ID: 1127115377

View in Genome Browser
Species Human (GRCh38)
Location 15:55721249-55721271
Sequence CTGTAGGCAGAGTGGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 370}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127115377_1127115385 19 Left 1127115377 15:55721249-55721271 CCCAGCCTCCACTCTGCCTACAG 0: 1
1: 0
2: 2
3: 28
4: 370
Right 1127115385 15:55721291-55721313 GCTCTCCTCACAGACACTAATGG 0: 1
1: 0
2: 0
3: 10
4: 171
1127115377_1127115386 20 Left 1127115377 15:55721249-55721271 CCCAGCCTCCACTCTGCCTACAG 0: 1
1: 0
2: 2
3: 28
4: 370
Right 1127115386 15:55721292-55721314 CTCTCCTCACAGACACTAATGGG 0: 1
1: 0
2: 1
3: 20
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127115377 Original CRISPR CTGTAGGCAGAGTGGAGGCT GGG (reversed) Intronic
900087130 1:904095-904117 CTGCACTCAGAGTGGAGGATGGG + Intergenic
900172147 1:1274246-1274268 CTGGAGGCTCAGTGGAGGGTTGG + Intergenic
900314395 1:2049908-2049930 CTGGGGGCGGAGTGGGGGCTGGG + Intergenic
900744074 1:4349139-4349161 CAGTAGGTTGAGAGGAGGCTAGG + Intergenic
901072783 1:6530906-6530928 GTGTAGTCAAAGTTGAGGCTAGG - Intronic
901522725 1:9797703-9797725 CTGAAGGAACAGAGGAGGCTTGG + Intronic
903015203 1:20357138-20357160 CTGAAGGCAGCTTGGAGGCTGGG - Intergenic
903664175 1:24996487-24996509 CTGTAGGCAGAGGGAAGGACAGG - Intergenic
903811839 1:26038984-26039006 CTGTAGTCAGATGGGAGGCTGGG + Exonic
905353015 1:37360505-37360527 CAGGAGGCAGAGTGAAGGCAGGG - Intergenic
905958259 1:42018674-42018696 CTGTAGGCAGAAGGTAGGATAGG - Intronic
906088227 1:43154784-43154806 CTGTAATCAGAGTCGAGGCCAGG - Intronic
906309491 1:44743143-44743165 CTGTAGGCAGTGGGGAACCTTGG + Intronic
906490676 1:46266132-46266154 CTCTAGGCAGAGGGGTGGCATGG + Intronic
906597421 1:47091885-47091907 CTGTGGGAAGAGGGGAGGCCTGG + Intronic
907395139 1:54184456-54184478 CAGAAGGCAGACAGGAGGCTGGG + Intronic
907864890 1:58390085-58390107 TTTTAGGCTGAGGGGAGGCTGGG + Intronic
908693514 1:66810110-66810132 CTGCAGGAGGAGTGGAGCCTTGG + Intergenic
910081571 1:83348134-83348156 CAGTAGGGAGTGTGGAGGCCTGG + Intergenic
910277383 1:85464355-85464377 CGGTAGGGCGGGTGGAGGCTGGG - Intronic
910919587 1:92329398-92329420 CTGCAGGCTGTGTGGAAGCTGGG - Intronic
913161848 1:116152247-116152269 CTGAAGGCAGAGAGCAGACTGGG + Intergenic
915314709 1:155021831-155021853 AAGAAGGCAGAGTGGAGGTTGGG - Intronic
918069453 1:181124321-181124343 CTGAAGTCAGAGTGCATGCTAGG + Intergenic
920389365 1:205589334-205589356 CGGTAGGCAGGGTGGGGGATCGG + Intronic
920728521 1:208460929-208460951 TTGTAGGCAGAGTGGGGAATTGG - Intergenic
921243354 1:213209741-213209763 CTGTAGGCAGAGTAGGAGCATGG + Intronic
921888520 1:220330416-220330438 CTGGAGGGAGAGAGGGGGCTGGG - Intergenic
922173689 1:223178428-223178450 CTGTAAGCCAAGGGGAGGCTGGG + Intergenic
922257618 1:223906707-223906729 GTCTAGGCAGAGCGGAGCCTGGG + Intergenic
923236937 1:232043096-232043118 GTGTGGGCAGAATGGAGACTTGG + Intergenic
923803147 1:237229860-237229882 CTGGAGTCAGAGTGGACGCAGGG - Intronic
924338810 1:243009486-243009508 GTCTAGGCAGAGCGGAGCCTGGG + Intergenic
924439472 1:244074275-244074297 CTGGCGGCAGGGTGGAGGCAGGG + Intergenic
1065048746 10:21768663-21768685 CTGTAGAGAGAGTGGAAGGTAGG - Intronic
1066166157 10:32790174-32790196 CACTAGGCATAGTGGAGCCTTGG - Intronic
1066408553 10:35143436-35143458 TTGTAGGCAGAGTGGAATGTTGG + Intronic
1066529809 10:36325003-36325025 CTGGAGGCAGTTTGCAGGCTGGG - Intergenic
1067203766 10:44196477-44196499 CTGAAGGCAGAGAGGAGGAGAGG + Intergenic
1067656499 10:48196098-48196120 CTGCAGGCAGAGGGTATGCTGGG + Intronic
1068752864 10:60615811-60615833 CTGTAGTCAGAGTAGATCCTTGG - Intronic
