ID: 1127110201

View in Genome Browser
Species Human (GRCh38)
Location 15:55661072-55661094
Sequence TGGGCATGATCAAAAGATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127110201_1127110206 -2 Left 1127110201 15:55661072-55661094 CCCCTATCTTTTGATCATGCCCA 0: 1
1: 0
2: 0
3: 5
4: 139
Right 1127110206 15:55661093-55661115 CATTTCTTCAAACAAAAAAAAGG 0: 1
1: 0
2: 12
3: 176
4: 1346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127110201 Original CRISPR TGGGCATGATCAAAAGATAG GGG (reversed) Intronic