ID: 1127111324

View in Genome Browser
Species Human (GRCh38)
Location 15:55674400-55674422
Sequence ACTTTCTTCAAGGATATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127111320_1127111324 -4 Left 1127111320 15:55674381-55674403 CCCTGCTATGCTAAGACTCACTT 0: 1
1: 0
2: 1
3: 11
4: 105
Right 1127111324 15:55674400-55674422 ACTTTCTTCAAGGATATAGAGGG 0: 1
1: 0
2: 2
3: 25
4: 251
1127111319_1127111324 11 Left 1127111319 15:55674366-55674388 CCTTTTACAGTGTTTCCCTGCTA 0: 1
1: 0
2: 1
3: 17
4: 204
Right 1127111324 15:55674400-55674422 ACTTTCTTCAAGGATATAGAGGG 0: 1
1: 0
2: 2
3: 25
4: 251
1127111321_1127111324 -5 Left 1127111321 15:55674382-55674404 CCTGCTATGCTAAGACTCACTTT 0: 1
1: 0
2: 0
3: 13
4: 100
Right 1127111324 15:55674400-55674422 ACTTTCTTCAAGGATATAGAGGG 0: 1
1: 0
2: 2
3: 25
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127111324 Original CRISPR ACTTTCTTCAAGGATATAGA GGG Intronic
901161618 1:7181201-7181223 ATTTTCTTCAATGATATATCAGG - Intronic
902446681 1:16470603-16470625 ACTATCTTCAAGAAAATAAAGGG + Intergenic
902973973 1:20075339-20075361 ACTTTCTTCAAGTGTTTAGTAGG - Intronic
904581892 1:31549652-31549674 ACCTTCTACAAGGATCTACACGG - Intergenic
905400818 1:37701865-37701887 ACTTTCTGCCATGATATATATGG - Intronic
906194934 1:43924101-43924123 AGTTATTTCAAGGATATATAAGG + Intronic
907828417 1:58040362-58040384 AACTTGTTCAGGGATATAGACGG + Intronic
907967684 1:59348936-59348958 ACTTTCTTCATGTATAAAGTGGG + Intronic
909459175 1:75889906-75889928 ATTTTCTTCAAGTAGATAGGTGG + Intronic
910526837 1:88188723-88188745 ATTTTCTTTATGGATATAGGGGG + Intergenic
911375815 1:97049830-97049852 ACTGTCTCCAAGAATATAAAAGG - Intergenic
911695786 1:100889595-100889617 AGTTCCTTCAAAGATATAGTGGG + Intronic
911874859 1:103147815-103147837 ACTCTCTGCAAGGTTGTAGAAGG - Intergenic
912077613 1:105895523-105895545 ACTTTCTCCAAGGAGAAAGTTGG + Intergenic
912128773 1:106574840-106574862 AATTTCTTCAAGCATTTTGATGG + Intergenic
912609040 1:111024311-111024333 ATTTTCTTCTAGGATATTTATGG - Intergenic
913998409 1:143671257-143671279 ACTGTCTTCAAGAAAATAAAGGG - Intergenic
914010772 1:143776440-143776462 GCTTTCTTCAAGGAGAAATATGG - Intergenic
914167056 1:145184675-145184697 GCTTTCTTCAAGGAGAAATATGG + Intergenic
914385005 1:147160201-147160223 ACTTTGTTCAAGGATAGAGAGGG - Intronic
914649394 1:149685097-149685119 GCTTTCTTCAAGGAGAAATATGG - Intergenic
915767646 1:158381386-158381408 ACGTTTTTCAAAGATATATAAGG - Intergenic
915970881 1:160354313-160354335 ACTCTCTTCAAGAATGAAGAGGG - Intronic
916258505 1:162815721-162815743 AATATCTTCCAGAATATAGAAGG - Intergenic
917622278 1:176809023-176809045 ACTTTATACAAGGTTATAAAGGG + Intronic
918213078 1:182368905-182368927 ACTTTCTGCTGGGATAGAGAAGG - Intergenic
918357947 1:183723898-183723920 CCTTTCTTCAAGCAGAAAGAAGG - Intronic
918945449 1:191058810-191058832 ACTTTCTTCACAGAATTAGAAGG - Intergenic
919381196 1:196863425-196863447 ACTTTCTTCACAGAACTAGAAGG - Intronic