1069583841 10:69583603-69583625 ATGAAGGCAGAGTTGAGGCCAGG + Intergenic
1069678653 10:70267759-70267781 CTGGAGGCTCAATGGAGGCTGGG + Intronic
1070121075 10:73577967-73577989 CTGTGAGCAAAGTGGAGGCTTGG - Intronic
1070155641 10:73833256-73833278 CTGTGGAAAGATTGGAGGCTGGG - Intronic
1070307938 10:75250960-75250982 CAGTGGGCAGAGAGGAGCCTGGG + Intergenic
1070814718 10:79315471-79315493 CTGTGGGCCGGGTGGATGCTTGG - Exonic
1071067863 10:81656994-81657016 CTGTGGGCAGTCTGGAGCCTAGG + Intergenic
1072236619 10:93459248-93459270 CTGTAACCAGAGAGGAGGATTGG - Intronic
1072400375 10:95092559-95092581 CTGTAGGCAGAAAGGAGGACAGG - Intergenic
1074519898 10:114209713-114209735 CTGAAGACAAAGGGGAGGCTGGG - Intronic
1075595654 10:123727294-123727316 CTGGAGGGAGAGATGAGGCTGGG - Intronic
1076474730 10:130744083-130744105 CTATGGGCTGGGTGGAGGCTGGG + Intergenic
1076984862 11:228107-228129 CTGTAGGAACAGAGTAGGCTGGG - Intronic
1077012864 11:386640-386662 CTCTCAGCAGAGAGGAGGCTGGG - Intergenic
1078006309 11:7535023-7535045 CTCTAGGGAGAGGGGAGGATGGG + Intronic
1078578092 11:12517971-12517993 CTCTGGGGAGAGAGGAGGCTGGG - Intronic
1078898591 11:15620855-15620877 CTGTAGGTAGAGTGGACACCAGG - Intergenic
1079237367 11:18700018-18700040 CTGCAGGCAGAGTCCAAGCTGGG - Intronic
1080416308 11:32072817-32072839 CAGAGGGCAGACTGGAGGCTTGG + Intronic
1080743231 11:35084784-35084806 GAGTAGGTAGAGTGGAGCCTGGG - Intergenic
1084303416 11:68265911-68265933 CTGTAGGCAGACTGGGGCTTTGG + Intronic
1084502734 11:69544485-69544507 AAGGAGGCAGAGTGGTGGCTGGG + Intergenic
1085361379 11:75890763-75890785 CTGTAGGAAGAAAGGGGGCTAGG + Intronic
1085800545 11:79585388-79585410 ATATGGGCAGAGTGGGGGCTTGG + Intergenic
1086312469 11:85550011-85550033 CCATAGGCAGAGTGGTGGCATGG - Intronic
1086402543 11:86472492-86472514 ATGTAGGCAGAGAAGAAGCTGGG + Intronic
1087687091 11:101277002-101277024 ATGAAGGCAGAGTGGAGGAAAGG + Intergenic
1090407533 11:126486117-126486139 CTGTATGCAGAGTGGAGGAAGGG + Intronic
1090825358 11:130381351-130381373 CTGCAGGAAGAGTGAAGCCTGGG - Intergenic
1090948140 11:131449473-131449495 CTGGTGGCAGAGTGTGGGCTAGG + Intronic
1091192792 11:133708252-133708274 ATGGAGGCAGAATGGAGGCATGG + Intergenic
1091385444 12:91832-91854 CTGAAGGAAGAGGGGAAGCTGGG - Intronic
1091404773 12:202368-202390 CTGTAAACACAGTGAAGGCTGGG + Intronic
1091784488 12:3234651-3234673 CTGCAGTCAGAGTGGAAGCGTGG + Intronic
1091835814 12:3584898-3584920 CTGAGGGCAGTGTGGAGGGTAGG - Intronic
1092175713 12:6404822-6404844 GTGTAGGCTGGGTGGGGGCTGGG - Intergenic
1092368687 12:7898508-7898530 TGGTAGGAAGAGTAGAGGCTGGG - Intergenic
1093845095 12:23961388-23961410 ATGTAGGGAGAGATGAGGCTGGG - Intergenic
1096513884 12:52145997-52146019 TTGTGGGCAGTGTGGATGCTGGG + Intergenic
1096616578 12:52836456-52836478 CTGAAGGTAGAGTGGAGAGTAGG - Intergenic
1096914901 12:55020697-55020719 CTGTGAGCAGAGTGGTGGATTGG - Intronic
1097171067 12:57113121-57113143 CTGCAGGCAGAGTGGGCACTCGG - Intronic
1099933721 12:89101582-89101604 CTGGAGGTTGAGTGGAGGCTTGG - Intergenic
1101597902 12:106183484-106183506 GTGTGGGCACAGTGGTGGCTGGG + Intergenic
1101732871 12:107440981-107441003 AGGTAGGCAGAGTTGAGGTTAGG + Intronic
1102122166 12:110450146-110450168 CGGAAGGCAGAGAGGAAGCTGGG - Intronic
1104037030 12:125104654-125104676 CTGCAGGCAAAGTGGTGGCTTGG + Intronic
1106232017 13:27827848-27827870 TTGAAGGCAGAGTGGAGGACAGG - Intergenic
1107549177 13:41458592-41458614 CAGTAGGCCGAGTGGTGGCGGGG + Intronic
1108408206 13:50125027-50125049 CGGTAGGGAGAGCGGAGGCGCGG - Intronic
1110662871 13:78078685-78078707 CTGTAGGGAGAGTGGACTGTTGG - Intergenic
