143455574-143455596 ATTCTAATGTAAGTGGAACAGGG + Intronic
1016453929 6:144211991-144212013 ATTTGAAAACAAATGCAAGAAGG + Intergenic
1018286849 6:162249787-162249809 ATTTTCATCCAGATGAAACATGG - Intronic
1019130155 6:169867479-169867501 ATTTGAATACAATTGGCCCAGGG - Intergenic
1020402024 7:7790136-7790158 ATTCTAATGCAAGTGGTACATGG - Intronic
1021304686 7:19017902-19017924 ATGGTAATAAAAAGGGAACAGGG + Intergenic
1021790402 7:24199022-24199044 ATTTTAATACTAAAGAAAAAAGG + Intergenic
1022355804 7:29613345-29613367 ATTTGGATACAAAGGGAAGAAGG + Intergenic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1022821714 7:33968732-33968754 AATTCAATTCAAATGGAACTAGG - Intronic
1023653775 7:42398887-42398909 ACTTTCATACAAATAGCACATGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024761895 7:52608501-52608523 ATTTTACTACTTATGAAACAAGG + Intergenic
1025010852 7:55396727-55396749 ATTTTAAAGCAAATGGTAAAAGG - Intronic
1027008968 7:74725299-74725321 GTTTTAAGTCATATGGAACATGG - Intronic
1027635106 7:80662060-80662082 ATTTTAAGAAAAATAGAAAACGG + Intronic
1029990182 7:104955929-104955951 ATGTTAAAAGAAATGTAACAGGG - Intergenic
1030219886 7:107087381-107087403 ACTTTAATATAAATAGAACCTGG + Intronic
1030962082 7:115937055-115937077 ATTTTAAGACAATTGGAAGTTGG + Exonic
1031263980 7:119560055-119560077 ATTTTAATATAGCTGGAACATGG + Intergenic
1031552920 7:123137062-123137084 ATTTTATTACAAATGCAATAAGG + Intronic
1032105498 7:129025583-129025605 TTTTTTATAAAAATGGGACAGGG + Intronic
1033517452 7:142122051-142122073 TTTTTAAAAGAAATGGAAAATGG + Intronic
1034172022 7:149069985-149070007 ATTTTTATACAAATGCACAAAGG + Exonic
1034843946 7:154426017-154426039 ATTTTACTACAAAAAGAACTTGG + Intronic
1036114047 8:5939061-5939083 ATTTTAAAACAAAAGAAAAAAGG + Intergenic
1036190729 8:6668331-6668353 TTTTTAATAACAATGGAACATGG + Intergenic
1036560925 8:9899697-9899719 ATTTTAAGACAAAAGGGAGAAGG + Intergenic
1038147388 8:24911783-24911805 ATTTTAATACAGATGGGCCAAGG + Intergenic
1038923026 8:32106748-32106770 TTTTTAAAAAAAATGGAACTGGG + Intronic
1039316436 8:36377794-36377816 ATATTAATACAAATTGCTCAAGG + Intergenic
1040663003 8:49597332-49597354 ATTTTAATAAAAAAGGAAACGGG + Intergenic
1041193675 8:55378829-55378851 ATTTTAATACAAATATTAAATGG + Intronic
1042454398 8:68983801-68983823 ATATATATACAAATGGAAGAAGG + Intergenic
1042848172 8:73189019-73189041 ATTTTAATATAAATGAATAAGGG + Intergenic
1043065489 8:75565558-75565580 ATTTTAAAACAAATGAAGCATGG + Exonic
1043659599 8:82721335-82721357 ATGTTAATATAAATGAAACATGG + Intergenic
1044751157 8:95416895-95416917 ATTTTGCTACAATTGGAACAGGG - Intergenic
1045477739 8:102567741-102567763 ATTTTAATTGAAATGGATCAAGG + Intergenic
1045734306 8:105277135-105277157 CTTTAAATACAAGAGGAACATGG - Intronic
1045829985 8:106447290-106447312 CTTTTAATATAAAGGGAAAATGG + Intronic
1045839043 8:106558554-106558576 ATTGTAATATGAATGGGACAGGG - Intronic
1046786320 8:118270981-118271003 AGTTTAAACCAAATGGAGCATGG + Intronic
1047085038 8:121506675-121506697 ATTTTAAAACAATTGGAACAGGG + Intergenic
1047133461 8:122049602-122049624 ATTCTAATACAAAAGAAAAATGG + Intergenic
1047477905 8:125252542-125252564 ATCTTAATACTGATGAAACAGGG - Intronic
1047508725 8:125499937-125499959 ATTTTAATAGAAATACAACATGG - Intergenic
1047554696 8:125916459-125916481 ATTATAAGACAAATGGAATTAGG + Intergenic
1047688607 8:127327772-127327794 AATTTTGTACAAAAGGAACAAGG - Intergenic
1048154093 8:131925973-131925995 GTTTTAAAATAAATGCAACAAGG + Intronic
