ID: 1127123498

View in Genome Browser
Species Human (GRCh38)
Location 15:55790914-55790936
Sequence TAGGAACATAAGCTCCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127123498_1127123503 3 Left 1127123498 15:55790914-55790936 CCCCCATGGAGCTTATGTTCCTA No data
Right 1127123503 15:55790940-55790962 ATGAGTCTGAATGTCATGTCCGG No data
1127123498_1127123506 14 Left 1127123498 15:55790914-55790936 CCCCCATGGAGCTTATGTTCCTA No data
Right 1127123506 15:55790951-55790973 TGTCATGTCCGGGATGAGTTGGG No data
1127123498_1127123504 4 Left 1127123498 15:55790914-55790936 CCCCCATGGAGCTTATGTTCCTA No data
Right 1127123504 15:55790941-55790963 TGAGTCTGAATGTCATGTCCGGG No data
1127123498_1127123508 20 Left 1127123498 15:55790914-55790936 CCCCCATGGAGCTTATGTTCCTA No data
Right 1127123508 15:55790957-55790979 GTCCGGGATGAGTTGGGAGTGGG No data
1127123498_1127123505 13 Left 1127123498 15:55790914-55790936 CCCCCATGGAGCTTATGTTCCTA No data
Right 1127123505 15:55790950-55790972 ATGTCATGTCCGGGATGAGTTGG No data
1127123498_1127123507 19 Left 1127123498 15:55790914-55790936 CCCCCATGGAGCTTATGTTCCTA No data
Right 1127123507 15:55790956-55790978 TGTCCGGGATGAGTTGGGAGTGG No data
1127123498_1127123510 23 Left 1127123498 15:55790914-55790936 CCCCCATGGAGCTTATGTTCCTA No data
Right 1127123510 15:55790960-55790982 CGGGATGAGTTGGGAGTGGGAGG No data
1127123498_1127123511 28 Left 1127123498 15:55790914-55790936 CCCCCATGGAGCTTATGTTCCTA No data
Right 1127123511 15:55790965-55790987 TGAGTTGGGAGTGGGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127123498 Original CRISPR TAGGAACATAAGCTCCATGG GGG (reversed) Intergenic