1112803616 13:103138414-103138436 CTGGAGGAGGAGAGGAGGCTGGG + Intergenic
1114493531 14:23117865-23117887 CAGGAGGCAGAGCGGAGGCGGGG + Intronic
1115504603 14:34081082-34081104 GAGTAAGCAGAATGGAGGCTGGG + Intronic
1117543314 14:56769679-56769701 CTGTAGCCAGAGATGAGGCCAGG - Intergenic
1118375005 14:65169227-65169249 CTTTAGCCACAGAGGAGGCTGGG - Intergenic
1118877347 14:69796677-69796699 ATGCAGGCTGGGTGGAGGCTAGG - Intronic
1119427089 14:74542708-74542730 AGGTAGTCAGAGTGGAGCCTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119704950 14:76777717-76777739 CTGAAGGCAGAGTGGAAGTGGGG - Intronic
1120185392 14:81388589-81388611 CTGTAGGCACAGTGGAGTTAGGG - Intronic
1121148172 14:91604775-91604797 TGGTAGGAAGAGTAGAGGCTGGG + Intronic
1121840778 14:97132073-97132095 CTGGAGGCAGAGACCAGGCTTGG - Intergenic
1122243348 14:100383624-100383646 CTGCTGGCAGAGTGGCAGCTTGG + Intronic
1123010600 14:105347866-105347888 CACTAGGCAGAGTGGAGGGTAGG + Intronic
1124898198 15:33797215-33797237 CTGTAGGCAGAGAAGAAGGTTGG - Intronic
1124916569 15:33980743-33980765 CTCTAAGCAGAGTGTAGGCAAGG + Intronic
1125011087 15:34876562-34876584 CCGTAGTCATAGTGGTGGCTTGG - Intronic
1125032258 15:35084566-35084588 TGGTAGGAAGAGTAGAGGCTGGG + Intergenic
1126923945 15:53560970-53560992 CTTTAGGGAGAGTGAAGTCTGGG - Intronic
1127115377 15:55721249-55721271 CTGTAGGCAGAGTGGAGGCTGGG - Intronic
1127972152 15:63970090-63970112 CTGGAGACAGCCTGGAGGCTGGG - Intronic
1128247068 15:66140388-66140410 CTGGAGGCAAAATGGAGGCAGGG + Intronic
1128386222 15:67150513-67150535 CTGTGGGCAGACTGCACGCTTGG - Intronic
1129333707 15:74840324-74840346 AGGGAGGCAGAGCGGAGGCTGGG + Intronic
1129884047 15:79026398-79026420 CAGGAGGCAGAGTGGTGGCCTGG - Intronic
1130021206 15:80233446-80233468 CAGCAGCCAGATTGGAGGCTTGG - Intergenic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1132496247 16:264825-264847 ATGTAGGCGGCGTGGCGGCTTGG - Exonic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1134605859 16:15570692-15570714 CTGTAGGCAGGGTAGCAGCTTGG + Intronic
1135135303 16:19882809-19882831 CTGTAGGCAGATTTGGGGGTGGG - Intronic
1137695407 16:50458530-50458552 CCGTAGGCAGAGCAGTGGCTTGG - Intergenic
1138074548 16:54028196-54028218 CTGCAGGCAGAGTGAAAACTTGG + Intronic
1139588417 16:67919160-67919182 CTGGTGGCAGAGTGGAGGCAGGG + Intronic
1139877604 16:70158674-70158696 CTCTAGGCAGAGAGGAGGAGAGG + Exonic
1142030197 16:87834754-87834776 CTGTATGCAGAGTCGAGGGCGGG - Intronic
1142144366 16:88486710-88486732 CTGGGGGCACAGTGGATGCTGGG + Intronic
1142176053 16:88646001-88646023 CTGTAGGCTGAGCCAAGGCTGGG - Intronic
1143091208 17:4450054-4450076 CTGGAGGCAGGGAGGAGGCCGGG - Intronic
1145058637 17:19718755-19718777 GTGCAGGCAGAGTGGGGGGTGGG + Intronic
1145737235 17:27241466-27241488 CTGACTGCAGAGTGGAGGGTGGG + Intergenic
1146056681 17:29584871-29584893 CTGTGGGCAGAGCTCAGGCTGGG - Intronic
1146943978 17:36861858-36861880 CTGCAGGCAGACTGGGAGCTGGG + Intergenic
1147052035 17:37802520-37802542 CAGAAGACTGAGTGGAGGCTGGG + Intergenic
1147895441 17:43747999-43748021 CTCTGGGCAGAGCGGAGGCGTGG + Intergenic
1148400636 17:47357032-47357054 CTGTGGGCTGCGTGGAAGCTGGG - Intronic
1148582199 17:48751988-48752010 CTGAAGGAAGGGTGGGGGCTGGG + Intergenic
1148790317 17:50169049-50169071 CTGTCAGCAGAGTGGGGGCAGGG - Intronic
1148808649 17:50277138-50277160 CTGAAGGATGAATGGAGGCTTGG + Intronic
1148861934 17:50609143-50609165 CTGAGGGCAGAGGGGAGGCAGGG - Intronic
1149302630 17:55318905-55318927 CTGGAGGCAGGGGAGAGGCTGGG - Intronic
1150226585 17:63527837-63527859 GGGTAGGCAGACAGGAGGCTAGG - Intronic
