ID: 1127110018

View in Genome Browser
Species Human (GRCh38)
Location 15:55658905-55658927
Sequence TTGTGTAAATACATCTAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127110018_1127110023 15 Left 1127110018 15:55658905-55658927 CCCAGTTAGATGTATTTACACAA 0: 1
1: 0
2: 0
3: 9
4: 228
Right 1127110023 15:55658943-55658965 ATGAATCAATTGTGATAATCAGG 0: 1
1: 0
2: 2
3: 11
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127110018 Original CRISPR TTGTGTAAATACATCTAACT GGG (reversed) Intronic
904072869 1:27815605-27815627 TGCTGTGAATACAGCTAACTGGG - Intronic
904436314 1:30499664-30499686 TTGTGAAAATACATTTAATCTGG - Intergenic
905987657 1:42301528-42301550 TTCTTTAAATTCATCTGACTGGG + Intronic
906877167 1:49551999-49552021 TTGTGTAACTCCATCGACCTGGG - Intronic
908041946 1:60123489-60123511 CTTTGTAAATATATCTAACCTGG - Intergenic
908394769 1:63715559-63715581 TTGTGTGAATACATTCAGCTAGG + Intergenic
910434191 1:87188384-87188406 TTGTTTAAAAACATCCAAATTGG + Intergenic
910888511 1:91992120-91992142 TTATGTAACAACATCTAACTAGG + Intronic
913041492 1:115029674-115029696 TTGTCTAAATACATTTTATTTGG + Intergenic
913381117 1:118211063-118211085 TGGTGTAAATACTTCTACCATGG - Intergenic
916001074 1:160616329-160616351 TCTTGTGAATATATCTAACTGGG - Intronic
917309087 1:173658959-173658981 ATGTGTATATACATCTATATGGG - Intronic
918855248 1:189746191-189746213 TTGTATAGATACATCAAATTTGG + Intergenic
919459597 1:197860791-197860813 TTGTGAAAATACATTTAATCTGG - Intergenic
920683159 1:208088471-208088493 TTATGTATCTACATCTCACTAGG + Intronic
921637504 1:217513604-217513626 TTCTGTAAATACATCTTTGTTGG - Intronic
921909484 1:220531062-220531084 TTGTGTAAATAGGGCTAAATTGG + Intronic
1064553567 10:16525860-16525882 ATGTGTTAATACATCCTACTAGG - Intergenic
1066268786 10:33801672-33801694 TTGTGTAAAGACATTAAGCTTGG - Intergenic
1066793993 10:39098428-39098450 TTGTGTAAATTCATCTCACAGGG + Intergenic
1071086040 10:81869846-81869868 TTGTGTATATAGATATAGCTAGG - Intergenic
1072390159 10:94975686-94975708 ATTTGTAAATAATTCTAACTTGG + Intronic
1079768361 11:24424579-24424601 TTAAGTAAATACCTCTAAATAGG - Intergenic
1080177436 11:29382460-29382482 TTGTGTTATTTCATATAACTGGG - Intergenic
1082899544 11:58231049-58231071 TTATGAAAATAAATCTAAATGGG + Intergenic
1082942061 11:58716571-58716593 TAGTGTAAATACATTTTAATAGG - Intronic
1082962193 11:58928917-58928939 TAGGGTAAACAGATCTAACTGGG + Intronic
1082993559 11:59230446-59230468 CTGTGTTAATAGATCTACCTCGG - Intergenic
1086125649 11:83345977-83345999 TGGTGTAAATACTCCTACCTTGG - Intergenic
1086185349 11:84007537-84007559 TTGTGTAAATTAAACTAAGTTGG - Intronic
1089802050 11:121040311-121040333 TTGTATTAACACATTTAACTTGG + Intronic
1090537534 11:127660443-127660465 TTGGATATATACATCTTACTTGG - Intergenic
1090892388 11:130935835-130935857 TTGTGTTAATATATCTAAAGTGG + Intergenic
