ID: 1127117582

View in Genome Browser
Species Human (GRCh38)
Location 15:55743186-55743208
Sequence GTGGACAGCGCCGCGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127117568_1127117582 27 Left 1127117568 15:55743136-55743158 CCGGCTGGGGGCGGAGTGAGGCG 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1127117582 15:55743186-55743208 GTGGACAGCGCCGCGGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127117582 Original CRISPR GTGGACAGCGCCGCGGCCGC GGG Intergenic
No off target data available for this crispr