1150266416 17:63834943-63834965 CTCTGGGCAGACTGGAGGCAGGG + Intronic
1150490711 17:65572713-65572735 CTGTCTGCAGAGTGGATACTCGG + Intronic
1150714228 17:67557719-67557741 CTGTAGTCAGAGTCAAGGGTGGG - Intronic
1150806238 17:68321372-68321394 CAGAAGGCAATGTGGAGGCTGGG + Intronic
1151494267 17:74450076-74450098 CTGCGGGCAGAGTGCAGGCAGGG - Intronic
1152642654 17:81455654-81455676 CTGTGAGCAGAGTGTAGCCTGGG - Intronic
1157359954 18:46967331-46967353 CTGTCAGCAGAGTGGGTGCTGGG - Intronic
1157360553 18:47020931-47020953 CTGTCAGCAGAGTGGGTGCTGGG - Intronic
1157361542 18:47026846-47026868 CTGTCAGCAGAGTGGGTGCTGGG - Intronic
1160384187 18:78485106-78485128 CTGCAGGCAGAGTGTGGACTTGG - Intergenic
1160384206 18:78485190-78485212 CTGCAGGCAGAGTGTGGACTTGG - Intergenic
1160384227 18:78485317-78485339 CTGCAGGTAGAGTGTAGACTTGG - Intergenic
1160384254 18:78485442-78485464 CTGCAGGCAGAGTGTGGACTTGG - Intergenic
1160384263 18:78485483-78485505 CTGCAGGCAGAGTGTGGACTTGG - Intergenic
1160384289 18:78485608-78485630 CTGCAGGCAGAGTGTGGACTTGG - Intergenic
1160575319 18:79849683-79849705 CTGGAGGCAGAGCGGAGGCTGGG + Intergenic
1161092637 19:2369872-2369894 CTGCAGTCAGAGTGTTGGCTGGG + Intergenic
1161162231 19:2767914-2767936 CCGTGGGCAGAGTGGAGCCCAGG + Intronic
1161313909 19:3609066-3609088 CTGCAGGCAGACTGGAGGTGGGG - Intergenic
1162135142 19:8550731-8550753 CTGGAGGCAGGTTGGAGGCCAGG - Intronic
1162179669 19:8859497-8859519 CTGTGTGCAGAATGGAGGGTGGG - Intronic
1162464144 19:10830593-10830615 CAGTAGGCAGAGGGCAAGCTGGG - Intronic
1163161087 19:15464446-15464468 CTGGAGGCAGAGCTGAGGGTGGG - Intronic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
925183166 2:1830118-1830140 GTGTCTGCAGAGAGGAGGCTGGG + Intronic
925395014 2:3527131-3527153 CTGGGGGAAGAGTGCAGGCTGGG - Intergenic
927132839 2:20074989-20075011 CTGAAGGCAGGATGGAGGCAGGG - Intergenic
927441232 2:23119498-23119520 CTGAAAGCAGAGGGGAGGGTTGG - Intergenic
927643935 2:24863323-24863345 GTGTAGGCTGTATGGAGGCTAGG - Intronic
928153670 2:28856392-28856414 CTGGAGAAAGAATGGAGGCTGGG - Intronic
928176087 2:29035311-29035333 CTGTAGGTGGAGGGGAAGCTGGG + Intronic
928286047 2:29990872-29990894 CTAGAGGCAGAGTGGATGGTGGG + Intergenic
929530877 2:42751615-42751637 GAGAAGGCAGAGTGGAGCCTGGG + Intronic
929553794 2:42911203-42911225 CTGTAGCGACAGGGGAGGCTGGG + Intergenic
930046637 2:47178047-47178069 CGTTAGGCAGAGAGGACGCTGGG + Intergenic
932410079 2:71542022-71542044 CTGAAGGCAGAGTGGGGGAGTGG + Intronic
932583831 2:73009785-73009807 CTGTAGGCAGGTGGGAGACTTGG - Intronic
934049141 2:88195516-88195538 TTGTAGGCAGTGTGGAGGATGGG + Intergenic
934120061 2:88829615-88829637 CTGGATGCAGGGAGGAGGCTGGG + Intergenic
934778429 2:96953733-96953755 CTGCAGGCCGAGTGCATGCTCGG + Intronic
935555951 2:104509656-104509678 CTGAAGGCTGAGTGGTGGGTGGG - Intergenic
936076051 2:109402528-109402550 CTGTAGGCACCGAGGAGCCTGGG - Intronic
936868991 2:117110238-117110260 GTGGAGGTAGAGTGCAGGCTGGG + Intergenic
937312703 2:120911845-120911867 TTCTAGGCAGGGTGGAGCCTAGG + Intronic
937363157 2:121242898-121242920 CTGCAGACAGAGTGTAAGCTGGG - Intronic
937375503 2:121333322-121333344 CTGAAGGGGGAGTGGAGGGTGGG + Intergenic
937851338 2:126638906-126638928 CCGTAGGCAGAGTTGAAGCTGGG + Intergenic
938951386 2:136257936-136257958 CTGTAGTCAGAGGGGAGGTCAGG - Intergenic
938969273 2:136417282-136417304 CTGTAGAAAGAGTGATGGCTGGG + Intergenic
940921688 2:159314859-159314881 CTGTGGGGGGATTGGAGGCTAGG + Intergenic
940925864 2:159363049-159363071 CTGTAGGGATAGTAGAGGCTTGG + Intronic
942215867 2:173718521-173718543 ATGTAGCCAGACTGGAGTCTAGG + Intergenic