1091084413 11:132706588-132706610 TTGGGTAAACTCATCTAAGTGGG - Intronic
1091199087 11:133757966-133757988 TTGTTTGAATAAATATAACTAGG - Intergenic
1093499003 12:19789273-19789295 TTGTTCAAATTCATTTAACTAGG + Intergenic
1095225192 12:39670752-39670774 TTTTTTAAATTCATCTGACTGGG + Intronic
1097779120 12:63683645-63683667 ATGTGTCCATACATCTAATTTGG - Intergenic
1097802439 12:63929079-63929101 TTGTGTACACACATGTAACCAGG - Intronic
1099611700 12:84880529-84880551 TTTTGGAAATACAACTAACAAGG - Intronic
1099630517 12:85136974-85136996 TTCTCTAAATACATCTTGCTTGG - Intronic
1101181837 12:102227154-102227176 GTGTGCAAATACATCTATATGGG + Intergenic
1103733919 12:123046404-123046426 TGGGGACAATACATCTAACTCGG - Intronic
1104105560 12:125655645-125655667 TTGTATAAATACAGCTATGTTGG - Exonic
1105227424 13:18449078-18449100 CTGTGTAAATAACACTAACTGGG - Intergenic
1106803675 13:33283887-33283909 TATTGTAAATACATCTAAGGAGG + Intronic
1107351379 13:39518376-39518398 TTTTTGAAACACATCTAACTGGG - Intronic
1108604657 13:52025440-52025462 TTATCAAAATACATCTACCTGGG - Intronic
1108610190 13:52077725-52077747 TTGGGTAAATACATTGGACTGGG - Intronic
1108941885 13:55965066-55965088 TTTTATAAATAAATCTCACTTGG - Intergenic
1111480852 13:88824349-88824371 TTGTGAAAATACATCACACCTGG + Intergenic
1112037462 13:95509987-95510009 TGGTGTAAATACTCCCAACTTGG + Intronic
1112244309 13:97716401-97716423 TTGTGTAAATTCCTCTAAATGGG + Intergenic
1112388308 13:98960414-98960436 TAGTGTATAAAAATCTAACTTGG + Intronic
1112616221 13:101008456-101008478 TTATGAAAATTCATCAAACTGGG - Intergenic
1112935765 13:104796262-104796284 TTTTATAAACACATCTAATTTGG - Intergenic
1114011875 14:18377531-18377553 CTGTGTAAATAACACTAACTGGG - Intergenic
1115497764 14:34023926-34023948 TTGTCTAAAGTCATGTAACTGGG + Intronic
1116371519 14:44139863-44139885 TTTTGTCAAGACATCTAAATAGG + Intergenic
1117320499 14:54618292-54618314 TGGTGTAAATACTCCTAACATGG - Intronic
1120032291 14:79655912-79655934 TTGTGAAAATACATGTTACTGGG + Intronic
1120440520 14:84531757-84531779 TTCTGAAAATACATTAAACTAGG + Intergenic
1121200638 14:92114479-92114501 TTGGGTAAATAAATCAGACTGGG + Intergenic
1123145568 14:106126904-106126926 TTATGGAAATACACCTAAATGGG + Intergenic
1126509991 15:49459875-49459897 TTGTGTAAATACCTCCACCATGG - Intronic
1127110018 15:55658905-55658927 TTGTGTAAATACATCTAACTGGG - Intronic
1127565148 15:60180532-60180554 ATGTGTAAATACATCCCACAAGG + Intergenic
1127660699 15:61097703-61097725 TTTTTAAAATACATCTATCTGGG + Intronic
1127921918 15:63501322-63501344 TTGTGTATATACATGGAAGTGGG - Intergenic
1128514065 15:68331341-68331363 AAGTGTAAATACATGTTACTTGG + Intronic
1130339255 15:82985560-82985582 TTTTGTTAATACAACCAACTTGG - Intronic
1130762063 15:86831467-86831489 TTGGGTAAATACACCCAAATGGG + Intronic
1130828482 15:87574370-87574392 TTGTGTAAATATATTTTACTGGG - Intergenic
1131708708 15:95027878-95027900 TTTGGTAAAAATATCTAACTTGG + Intergenic