919754068 1:201055666-201055688 ACTTTCTGCAAGGACAGAAATGG - Intronic
919973649 1:202596959-202596981 ACTTTCTGCAAGGAAAACGAGGG + Exonic
920873120 1:209810489-209810511 GCTTGCTTCAAGGATAAAAAGGG - Intergenic
924631224 1:245742784-245742806 ACTTACTTCAGGGACAGAGAGGG + Intergenic
1063525444 10:6780283-6780305 GCTTTCTTCAAGGTCATAGAAGG - Intergenic
1065097006 10:22291384-22291406 ACTTTCTTCAATGTGATAAAAGG - Intergenic
1066129405 10:32377639-32377661 ACTTTCTTTAAGAAAATAAAGGG + Intronic
1066249735 10:33621320-33621342 ACATTCTCCATAGATATAGAGGG + Intergenic
1067141931 10:43665697-43665719 ACTTTCTTCAGGGATTTTTATGG - Intergenic
1068148641 10:53103253-53103275 ACTGTCTTTAAGGATAGAGATGG + Intergenic
1068584911 10:58787217-58787239 ACTTTCTGCAAGGAAATTGAAGG + Intronic
1070233624 10:74598771-74598793 TCTTTCTTCAAGGTGATATAAGG - Intronic
1070549936 10:77483123-77483145 AATTTGTTCAAGGGTTTAGAGGG + Intronic
1070970762 10:80565356-80565378 AAGTTCTTCATGGAGATAGAGGG - Intronic
1071060386 10:81563862-81563884 ACTTGCTTCCAGAATATACATGG + Intergenic
1071727266 10:88211772-88211794 ACTTTCTTCAAGGTCAATGAAGG + Intergenic
1073493188 10:103868888-103868910 TATTTCTTCAAAGAGATAGAGGG + Intergenic
1073582283 10:104679624-104679646 ACTTTCTTCAGGGACTTGGATGG + Intronic
1074076675 10:110133142-110133164 ATTTTCTTTAATGATATAAAGGG - Intronic
1074334982 10:112563194-112563216 AGTTGCTTCAAGGATTTAGAGGG + Intronic
1074677357 10:115867152-115867174 ACTTTCTTAAAGGACAAATATGG - Intronic
1077458616 11:2696720-2696742 ACTCTATTGGAGGATATAGAGGG - Intronic
1078504827 11:11928465-11928487 AATTTCTTGAAAGTTATAGAAGG + Intronic
1080121370 11:28681620-28681642 ATTTTCCCCAAGGTTATAGATGG - Intergenic
1080230408 11:30013551-30013573 ACTTTCTTGAAGAAAAGAGAAGG - Intronic
1080809533 11:35689388-35689410 ATCTTCTTCCACGATATAGAGGG - Intronic
1080877019 11:36284481-36284503 ATATTCAACAAGGATATAGAAGG + Intronic
1082223002 11:49664679-49664701 ACTTTCTGCAGTGATATAAATGG - Intergenic
1082270224 11:50162625-50162647 ATTTTGTTCAAGGATACAGGGGG - Intergenic
1085110010 11:73879491-73879513 ACTTTCTTACAGAATTTAGAAGG - Intronic
1085232002 11:74980224-74980246 ACTTTTTTCTAGAAAATAGAGGG + Intergenic
1086271667 11:85074697-85074719 AATGTCTTCAAGAATATAGGAGG + Intronic
1087221581 11:95551846-95551868 TTTTTCTTTAAGAATATAGATGG + Intergenic
1088636833 11:111829605-111829627 ACATTCTCAAAGGAAATAGAAGG + Intronic
1089111145 11:116057671-116057693 AATATCAGCAAGGATATAGATGG - Intergenic
1090530787 11:127589573-127589595 ACTTACTTCCTGGATATAGAAGG + Intergenic
1093444427 12:19240076-19240098 AATTTCTTCAAGAATAAAAAAGG - Intronic
1094777820 12:33752026-33752048 ACTCTCTTGAAAGATACAGAAGG - Intergenic
1095123742 12:38449803-38449825 ATTTTCTTTAAGGGTATAGATGG + Intergenic
1095407672 12:41885681-41885703 CCTTTCTTGATGGATGTAGATGG - Intergenic
1098484958 12:71010065-71010087 CCTTTCTTCAGTCATATAGAAGG + Intergenic