942809684 2:179983253-179983275 GTGAAGGGAGAGTGGAGGGTGGG - Intronic
943725279 2:191245919-191245941 CTGTGGGCAGAGTCGAATCTCGG + Intronic
946119938 2:217501449-217501471 CTGTAGGCAGTGAGGAGTCAAGG - Intronic
948184768 2:236012298-236012320 AAATAGGCAGAATGGAGGCTGGG - Intronic
948329230 2:237151789-237151811 CTGTGGGCAGTGGGGAGCCTCGG - Intergenic
948369208 2:237476707-237476729 CTGTCTCCAGAGTGGAGGTTAGG - Intergenic
1169189026 20:3645504-3645526 CTGAGGGCAGGGTGGCGGCTGGG + Intronic
1170614560 20:17938310-17938332 CTGAAGGCAGGGAAGAGGCTGGG + Intergenic
1172227811 20:33316929-33316951 CTGAAGGCAGAGTAGGTGCTGGG - Intergenic
1173282192 20:41638844-41638866 CTGGAGGCAGAGGGGACTCTAGG - Intergenic
1173334960 20:42105069-42105091 CTGAAGGCAGAGGGGATACTTGG + Intronic
1173661433 20:44736974-44736996 CTGTCTGCACAGTGGAAGCTGGG - Intergenic
1173790476 20:45824703-45824725 CTCTAGGCAGGGTGGGGGTTGGG - Intronic
1174190152 20:48734818-48734840 CTGGGGCAAGAGTGGAGGCTGGG - Intronic
1174463530 20:50699722-50699744 CTGTGCCCAGAGTGGGGGCTTGG - Intergenic
1174972436 20:55291330-55291352 CTGTTGGCTGATTGAAGGCTTGG + Intergenic
1175047944 20:56125125-56125147 CTGTAAATAGAGTGGATGCTTGG + Intergenic
1176293498 21:5058704-5058726 GTGCAGGCAGGGTGGAGCCTGGG + Intergenic
1176368854 21:6050581-6050603 CTGAAGGCAGAGCCGAGGCAGGG + Intergenic
1177003253 21:15639353-15639375 CTGTAGACAGAGTGCTGGCTGGG - Intergenic
1177452710 21:21292179-21292201 GTGAAGGAAGAGTGGAGGCCAGG + Exonic
1179277183 21:39903130-39903152 CTGGAAGCAGAGTGGCTGCTGGG + Intronic
1179402020 21:41093295-41093317 CTGTAGGCTGAGTGGAGGAAAGG - Intergenic
1179754665 21:43487961-43487983 CTGAAGGCAGAGCCGAGGCAGGG - Intergenic
1179840598 21:44070493-44070515 CTCAGGGCAGAGCGGAGGCTTGG + Intronic
1179863762 21:44204944-44204966 GTGCAGGCAGGGTGGAGCCTGGG - Intergenic
1180089802 21:45528075-45528097 CAGTGGGGACAGTGGAGGCTCGG + Intronic
1180247029 21:46555115-46555137 CTGTGGGCTGAGTGGAGCGTGGG - Intronic
1181042822 22:20200636-20200658 ATGTAGGCAGAGTGGGGACAAGG + Intergenic
1181495251 22:23283954-23283976 CTGCAGGCACAGGGAAGGCTGGG - Intronic
1181911421 22:26241329-26241351 CTGGAGGCAGAGCTGAGGGTAGG - Intronic
1183832651 22:40426660-40426682 CTGGGGGCAGCTTGGAGGCTGGG - Intronic
1184379699 22:44137648-44137670 CTGAAGGCTGGATGGAGGCTGGG + Intronic
1184594247 22:45504217-45504239 CTGGAGGGGGAGGGGAGGCTGGG + Intronic
1185111290 22:48901547-48901569 CTGGAAGCAGGGAGGAGGCTTGG + Intergenic
1185126277 22:49012470-49012492 CTGTTGACAGCGTGGATGCTTGG + Intergenic
1185297749 22:50062527-50062549 CAGTAGGGAGGGTGGAGGGTGGG + Intronic
949516070 3:4807992-4808014 CTGGAGGCAGATTGGAGGAAAGG - Intronic
950135519 3:10578010-10578032 CTGAAGACAGAGTAGAGACTTGG - Intronic
950491231 3:13306163-13306185 CTGTAGGCAGTGGGGAGGCATGG - Intergenic
953055952 3:39387358-39387380 CTGGGAGCAGAGTGGAGGGTGGG + Intronic
953241302 3:41151710-41151732 AGGTAGGCAGAGTGGGAGCTTGG - Intergenic
954107363 3:48416452-48416474 CTGTAGGCACAGGGCAGGCTAGG + Intronic
956398724 3:68853429-68853451 CAGTAGGCAGAGAGGAGGAAAGG - Intronic
956675012 3:71725263-71725285 CTGCAGGCCGAGCGGCGGCTCGG + Exonic
961563412 3:127746801-127746823 CTGGAGGGAGATTGGGGGCTGGG - Intronic
962493780 3:135919493-135919515 CTGGATGCAGAGTAGAGTCTTGG + Intergenic
962629794 3:137264226-137264248 CAGGAGGCTGGGTGGAGGCTGGG - Intergenic
963085723 3:141434416-141434438 TTGTAGGGAGTGGGGAGGCTAGG + Intronic
964155630 3:153581706-153581728 CTGCAGGCAGAGTGAAGGGTAGG - Intergenic
964178286 3:153852533-153852555 GTATAGCCAGAGTTGAGGCTAGG - Intergenic