1131748675 15:95480752-95480774 TTGTGTAAATACATGTTAAATGG + Intergenic
1131786258 15:95914627-95914649 TTCTATAAATACAACCAACTGGG + Intergenic
1133592415 16:7258376-7258398 ATGTCTAAATACACTTAACTTGG + Intronic
1133619815 16:7515665-7515687 TTGTGTAACTACAACAAACAGGG + Intronic
1135292124 16:21248949-21248971 TGGTGTAAATACATCCACCATGG - Intronic
1135332845 16:21575377-21575399 TTGTATAAATACTTCTACCATGG + Intergenic
1137821103 16:51446766-51446788 TTATGTAAACACATCTATATTGG + Intergenic
1141273143 16:82558797-82558819 TTGGGTAAATACACCCAAATGGG - Intergenic
1142942342 17:3391966-3391988 ATCTGTGAATACAGCTAACTAGG - Intergenic
1144540741 17:16139850-16139872 TTGGGTAAATACTTGTAATTTGG - Intronic
1153572194 18:6484492-6484514 TTGGCTAATTACGTCTAACTAGG + Intergenic
1153700183 18:7684851-7684873 TTGGGTAAATACACCTAAGTGGG + Intronic
1153726494 18:7961888-7961910 TTATGTAAAAAGCTCTAACTAGG - Intronic
1154525952 18:15290398-15290420 CTGTGTAAATAACACTAACTGGG + Intergenic
1155175232 18:23296015-23296037 TTGTGTAAATTCATTTATTTTGG + Exonic
1156170924 18:34484618-34484640 TTGTGTAAATATATCACAATTGG - Intergenic
1156540086 18:37901112-37901134 TTGTGTAGAAACATTTAACTAGG - Intergenic
1159363748 18:67438657-67438679 CTGTGTGAGGACATCTAACTTGG - Intergenic
1160945125 19:1638318-1638340 TTGTGTATTTGCATCTTACTAGG - Intronic
1163656954 19:18552184-18552206 TTTTGTTCATACATTTAACTTGG + Intergenic
1164336800 19:24331569-24331591 ATGTGTAAATTCTTCTAACAGGG + Intergenic
1168572006 19:57478326-57478348 TTGTGTATAGACATCTAGTTTGG - Intergenic
926055578 2:9772059-9772081 ATGTGGAAATTCATCCAACTCGG + Intergenic
926519995 2:13898207-13898229 TTGGGTAAATACAGCCAAGTGGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
928970289 2:37021274-37021296 TTGTGAAATTACAGCTACCTGGG - Intronic
929278016 2:40046172-40046194 GTGTGTTAAAACATCTAAATGGG - Intergenic
930300561 2:49610590-49610612 TTGTATAAATACATCAAGGTGGG - Intergenic
930988813 2:57625920-57625942 TTGTGTATATACATGTAATATGG + Intergenic
931119225 2:59197970-59197992 TTGGGTCATTACATCAAACTTGG + Intergenic
931766428 2:65460798-65460820 GTGAATAAATACATCTTACTAGG + Intergenic
933043647 2:77504212-77504234 TTTTGTAAATAGATTTTACTGGG + Intronic
933933089 2:87175098-87175120 TTGAGTAAATCCTTCAAACTCGG + Intergenic
934011941 2:87830033-87830055 TTGGGTAAATACACCCAAATGGG + Intergenic
935509846 2:103957956-103957978 TTGTCTATATGCAGCTAACTAGG - Intergenic
936257299 2:110927785-110927807 TTGTGTAACTACATCACACCTGG + Intronic
936360023 2:111790349-111790371 TTGAGTAAATCCTTCAAACTCGG - Intronic
937294704 2:120802954-120802976 TTGTGTAAACACAGCTTGCTGGG - Intronic
938111131 2:128565810-128565832 ATCTGTAAATTCATTTAACTGGG - Intergenic
942261739 2:174172085-174172107 GTGTACAAATACATCTCACTTGG - Intronic
945415902 2:209572405-209572427 TTGTTTAAATATTTCTTACTGGG + Intronic