1098568909 12:71967327-71967349 ACTTTCTTTGAGAATATTGAAGG - Intronic
1098616204 12:72526671-72526693 ACTTTCATTAAGGATATACTTGG + Intronic
1098626365 12:72675326-72675348 AAATTCTTCAAGGGTAGAGATGG + Intergenic
1099645998 12:85357508-85357530 ACTATTTTCAAGAATATATATGG - Intergenic
1100849193 12:98691550-98691572 ACATTCTTCAAGGGAATACAGGG - Intronic
1101424972 12:104580656-104580678 ATTTACTTCTAGGATATAGCTGG + Intronic
1101979560 12:109393711-109393733 ACATGCATCAAGGATTTAGATGG - Intronic
1106360251 13:29024995-29025017 ACTTTCTTCAACCATTCAGAGGG + Exonic
1107321246 13:39190744-39190766 ACTTTCTTTAAGGATAAATCTGG - Intergenic
1108005236 13:45939708-45939730 AGTTTCTACAAGGACAGAGAGGG - Intergenic
1108806784 13:54167536-54167558 AGTTTCTTCAAGTATATAAGGGG + Intergenic
1109640493 13:65185225-65185247 ACTTTCTTCTAGGGTATTTATGG - Intergenic
1109715753 13:66220035-66220057 ACTTTCTTCAAGGATTGAAGTGG - Intergenic
1110361078 13:74626510-74626532 ACTTTCTTCCAGAAAATAGATGG + Intergenic
1111357085 13:87121812-87121834 ACTTTCTTTAAGCACATTGAGGG + Intergenic
1113548161 13:111170649-111170671 ACTTTCTGGAAGGTTCTAGAAGG + Intronic
1114423583 14:22604214-22604236 ACTTTGTTCAAGGTTTGAGAAGG + Intronic
1115037769 14:28881440-28881462 ATATTCTTCAAGGAGATAGAAGG - Intergenic
1115633334 14:35267210-35267232 TCTTTCTCCAAGAACATAGAAGG - Intronic
1116119739 14:40706662-40706684 GCTTTCTTCATAGATATAGATGG - Intergenic
1116562034 14:46391987-46392009 AGTTACTCCAAGGATATGGAGGG - Intergenic
1116637842 14:47419887-47419909 AATTTCTTCAAGGAAATATGTGG + Intronic
1116849818 14:49896717-49896739 ATTTTCTTTAAGGATATAAGAGG + Exonic
1117825228 14:59695012-59695034 ACCTACTTCAAGGAAATACAGGG - Intronic
1117991241 14:61435947-61435969 TCTTTCTTCAAGGACTGAGAAGG + Intronic
1119550145 14:75503811-75503833 ACTATCCTCAAGGATATATCTGG - Intergenic
1120385662 14:83842321-83842343 ACTGACTTCAAGAATATAGATGG + Intergenic
1124223867 15:27872253-27872275 ACTTTCTTGAAAGATCTATATGG - Intronic
1124907792 15:33887707-33887729 TCTTTCCTCAAGGACTTAGAGGG + Intronic
1126807590 15:52367416-52367438 AATTTCTTGAAGGATAAGGATGG + Intronic
1127111324 15:55674400-55674422 ACTTTCTTCAAGGATATAGAGGG + Intronic
1127728421 15:61774849-61774871 AATTTCTTAAAAGATATAAAGGG + Intergenic
1127879721 15:63146058-63146080 ACTTTATACAAGTAAATAGATGG + Intronic
1128397165 15:67239631-67239653 ACTTTCTTCAAGGCTGCATATGG + Intronic
1130658261 15:85808623-85808645 AATTTCTTCCAGAAAATAGAAGG + Intergenic
1135714669 16:24752221-24752243 ATTTGTTTAAAGGATATAGAGGG + Intronic
1136622396 16:31438004-31438026 ACTTTCATTCAGGATAAAGATGG - Intronic
1138325497 16:56162702-56162724 ACTTTGTTGAAGGAAAGAGAAGG + Intergenic
1138916073 16:61466594-61466616 TCTGTCTTCAAGGAAAAAGATGG - Intergenic
1139743432 16:69055127-69055149 ACTTTCTCCATTGATAAAGAGGG - Intronic
1140017265 16:71199591-71199613 GCTTGCTTCAAGGCTTTAGAAGG - Intronic