964504047 3:157379131-157379153 CTGTAAGCAACATGGAGGCTTGG - Intronic
964540242 3:157771727-157771749 CTGTAGGCAGTATGTATGCTGGG + Intergenic
965819736 3:172673109-172673131 CTATAGGAAGAGAGGAGGCCTGG - Intronic
967148042 3:186622600-186622622 CTGTAGGGAGACTGGAGAGTGGG + Intergenic
967316931 3:188158430-188158452 CTGTAGGCTGCCTGGAGGCTTGG + Intronic
968128741 3:196179645-196179667 CCGGAGGCAGAATGGAGGTTGGG - Intergenic
968226790 3:196977430-196977452 CAGTAGGCGGGGTAGAGGCTGGG - Intergenic
968234577 3:197024130-197024152 CCGGCGGCAGAGTGGAGGCGGGG + Intronic
968282862 3:197490232-197490254 ATGTGGGCAGAGGAGAGGCTGGG - Intergenic
969073316 4:4557252-4557274 CTGTTGTCAGAGTGGACTCTGGG + Intergenic
969237132 4:5873501-5873523 CTGAAGGCAAAGTGGGGGGTGGG + Intronic
969436181 4:7191000-7191022 CAGTTGGCAAAATGGAGGCTCGG + Intergenic
971148685 4:24007748-24007770 CTGGAGGCAAAGGGGAGGTTGGG + Intergenic
974325428 4:60408302-60408324 CAGTAAGCAGAGTAGAAGCTGGG - Intergenic
975694931 4:77003015-77003037 CTGCAGACAGAATGTAGGCTGGG - Intronic
975805205 4:78105157-78105179 CTGAAGGCAGAATTTAGGCTTGG + Intronic
976599920 4:86928516-86928538 CTGAAGGCAGAGTAGAGGAAGGG + Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
977193786 4:94033046-94033068 CTGGCGGCAGAGTGGAGACAAGG + Intergenic
978761654 4:112359754-112359776 CTGGAGGCAGTGTGCAGGTTGGG - Intronic
979351669 4:119650703-119650725 CTGAAGCCAGAGCAGAGGCTTGG + Intergenic
980187271 4:129478001-129478023 CTGTAGGCAAAATGGAGACATGG - Intergenic
980958222 4:139449897-139449919 TTGTAGGCAGATGGGAAGCTAGG - Intergenic
981513940 4:145587208-145587230 CTGTAGGCAGTGTGCAACCTGGG - Intergenic
981594128 4:146399991-146400013 CTGTAGACAGAGTAAAGGCCAGG + Intronic
983075184 4:163317058-163317080 ATGTAAGAAGAGTTGAGGCTTGG - Intergenic
983088309 4:163473820-163473842 CTTCAGGCAGAGGGGAGGCGAGG - Intergenic
983305600 4:165981478-165981500 CTGCAGGGAGATTGGAGGTTTGG + Intronic
986051430 5:4094096-4094118 CTGTAGGCAGAATAGAGGGGTGG + Intergenic
986397203 5:7342989-7343011 CTGTGTGCAGTGTAGAGGCTTGG + Intergenic
986551982 5:8966998-8967020 CTGTAGGAAAAGTGAAGGCAAGG + Intergenic
988113714 5:26855687-26855709 GTGGAGGCAGAGTGGTGGGTGGG + Intergenic
988682160 5:33494169-33494191 CAGGAGGGAGAGTGGAGGCCTGG + Intergenic
988759096 5:34294543-34294565 TTGTGGGCAGAATGGAGGTTTGG - Intergenic
989802378 5:45559054-45559076 CTGTAGGCTGGGTGTAGGCTGGG - Intronic
990606609 5:57416928-57416950 CTGAAGGCAGGGTGGACACTGGG + Intergenic
991639379 5:68738221-68738243 CTGCAGCCAGACTGGAGGCCGGG + Intergenic
993264924 5:85713274-85713296 GTGAAGGCAAACTGGAGGCTAGG + Intergenic
994083191 5:95731073-95731095 CTGCAGGCGGATTGGCGGCTGGG + Intronic
994745809 5:103676922-103676944 CTGGAGGGAGAGTGGGGGCTTGG + Intergenic
997310648 5:132878139-132878161 CTCTAGCCAGACTGGAGCCTGGG + Exonic
997355359 5:133259321-133259343 CTTGAGGCAGGGTGGGGGCTTGG + Intronic
997901244 5:137767128-137767150 CTGTAGTCAGAGAAGATGCTTGG - Intergenic
998016265 5:138734661-138734683 CTGGCCGCAGAGAGGAGGCTGGG - Intronic
999081145 5:148844704-148844726 GTGGAGGCAGAGTGAAGGCAGGG - Intergenic
999238376 5:150113464-150113486 CTGTGGGCGGAGTGGAGGGGAGG + Intergenic
1001486030 5:172120232-172120254 TTGTAGGCAGAGGGAAGACTCGG - Intronic
1001740714 5:174050872-174050894 TTGGGGGCAGTGTGGAGGCTTGG - Intronic
1001936891 5:175711810-175711832 CCATGGGCAGACTGGAGGCTTGG + Intergenic
1001980669 5:176035402-176035424 CTGGGGGCAGAGTGGTGGTTTGG - Intergenic
1002099357 5:176849755-176849777 GTGGAGGCAGAGTGGGGGCTGGG + Intronic
1002236793 5:177808663-177808685 CTGGGGGCAGAGTGGTGGTTTGG + Intergenic