945753089 2:213812752-213812774 TTGTTTTATTACATGTAACTAGG + Intronic
946009190 2:216551379-216551401 TGTTGTAAATACATATACCTTGG + Intronic
947399968 2:229721525-229721547 TTCTGGAAATAAATCTTACTTGG - Intergenic
1169626746 20:7579672-7579694 CTGTATAAACACATCTAAATGGG - Intergenic
1172160513 20:32864878-32864900 TTGTGTAATTACAGTTTACTGGG + Intronic
1176771469 21:13078090-13078112 CTGTGTAAATAACACTAACTGGG - Intergenic
1177281920 21:18992116-18992138 TTATCTAAATAGATCCAACTGGG + Intergenic
1178330303 21:31684961-31684983 TTTTTTAAAAAAATCTAACTTGG + Intronic
1180436368 22:15308339-15308361 CTGTGTAAATAACACTAACTGGG - Intergenic
1180518609 22:16172536-16172558 CTGTGTAAATAATGCTAACTGGG - Intergenic
1183126622 22:35788121-35788143 TTTTTAAAATACTTCTAACTAGG + Intronic
1184965703 22:47970500-47970522 TTGTGTAAATAAAGCAAAGTAGG - Intergenic
949706164 3:6819783-6819805 TTGTTTAAACACATCTAAAATGG - Intronic
949821359 3:8119482-8119504 TTGTGTAAACAAATCTGACATGG - Intergenic
950755660 3:15169910-15169932 TTGTTTAAAAACATCAAATTTGG + Intergenic
950921369 3:16698059-16698081 TTGTGAAATTACAGCTATCTGGG + Intergenic
955091205 3:55752383-55752405 TCGTGTAAATACTTCTACCATGG - Intronic
955569499 3:60289325-60289347 TTCTGTAAATCCATTTATCTAGG - Intronic
956345420 3:68272631-68272653 TTGTGGAAATTCATCTGCCTGGG + Intronic
957661908 3:83167307-83167329 TTGTGTATAAAATTCTAACTTGG + Intergenic
958493918 3:94817827-94817849 TTGAGTAAATACCTCACACTGGG - Intergenic
959764944 3:110014385-110014407 TTATATAAGTACATGTAACTTGG + Intergenic
962529785 3:136268443-136268465 TTGTGTAAAATCCTCCAACTTGG + Intronic
963497140 3:146079721-146079743 TGGTGTAAATACTTCTACCATGG - Intronic
965215820 3:165863456-165863478 TTTTTTAAATCCATCTAACATGG + Intergenic
965895080 3:173565692-173565714 ATGTGGTAATACATATAACTAGG - Intronic
970951847 4:21765636-21765658 TTGTGTTAATACATATAAATGGG + Intronic
971233918 4:24824494-24824516 TTGTGTTATCTCATCTAACTTGG + Intronic
973104509 4:46317567-46317589 TATTGTAAATTCACCTAACTAGG - Intronic
973703206 4:53556401-53556423 TTGTTTTAAGACATCCAACTTGG + Intronic
974710239 4:65582767-65582789 TTGAGTAAATATATGTAAATTGG - Intronic
974869839 4:67627647-67627669 TTCTGCAAATCCATCTACCTGGG + Intronic
974939581 4:68449814-68449836 TGGTGTAATTACATCTGAATGGG + Intronic
977595802 4:98878334-98878356 TTATGAAAATACATCTATTTGGG + Intronic
977687558 4:99865732-99865754 TCGAGTATATACATCTGACTTGG + Intronic
977746560 4:100556269-100556291 TTGTTTAAATTTCTCTAACTTGG + Intronic
977761478 4:100742677-100742699 TTTTGTAAACAACTCTAACTAGG - Intronic
978937084 4:114390665-114390687 ATCTATAAATACATTTAACTGGG - Intergenic
979079480 4:116316377-116316399 TTATGTAAATACAAAAAACTAGG + Intergenic
980454164 4:133017685-133017707 TTGTGTAAAGACCTGTAATTTGG + Intergenic
980893591 4:138839897-138839919 TTTTGTAAACACATTTAATTTGG + Intergenic
981467879 4:145095055-145095077 ATATGTAATTAAATCTAACTAGG + Intronic