1144754800 17:17672797-17672819 ACTGTCTTCAAAGATCTAAAGGG - Intergenic
1147008813 17:37426893-37426915 ACTTTCTTAAAGGACAGAGGAGG - Intronic
1148293765 17:46480553-46480575 GCTTTCTTCAAGCATATATTGGG + Intergenic
1148315949 17:46698256-46698278 GCTTTCTTCAAGCATATATTGGG + Intronic
1149189154 17:54037663-54037685 TCTTTCTTCTAGGATGTACATGG + Intergenic
1149225058 17:54460439-54460461 ACTGTTTTCAAAGATCTAGAGGG + Intergenic
1150628997 17:66863905-66863927 ACTTTCTTTAAGCATATTAAAGG + Intronic
1151905086 17:77042606-77042628 ACTTTCTTCCAGGAAGGAGAGGG + Intergenic
1153645443 18:7192154-7192176 ACTTTCTTCAAGTAACTAAATGG - Intergenic
1155695117 18:28676226-28676248 ACTTTCTTCCCGAATAAAGAGGG + Intergenic
1156176375 18:34551932-34551954 AGTTTATTCAAGGAAATATAAGG - Intronic
1158334145 18:56396363-56396385 ACTTTTTACAAGGATATATCTGG + Intergenic
1159216446 18:65397307-65397329 AGTTTCTTCAAAGGTATAGGAGG + Intergenic
1165680202 19:37767707-37767729 ACTTATTTAGAGGATATAGAGGG + Intronic
1165919935 19:39290320-39290342 AGTTTCATCAAAGAAATAGAAGG - Intergenic
1167105909 19:47429811-47429833 AATTTCCCCAGGGATATAGACGG + Exonic
1168589590 19:57621790-57621812 ACTTTCTTCATGGATATTCTTGG + Exonic
925586397 2:5468940-5468962 GATTTCTCCAAGGTTATAGAAGG + Intergenic
925591654 2:5515934-5515956 ATTTTTCTCAAGGATGTAGAAGG + Intergenic
928764237 2:34623131-34623153 ATTTTTTTCAAGGATACAGAGGG + Intergenic
930544331 2:52747367-52747389 CCTTTCTTCAGGAATATAAATGG - Intergenic
932401508 2:71483762-71483784 ACTTTCTTGAAGGCTAGTGATGG + Intronic
933517895 2:83329663-83329685 ACTTTCTTGAAGGGGAGAGATGG - Intergenic
933823509 2:86137224-86137246 ACTTTTTGAAAGGAAATAGAAGG - Intronic
935005871 2:99076442-99076464 TCTATCATCATGGATATAGAGGG - Intronic
935072372 2:99706078-99706100 AGTTTCTTCAGTGATTTAGAGGG + Intronic
936642786 2:114334214-114334236 ATTTTCTTCAAGGGTTTTGATGG + Intergenic
937534445 2:122868562-122868584 ATCTTTTTCAAGTATATAGATGG + Intergenic
939075830 2:137601765-137601787 ACTTTCTTCACTAATAAAGAGGG - Intronic
939470940 2:142618605-142618627 TCTTTCTTCATAGATATATAGGG - Intergenic
940499368 2:154475126-154475148 TCCTGATTCAAGGATATAGACGG - Intergenic
940857996 2:158744723-158744745 ACTTTCTGCAAGGATGGAAATGG + Intergenic
942075437 2:172352891-172352913 TTTTTCTTCAGAGATATAGATGG + Intergenic
942726752 2:179017536-179017558 ACTTTCTTCAAGTTTAAAGATGG - Intronic
942828427 2:180209262-180209284 AATCTCTTCCAGGAAATAGAAGG - Intergenic
942898048 2:181081714-181081736 CCATTCTTAAAGGATAAAGATGG + Intergenic
943756933 2:191566583-191566605 ACCTTCTTCTGGGCTATAGAAGG + Intergenic
945192285 2:207201402-207201424 GCTTTGTTCAAGAAGATAGAAGG - Intergenic
946547081 2:220755914-220755936 GCTTACTTCAAGGATAGAGAAGG + Intergenic
946981875 2:225227026-225227048 ACTTTCTTCAATGATCTGAAAGG - Intergenic
1168747910 20:259920-259942 ACTTGCTTCAAGGGGATAGTTGG - Exonic
1173171241 20:40725738-40725760 ACTGTCTTTAAGGAGAAAGAAGG - Intergenic