1002578839 5:180195005-180195027 CTGCAGGCAGAGGGGAAGCATGG - Intronic
1003068202 6:2920921-2920943 CTGTGGGCAGGGAGGAGCCTTGG - Intergenic
1005309943 6:24549565-24549587 CTGAAGGTGGGGTGGAGGCTGGG - Intronic
1005879362 6:30043340-30043362 CTGTCAGCAGAGTAGAGACTTGG + Intergenic
1007239307 6:40413705-40413727 TTGAAGGCAGAGGGGAGCCTCGG - Intronic
1008905949 6:56677977-56677999 CTGTGGGCCTAGTGGAGTCTGGG - Intronic
1009842519 6:69094070-69094092 CTGTTTGCACAGTGGAGGCAAGG + Intronic
1010721014 6:79283382-79283404 CTGCAGGGAGAGTGCAGGTTTGG + Intergenic
1013486890 6:110605928-110605950 CAGAAGGCAGACTGGAGACTAGG - Intergenic
1015804104 6:137091404-137091426 CTGTGGACAGAGAGGAGGGTAGG + Intergenic
1016513857 6:144872249-144872271 CCATAGGCAGAGTGGCGGCATGG + Intergenic
1017377350 6:153786645-153786667 CTGAAGGGAGAGTGGTGGCCAGG + Intergenic
1017745705 6:157445022-157445044 ATGTAGACAGAGTCCAGGCTGGG + Intronic
1018847370 6:167564972-167564994 CTGTGGGCAGTGTGCAGGCACGG + Intergenic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1019575836 7:1737236-1737258 CTGCAGGGAAAGAGGAGGCTTGG - Intronic
1020717969 7:11701987-11702009 CTGTGGTCAGAGTTGAGGCCTGG - Intronic
1020748716 7:12111973-12111995 CTGTGCGCAGAGCTGAGGCTGGG - Intergenic
1021526376 7:21593323-21593345 GTGGTGGCAGAGTGGAAGCTTGG + Intronic
1022324005 7:29313501-29313523 CTGTAGGGAGTGTGGGGCCTCGG - Intronic
1022508615 7:30921807-30921829 TTCTAGGCAGAGTGGGGCCTGGG + Intronic
1022792584 7:33703593-33703615 CTGTATGCAGAGGGCAGGCAGGG + Intergenic
1023862335 7:44224265-44224287 GGGGAGGCAGAGTGGGGGCTGGG - Intronic
1024029096 7:45441877-45441899 CTGTAGCCAGAGTAAAGGGTTGG - Intergenic
1024117164 7:46205491-46205513 CAGAAGGCAGAGTGGAGGGAAGG - Intergenic
1024794814 7:53008046-53008068 CTGTAGGTAGCCTGGGGGCTGGG + Intergenic
1025254522 7:57374561-57374583 CAGCAGGGAGAGTGGGGGCTTGG + Intergenic
1025784010 7:64627636-64627658 CTATAGGCAGAGCACAGGCTGGG - Intergenic
1026170978 7:67953623-67953645 CTCTAAAGAGAGTGGAGGCTGGG + Intergenic
1026302024 7:69106440-69106462 CTGTAGGCAGAGCAGCGGCATGG + Intergenic
1028484524 7:91343436-91343458 CTGAAGTCATAGGGGAGGCTGGG - Intergenic
1029123769 7:98284160-98284182 CACCAGGCAGGGTGGAGGCTGGG + Intronic
1029296410 7:99543697-99543719 CTCTGGGCAGAGGGAAGGCTTGG + Intergenic
1029419971 7:100467353-100467375 CAGTAGCCAGACTAGAGGCTGGG + Intronic
1029463695 7:100711736-100711758 CTGAAGGAAGAGTGGGGCCTGGG + Intergenic
1029571265 7:101371160-101371182 GTGTAGGTAGGGTAGAGGCTGGG + Intronic
1031056502 7:116998086-116998108 ATGGAGGCAGGGGGGAGGCTCGG + Intronic
1031981603 7:128130526-128130548 CTGGAGTCAGGGTGGAGGTTAGG + Intergenic
1032021080 7:128407362-128407384 CTGTGTGCAGAGGGGAGGCTGGG + Intronic
1032510026 7:132465191-132465213 CACCAGGCAGTGTGGAGGCTGGG + Intronic
1033340028 7:140484724-140484746 TTGTAGGCAGAGTAAAGGCTTGG + Intergenic
1035079577 7:156204769-156204791 CTGAAGGCAGACTGGGGTCTGGG - Intergenic
1036437228 8:8745776-8745798 CTGTTGGGAGAGTGTAAGCTTGG - Intergenic
1036516694 8:9450866-9450888 TGGTAGGCAGGGTGGAGGCAAGG + Intergenic
1037459884 8:19098209-19098231 TTGAAGGAAGAGTGCAGGCTGGG - Intergenic
1037831220 8:22190776-22190798 TTAGAGGCAGAGTGGAGGCCAGG - Intronic
1037908471 8:22729208-22729230 CTGTAGGGAGAGTGGCTGCTAGG - Intronic
1038033344 8:23663781-23663803 CAGGAGTCAGAGTGGAGACTTGG + Intergenic
1039067662 8:33623076-33623098 CCATAGGCAGAGTGGCAGCTTGG + Intergenic
1040685005 8:49861180-49861202 CTGTAGGCAGGGATGAGTCTTGG - Intergenic
1040973794 8:53167552-53167574 CTGGAGGTGGAGTGGAGGATTGG + Intergenic