982452208 4:155566575-155566597 TTGTGTAAATACTCCTATTTTGG - Intergenic
983980854 4:173995372-173995394 GTGTGTAAATACATATGAATAGG + Intergenic
984914672 4:184711352-184711374 TTGTGTAAAAAAATCAAATTAGG + Intronic
986912301 5:12573670-12573692 TTATATAAATACCTCTATCTGGG + Intergenic
988017186 5:25574195-25574217 TTGTGAAGATAAATCTATCTAGG + Intergenic
988075454 5:26347680-26347702 TTTTATAAAAACATCTAAGTAGG - Intergenic
989069423 5:37495138-37495160 TTGTGTGAATACATTTTGCTGGG - Intronic
990482975 5:56229551-56229573 TTGTGCAAGTTCATGTAACTAGG + Intronic
990554262 5:56914409-56914431 TTGTTTGAATACATTTAACATGG + Intronic
990660890 5:58014057-58014079 ATCTGTAAATACATTGAACTGGG + Intergenic
993004407 5:82415213-82415235 TTGTGCAAATATATCTATCATGG + Intergenic
994494527 5:100494241-100494263 TTGTGTAAATAAATAGTACTTGG + Intergenic
995231999 5:109776467-109776489 ATCTGTAATTACATCTTACTAGG + Intronic
995315208 5:110762375-110762397 TTATGTATACACATGTAACTTGG + Exonic
999204483 5:149838238-149838260 ATGTGCATACACATCTAACTGGG + Intronic
999541164 5:152573642-152573664 TTGGGTAAATACACTTAAATTGG - Intergenic
1000155169 5:158543546-158543568 TTGTATACATTCATCTAATTCGG - Intergenic
1001126354 5:169023166-169023188 GTGTGTACATGCATATAACTAGG + Intronic
1001664419 5:173420848-173420870 TGGTGGAAAAACTTCTAACTTGG + Intergenic
1001976913 5:176007616-176007638 TTGTTTAAATAGATGTAATTGGG - Intronic
1002240515 5:177836164-177836186 TTGTTTAAATAGATGTAATTGGG + Intergenic
1002948150 6:1782220-1782242 CTTTTTAAATACATGTAACTGGG - Intronic
1008075789 6:47144351-47144373 TTTTGTAAATAAAGCTAATTTGG - Intergenic
1008308240 6:49932641-49932663 TGGTGTAAATACTCCTAACACGG + Intergenic
1009463027 6:63936642-63936664 TTCTGTTTATCCATCTAACTGGG + Intronic
1011139944 6:84141692-84141714 TTGTGTAAATACTGCCAACCAGG + Intronic
1012060970 6:94480138-94480160 TTGTCTAAATAAATCTAAAATGG - Intergenic
1012822958 6:104111649-104111671 TTATGTAAATATACCTAAATTGG - Intergenic
1014558212 6:122858915-122858937 TTGTGTAAATACATTGACTTAGG + Intergenic
1015145536 6:129981508-129981530 TTGTGTAAATGAAACTATCTGGG - Intergenic
1016810339 6:148254984-148255006 TTGTATAAATACATCTCATTTGG - Intergenic
1017608389 6:156157682-156157704 TTCTGTAAATAAATCACACTCGG - Intergenic
1018239417 6:161758212-161758234 TTGTGTAAATACCTAGAAGTGGG - Intronic
1018254313 6:161903275-161903297 TGGTGTAAATACACCCATCTGGG - Intronic
1019362625 7:613040-613062 TGGTGTAGATACATGTAACAAGG + Intronic
1020766407 7:12327517-12327539 TTGTGTAAATACATTCTACGAGG - Intergenic
1020925668 7:14320954-14320976 TTCCTTAAATAAATCTAACTTGG - Intronic
1022938046 7:35201290-35201312 ATGTGTCCATACATCTAATTTGG - Intergenic
1023408104 7:39857943-39857965 GTCTGTAAATACATCTACTTGGG - Intergenic
1026491173 7:70865186-70865208 TTGTGTAGACACATCTAAGGAGG + Intergenic