1048791174 8:138105345-138105367 ATTTGAAAACATATGGTACATGG + Intergenic
1049154319 8:141057494-141057516 AGTTTAGGGCAAATGGAACATGG - Intergenic
1050794328 9:9518484-9518506 ACTTTAATACAAATCTAAGAAGG + Intronic
1050875150 9:10624399-10624421 ATGTTAAAACAAAGGAAACAGGG + Intergenic
1051612490 9:18974929-18974951 AATCAAATACAAAGGGAACATGG + Intronic
1051963264 9:22794179-22794201 ATTTTACTACACATGGCAAAAGG - Intergenic
1052384181 9:27805637-27805659 ACTTTAATATAAAAGGAAGAGGG + Intergenic
1053261091 9:36665243-36665265 ATTTTAATAAAAATAGTACAAGG + Intronic
1053504130 9:38626782-38626804 TTTTTAATATAAATGGAAGATGG + Intergenic
1055262720 9:74457377-74457399 ATCTAAACACAAATTGAACAGGG + Intergenic
1055463400 9:76540410-76540432 ATTTTAAATGGAATGGAACAGGG - Intergenic
1055548043 9:77402097-77402119 TTTGTAATACAAATGAAAAAGGG - Intronic
1056120339 9:83481542-83481564 ATTTTAAAAAATATGGAAGAGGG + Intronic
1056241449 9:84651528-84651550 AATTTATCCCAAATGGAACATGG - Intergenic
1056480522 9:86999234-86999256 ATTTAAAAACAAAAGAAACAGGG - Intergenic
1056614524 9:88152385-88152407 ATATTAATATAAATGTAAAACGG - Intergenic
1057152246 9:92806812-92806834 TTTTTAATATAAATGGAAGATGG - Intergenic
1058208566 9:102138388-102138410 ATTTTCATTCAAATCTAACAGGG - Intergenic
1058255189 9:102753008-102753030 ATCTTAATACAAAAGAAACTGGG + Intergenic
1058257079 9:102780135-102780157 AGATTAATAGAAATGGAACTTGG - Intergenic
1058469314 9:105260942-105260964 TATTGAATACATATGGAACAGGG + Intronic
1058634857 9:107028553-107028575 ATTTTAATTCACATGCATCATGG - Intergenic
1060064484 9:120491861-120491883 ATGTTAATACAAATGTCATAAGG + Intronic
1060379794 9:123157179-123157201 AGACTAATACAAATGGAAGATGG + Intronic
1060851623 9:126881461-126881483 AATTTAATACAATGTGAACAGGG + Exonic
1186118883 X:6336462-6336484 ATTTTAGTACAAACTGAACCTGG + Intergenic
1186963373 X:14761358-14761380 TTTTTAAGACAAATTGGACAAGG + Intergenic
1187668855 X:21648163-21648185 ATTTTAATTAAAATGAAACATGG - Intronic
1187949797 X:24460638-24460660 ATTCTAAAACAAATGGACAAAGG - Intergenic
1188096405 X:26028492-26028514 ATTTTAATAAAAATTGAAGCTGG + Intergenic
1188423761 X:30022701-30022723 TTTTTATTACAAGTGGAAGAAGG + Intergenic
1188720644 X:33519367-33519389 AATTTAATACAATTGCAAAATGG + Intergenic
1188975729 X:36673028-36673050 AGGTTAATACACTTGGAACAAGG - Intergenic
1189459572 X:41228290-41228312 TTTTTAACACAAAAGAAACAAGG + Intronic
1191653600 X:63570607-63570629 CTTTTAGTAAAAATGGAACATGG + Intergenic
1191820680 X:65303487-65303509 ATTTTATTAAAAATGGATGATGG - Intergenic
1192749078 X:73969516-73969538 ATATTAATTAAAATGGATCATGG - Intergenic
1192873099 X:75203912-75203934 ATTTTAATATAAAAGGAAGAGGG + Intergenic
1192958324 X:76097087-76097109 CTTTTTCTACAAATGGAACTGGG + Intergenic
1193313183 X:80032329-80032351 ATTTTAATACATATAGAGGAAGG - Intergenic
1193534556 X:82697038-82697060 ATTTTTAAAAATATGGAACACGG - Intergenic
1195023633 X:100853840-100853862 ATTTTAAAACAAATGTTTCAAGG + Intronic
1196174714 X:112628014-112628036 ATTTTAATTCGAATTGAACATGG + Intergenic
1196506433 X:116449768-116449790 ATTCAAAAACAAATGGAACTTGG + Intronic
1196521252 X:116675003-116675025 ATTAAAAAACAAATGGAACTTGG - Intergenic
1196676789 X:118428582-118428604 TTATTAAAACAAATGGAAGAGGG + Intronic
1198109573 X:133491155-133491177 ATTTTAATCCAAAAGGAAGCAGG - Intergenic
1200367816 X:155686072-155686094 AGTTAAATAAAAATGGAATATGG - Intergenic
1201324800 Y:12744658-12744680 ATGGTAATGCAAATGGAACCAGG - Intronic