1173281629 20:41633466-41633488 AATTTCTCCATGGATATGGAGGG - Intergenic
1173941739 20:46916689-46916711 CCTTTCTTCTGGGATATAGTGGG + Intronic
1175452978 20:59085768-59085790 TCTTTCTTCTAGGACATACACGG + Intergenic
1175510771 20:59524082-59524104 AGTTTCTTCCAGAAGATAGAAGG + Intergenic
1176880624 21:14188118-14188140 ACTTTCTTTTAGGATAGACATGG + Intronic
1177330954 21:19661856-19661878 ACTTTCTTGAAGAAAATAAATGG - Intergenic
1177873878 21:26607750-26607772 ACTTCCATCAAGGATCAAGATGG + Intergenic
1177937207 21:27364493-27364515 ACTTTATTCAAGGAAATATGTGG - Intergenic
949215543 3:1562709-1562731 ACTTTAATACAGGATATAGAGGG - Intergenic
949856428 3:8466061-8466083 ATTTTCTTCACGGATAAAAATGG - Intergenic
951472896 3:23074791-23074813 AGTTTCTTCTGGGATATAAACGG + Intergenic
951595342 3:24312606-24312628 AAATTATTGAAGGATATAGAAGG - Intronic
951981382 3:28570836-28570858 ACTTTCTACAATGATAGAAATGG - Intergenic
952154312 3:30626532-30626554 ACTTCCTTCAAGGAAACAGAGGG + Intronic
953597992 3:44336351-44336373 ATTTTCCTCATGGATATTGATGG - Intergenic
956001729 3:64736893-64736915 ACTTTCTACAAAGTTCTAGAAGG - Intergenic
957173305 3:76768908-76768930 ACAATCTTCAAGTATATAAAGGG - Intronic
957512393 3:81206247-81206269 ATATTCTTTAAGGATATAGTGGG + Intergenic
957668593 3:83269983-83270005 ATTTTCTTCTAGGATATTTATGG + Intergenic
959068710 3:101682941-101682963 CCTTCCTTCAAGAATTTAGAGGG + Intronic
960519520 3:118638984-118639006 ACTTTCTTCAATGAAACACACGG + Intergenic
961226152 3:125249067-125249089 GCTTTCTTCAAGGATTTTTATGG - Intronic
963320899 3:143807941-143807963 ACTTTCTTAAAGCATCGAGATGG - Intronic
963752184 3:149193430-149193452 AGTTTTTTTAATGATATAGAAGG + Intronic
964978831 3:162653010-162653032 ACTTTATTCAAGGATATGAAAGG + Intergenic
965706970 3:171518842-171518864 ATTTTCTTCAAGGGTTTATATGG - Intergenic
965935409 3:174103738-174103760 ACTATATTCAAGAATATTGATGG - Intronic
966606722 3:181828331-181828353 AATTTCTTCCAAAATATAGAAGG - Intergenic
966716618 3:183019225-183019247 ACTGTATTCAAGTATATAAAAGG + Intronic
971295424 4:25385399-25385421 ACTTTCTTCAGTGATTTAGCTGG + Intronic
971872730 4:32265395-32265417 ACTTTGTTGGAGAATATAGAAGG + Intergenic
971890281 4:32511050-32511072 ACTTGCTTCAAGGAAAATGAGGG - Intergenic
972423138 4:38908647-38908669 ACTTTCTGCAAGGACATTCATGG - Exonic
972789994 4:42362310-42362332 CCTGTATGCAAGGATATAGAAGG - Intergenic
973268210 4:48232396-48232418 AGTTTCTTGAGGGAGATAGATGG - Intronic
973680870 4:53317962-53317984 ATTTTCTTGTAAGATATAGAAGG + Intronic
974350998 4:60745763-60745785 GCATTCTTCAAGGAACTAGAGGG - Intergenic
974731639 4:65874373-65874395 ACTTTATTCAAGGATACAGTTGG + Intergenic
974924381 4:68279083-68279105 ACTTTCTTCAAGGCTATACAAGG + Intergenic
974979043 4:68930349-68930371 ACTTTCTTCATGGAAATATTAGG - Intronic
976102798 4:81583314-81583336 TCTTTTTTCAGGGATATAGAAGG + Intronic
976116119 4:81729126-81729148 ACATTCTTCACAGAAATAGAAGG + Intronic