1041653294 8:60322518-60322540 CTGTAGACAAAGTGTGGGCTTGG + Intergenic
1042553469 8:70014656-70014678 GTGTTGGCAGAGTGGAGGTGGGG + Intergenic
1043456576 8:80418037-80418059 GAGTAGGCAGAGCGGAGACTGGG + Intergenic
1044469305 8:92547703-92547725 CTGCAGGGAGTGGGGAGGCTGGG - Intergenic
1044587021 8:93877516-93877538 CTGTCAATAGAGTGGAGGCTAGG + Intronic
1045186262 8:99841648-99841670 CAGTAGGCAGAAGGTAGGCTGGG - Intronic
1045274108 8:100686487-100686509 CTGTAGGGGGTTTGGAGGCTTGG + Intronic
1045395584 8:101757739-101757761 ATGAAGGTAGAGTGGAGGCAAGG - Intronic
1045599260 8:103694304-103694326 CTGAAGGAAGCCTGGAGGCTAGG + Intronic
1047670131 8:127137010-127137032 CCAGACGCAGAGTGGAGGCTCGG + Intergenic
1048004989 8:130411912-130411934 CTTTGGACAGGGTGGAGGCTGGG - Intronic
1049367843 8:142249298-142249320 CTGTGGGCAGAGGGTGGGCTGGG + Intronic
1050141979 9:2525463-2525485 CTGTAGGCAGAGCAGTGGCATGG - Intergenic
1051514018 9:17908351-17908373 CTGGAGGGAGAGGGGAGGCTGGG + Intergenic
1052233947 9:26188329-26188351 CTGGGGGCAGACTGGAGCCTGGG - Intergenic
1052340744 9:27361980-27362002 CTGTAGCCAGTGTGGAGGGTAGG - Intronic
1052455382 9:28690278-28690300 CTGTAATCAGAGTGTGGGCTGGG - Intergenic
1052549223 9:29926698-29926720 TTGTAGGCAGAGGACAGGCTGGG - Intergenic
1054909251 9:70438828-70438850 CCGTAGAGAGAGGGGAGGCTGGG + Intergenic
1057733125 9:97629198-97629220 CTGTAGGCAGAGTTGTGAATTGG - Intronic
1058858763 9:109093475-109093497 CTGCAGGCTGAGTGGAGGGCTGG + Exonic
1060119579 9:120975637-120975659 GAGAAGGCAGAGTGGAGGGTTGG - Intronic
1060520781 9:124292768-124292790 CAGTTGGCAGAGGAGAGGCTGGG - Intronic
1060806870 9:126583229-126583251 CGGTGGGCAGAGGGGAGGCGGGG + Intergenic
1061294466 9:129669444-129669466 CTGTGGGCAGAGTGGAAACGGGG + Intronic
1061326465 9:129867625-129867647 CTGTAGGGAGAAAGGTGGCTCGG + Intronic
1061334316 9:129921335-129921357 CTGTAGTCCTAGCGGAGGCTGGG - Intronic
1061825978 9:133258445-133258467 CTGTGGGCAGAGAGGAGGCTGGG + Intronic
1061869191 9:133511170-133511192 CTGTCGGGAGGGTCGAGGCTGGG + Intergenic
1061949863 9:133930215-133930237 CGGGAGGCAGAGAGGAGGCCAGG - Intronic
1061949878 9:133930273-133930295 CAGGAGGCAGGGTGGAGGCAGGG - Intronic
1061949925 9:133930464-133930486 CGGGAGGCAGAGAGGAGGCCGGG - Intronic
1062043285 9:134413931-134413953 GAGGAGGCAGAGTGGAGGCACGG - Intronic
1062310545 9:135933546-135933568 CTGTGGGCTGAGTGGGGGCGTGG - Intronic
1062622258 9:137428418-137428440 CTGGGGGCACAGTGGAGGGTGGG - Intronic
1186507308 X:10103375-10103397 CTGTAGACAGATGGAAGGCTAGG + Intronic
1189670939 X:43408016-43408038 TGGTAGGAAGAGTGGAGGCTGGG + Intergenic
1190325515 X:49204844-49204866 CTGGAGGCAGAGTGGAGGAGGGG - Intergenic
1192771305 X:74195214-74195236 CTGGAGTGAGACTGGAGGCTAGG + Intergenic
1193290198 X:79763861-79763883 CTGTTGTCAGAGAGGATGCTTGG + Intergenic
1194021539 X:88697256-88697278 CTGTTGGCAGGTTGGGGGCTAGG + Intergenic
1194220694 X:91186285-91186307 CTGTAGGGAGCGTTGAGGATTGG + Intergenic
1195364973 X:104116626-104116648 TTGTAGGGGGAGTGGAGGTTAGG + Intronic
1196184966 X:112736287-112736309 CTGGTAGCAGAGTGGAGGATAGG - Intergenic
1197764575 X:130051465-130051487 CTGCAGGCAGTGAGGTGGCTTGG + Intronic
1197942113 X:131801428-131801450 CTGAAGGCACTGTGGAGGCTGGG + Intergenic
1198730546 X:139723235-139723257 TGGAAGGCAGACTGGAGGCTTGG + Intergenic
1199613386 X:149636038-149636060 CTGTAGGCAGAGTGGGGTGGTGG - Intergenic
1199996703 X:153030592-153030614 CTGGAGGCAGTGGGGAGGCCAGG + Intergenic
1200067312 X:153510024-153510046 GTGTAGGCAGAGCCGAGCCTGGG + Intergenic
1200557201 Y:4650037-4650059 CTGTAGGGAGCGTTGAGGATTGG + Intergenic