1027447990 7:78296884-78296906 TTGTGTAAACGTACCTAACTGGG - Intronic
1027703192 7:81494804-81494826 TTCTCTAGATATATCTAACTTGG + Intergenic
1028525459 7:91780553-91780575 ATGTTTAAATACATTTAAGTTGG + Intronic
1029360784 7:100087328-100087350 TTGTGGAATTACAGCTATCTGGG + Intergenic
1030422010 7:109318898-109318920 TGGTGAAAATAATTCTAACTAGG - Intergenic
1032507725 7:132448384-132448406 TGGTGTAAATACTTCTACCCTGG - Intronic
1035318165 7:158010447-158010469 TTGAGTAAATCCATCCATCTTGG - Intronic
1036505144 8:9348058-9348080 ATTGGCAAATACATCTAACTTGG + Intergenic
1039580840 8:38665810-38665832 TTGTTAAAATACATCTTCCTGGG + Intergenic
1040133227 8:43822276-43822298 ATGTGTAAATTCATCTCACAGGG + Intergenic
1040862417 8:52013272-52013294 ATCTGCAAATACATTTAACTAGG - Intergenic
1041332037 8:56737068-56737090 TTGGTTAAATACATCAACCTGGG - Intergenic
1043248717 8:78040520-78040542 TTGACTCAATACATCCAACTAGG - Intergenic
1043288071 8:78559765-78559787 TGGTATAAATAGATCAAACTGGG - Intronic
1043288208 8:78561804-78561826 ATGTGTAAATTCATGTAACATGG + Intronic
1044044415 8:87413189-87413211 TTGTGAAATTACAGCTATCTGGG + Intronic
1048450557 8:134529764-134529786 TAGTGTAAATACTTCTACCATGG - Intronic
1050216077 9:3325505-3325527 TTATGTATATACATTTAAATGGG - Intronic
1051028429 9:12644162-12644184 TTTTGAAAATACAACTAACAAGG + Intergenic
1052109708 9:24566276-24566298 ATGTGTAAATACTTCTATCATGG + Intergenic
1053703769 9:40729215-40729237 CTGTGTAAATAACACTAACTGGG + Intergenic
1054413851 9:64852824-64852846 CTGTGTAAATAACACTAACTGGG + Intergenic
1188895666 X:35665515-35665537 TTGTGAAATTACAGCTATCTGGG - Intergenic
1189416001 X:40813856-40813878 TTGAGAAAATACAGCTAACAAGG + Intergenic
1191137063 X:57076229-57076251 TTGGGTAAATACATATGAGTGGG + Intergenic
1191245049 X:58221483-58221505 ATGTGTTGATACATCTAACAGGG + Intergenic
1193594255 X:83426514-83426536 ATCTATAAATACACCTAACTAGG + Intergenic
1194173939 X:90624258-90624280 TTGCCTAAATCCATCTAAATTGG + Intergenic
1194458017 X:94128576-94128598 TTGTGTAAATATGTCTATCATGG + Intergenic
1194622709 X:96192991-96193013 TTGTGTATAAACATATATCTGGG + Intergenic
1196070462 X:111515642-111515664 TTTTGAAAATATATATAACTGGG - Intergenic
1196981880 X:121223399-121223421 TTGAGCAAATACAACTAAGTGGG - Intergenic
1197179142 X:123515477-123515499 TTGTGTAAATACTTCCACCATGG - Intergenic
1197232017 X:124015284-124015306 TGGTGAAAATACTTCAAACTAGG - Intronic
1199132543 X:144208516-144208538 TTGGGTAAATACACCCAAATGGG - Intergenic
1199278420 X:145972292-145972314 TTGTGTAAATACTTAAAGCTTGG - Intergenic
1199465695 X:148134087-148134109 TTGTTTAAATACAGCTAGTTTGG - Intergenic
1199509195 X:148601205-148601227 TTGTGAAACTACTTCTTACTTGG + Intronic
1199925115 X:152454321-152454343 TGGTGTAAATACTTCTACCACGG + Intergenic
1200520157 Y:4201959-4201981 TTGCCTAAATCCATCTAAATTGG + Intergenic
1201294054 Y:12448599-12448621 TTCTGTAAAAACATTTAATTTGG + Intergenic