977267823 4:94877176-94877198 ATTTTCTTCATGGAGAGAGATGG + Intronic
977529314 4:98181468-98181490 TTTTTCTTCAAGGATATTTAGGG - Intergenic
977871435 4:102095055-102095077 CCTTTCTTAAAGGATAGAGAAGG - Intergenic
979951996 4:126904751-126904773 TCTTTCATCAAAGAAATAGATGG + Intergenic
983216076 4:165004287-165004309 CCTTTCTTCACGAAAATAGAAGG + Intergenic
983313377 4:166095068-166095090 ACTGTCTTCTAGAATATGGACGG + Intronic
983411876 4:167409428-167409450 ACTTTATCAAAGGCTATAGAGGG + Intergenic
983963449 4:173781998-173782020 GCTTACTTCAAGGATCTAAATGG - Intergenic
984371850 4:178877552-178877574 TTTTTCTTCAAGGTTATTGATGG - Intergenic
985056259 4:186037971-186037993 CCTATCTTCCAGGTTATAGAAGG - Intergenic
986138143 5:5002269-5002291 ACTTTCTTCAATGCAATAAAGGG + Intergenic
988617246 5:32786378-32786400 AGATTCTTTAAGGAGATAGACGG + Exonic
991140750 5:63239349-63239371 ACTTTCTTCCAAGATAAACATGG + Intergenic
991365823 5:65866971-65866993 ACTCTCTTTAAGGACATAGAAGG + Intronic
992291176 5:75281617-75281639 AGTTTCTTCATGCATATACAAGG + Intergenic
993263135 5:85687307-85687329 ACATTCTAGGAGGATATAGAAGG - Intergenic
993963732 5:94334073-94334095 ACTTTCTTCACAGAATTAGAAGG + Intronic
994864571 5:105250275-105250297 GCTTTCTTCACAGAAATAGAGGG + Intergenic
995797806 5:115960741-115960763 AATTTCTTGAAGGATTTCGAAGG - Intergenic
996156496 5:120109136-120109158 ACTGTCTTCAAGGAGAGAAAAGG - Intergenic
996258719 5:121439040-121439062 ACTTGCTTCATAGAAATAGAAGG - Intergenic
996545166 5:124670203-124670225 CCTTTCTTCACAGAGATAGAGGG + Intronic
996595116 5:125191945-125191967 ACTGTCTACCATGATATAGAGGG + Intergenic
998508022 5:142687594-142687616 ATTTTCTTTAAGGATTCAGAAGG - Intronic
998543211 5:143002915-143002937 AATTTCTTCAAGCTTCTAGAAGG - Intronic
1000535606 5:162474378-162474400 ACTTTCTACAAGGATATGTAGGG - Intergenic
1004757043 6:18621632-18621654 AATTTCTTCCATAATATAGAGGG - Intergenic
1006277059 6:33013544-33013566 ACTTCTTTCAAGGACATAGATGG + Intergenic
1008826321 6:55698299-55698321 CCTTTCTTCAAGGAAATACTAGG - Intergenic
1012349970 6:98238057-98238079 AATAACTTCAAGGATAAAGAAGG + Intergenic
1013655086 6:112238168-112238190 AAACTCTTCAAGGATATAGAAGG - Intronic
1014158749 6:118141937-118141959 ACTTTCTTTAAGAACAAAGAAGG - Intronic
1024141273 7:46465579-46465601 ACTTTCTTCCAGGAGAAAGCTGG - Intergenic
1024458257 7:49632916-49632938 ACTGTCTTCCAGGATTTGGATGG + Intergenic
1027405707 7:77857789-77857811 ACTTTGTTCATGTATATAAAGGG + Intronic
1027499133 7:78926220-78926242 AATTTCTTCAAGGATCTTCAAGG - Intronic
1027802976 7:82779550-82779572 GCTTTCGTTAAGGATGTAGAAGG - Intronic
1028055552 7:86237234-86237256 ATTTTTTTCAAGGAAATAGTAGG - Intergenic
1028876422 7:95828257-95828279 ACTTTCTTCAAAGCTTTATAAGG - Intronic
1029252106 7:99244286-99244308 AATTTCTTCAAGGATGCAGTTGG - Intergenic
1029308017 7:99635484-99635506 ATTTTCTTTAAGGATATAAGAGG - Intergenic
1029477792 7:100795178-100795200 GCTTTCTGCAAGGACAGAGAGGG - Exonic
