ID: 1127118965

View in Genome Browser
Species Human (GRCh38)
Location 15:55754790-55754812
Sequence TGCTTTGCACACAGCAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127118960_1127118965 27 Left 1127118960 15:55754740-55754762 CCTCAAATAGTGCACCATGCCTC No data
Right 1127118965 15:55754790-55754812 TGCTTTGCACACAGCAGATGAGG No data
1127118963_1127118965 0 Left 1127118963 15:55754767-55754789 CCTTTACATAGCACCTAGCAAAG No data
Right 1127118965 15:55754790-55754812 TGCTTTGCACACAGCAGATGAGG No data
1127118961_1127118965 13 Left 1127118961 15:55754754-55754776 CCATGCCTCAACACCTTTACATA No data
Right 1127118965 15:55754790-55754812 TGCTTTGCACACAGCAGATGAGG No data
1127118962_1127118965 8 Left 1127118962 15:55754759-55754781 CCTCAACACCTTTACATAGCACC No data
Right 1127118965 15:55754790-55754812 TGCTTTGCACACAGCAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127118965 Original CRISPR TGCTTTGCACACAGCAGATG AGG Intergenic
No off target data available for this crispr