1030513828 7:110517659-110517681 AAATTCTTCAAGGATATAAAAGG - Intergenic
1030894094 7:115035795-115035817 ATGTTCTTCCAGGATATAGGTGG - Intergenic
1032875008 7:136029033-136029055 ATTTTCTTGAAGGAAATAGTTGG + Intergenic
1033238988 7:139661441-139661463 ACTGTCTTCAAGTATGTAAAAGG - Intronic
1033289256 7:140068684-140068706 AATATCAGCAAGGATATAGAAGG + Intergenic
1033344115 7:140513991-140514013 ACTTTCTTCAAACATTTTGAGGG - Intergenic
1035861211 8:3029862-3029884 AGTTCCTCCAAGGATATTGAGGG - Intronic
1036433817 8:8714471-8714493 TCTTTCTTCATGGATAAGGATGG + Intergenic
1036913933 8:12786164-12786186 ACTTTCTGCAAGAATATAAAAGG - Intergenic
1038288798 8:26229974-26229996 AATTTCTTGAAGGATATATGGGG + Intergenic
1038306830 8:26412031-26412053 TCTTTTTTCAAGAATATAGCTGG + Exonic
1038433438 8:27518382-27518404 ACTTTTTTCAATGCTTTAGATGG - Intronic
1039939498 8:42077414-42077436 AATGTCTTCAAGGATATATTTGG - Intergenic
1040749130 8:50683866-50683888 ATTGTCCTCAAGGATATAAAAGG + Intronic
1041196222 8:55404006-55404028 TCTTTCTCCAAGGCTATAGCAGG - Intronic
1041751327 8:61264237-61264259 AGCGTCTTCAAGCATATAGACGG - Intronic
1044888106 8:96801351-96801373 ACTTACTTCAAGCATAAAGGAGG + Intronic
1045081017 8:98625941-98625963 ACTTTTTTCAGGGTTATAGTAGG - Intronic
1046467838 8:114629554-114629576 ACTTTCTTCTACAATATGGAAGG - Intergenic
1047181272 8:122590494-122590516 AGTTTCCTCAAGTATACAGAAGG - Intergenic
1047492465 8:125386210-125386232 ACCTGCTTCAAGGAGACAGATGG - Intergenic
1047874444 8:129120352-129120374 ACGTTTTTAAAGGAAATAGATGG - Intergenic
1048131399 8:131701710-131701732 ACTTTCTTCAAGAAGAAACAGGG - Intergenic
1050400584 9:5248926-5248948 AATTTCTTCACTGAAATAGAGGG + Intergenic
1051716923 9:19994713-19994735 ACTATCTTCAGGGAAGTAGATGG - Intergenic
1052379866 9:27758421-27758443 ACTTTTTTAAAGGATAGAGTAGG - Intergenic
1053356880 9:37453587-37453609 ATTTTCTCCAATGACATAGAGGG - Intronic
1055170459 9:73252402-73252424 AATTTCAACAAAGATATAGAAGG + Intergenic
1062620608 9:137419717-137419739 ATTTTCTTCAAGGAAATTCATGG + Intronic
1185788902 X:2913620-2913642 GGTTTCTTCAAGGCCATAGAAGG + Intronic
1185847606 X:3453554-3453576 ACTTATTTCAAGGGTATGGAAGG + Intergenic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1187799564 X:23045580-23045602 ATTTTCTTCAAGTATTTGGAGGG - Intergenic
1188360784 X:29250657-29250679 TCTTTCTGCAAGGAAAAAGAAGG + Intronic
1191749985 X:64531923-64531945 ACTTGTTTCCAGGATATATAAGG - Intergenic
1193713319 X:84904917-84904939 AATTTCTTCAAGAATAAAAAAGG - Intergenic
1194183576 X:90743086-90743108 ACTTTTTGCAGGGACATAGATGG + Intergenic
1195607052 X:106817946-106817968 ACTTTGTTCTAGGAAATAGTAGG + Intronic
1199023126 X:142905715-142905737 AATTTATTCAAGGACATAGAAGG - Intergenic
1200480940 Y:3702038-3702060 ACTTTCTTCAAGAATTATGAGGG - Intergenic
1200530185 Y:4325031-4325053 ACTTTTTGCAGGGACATAGATGG + Intergenic
1201286069 Y:12379746-12379768 GGTTTCTTCAAGGCCATAGACGG - Intergenic