ID: 1127126661

View in Genome Browser
Species Human (GRCh38)
Location 15:55818920-55818942
Sequence AGGGAGAAGCACAATGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127126661_1127126664 -7 Left 1127126661 15:55818920-55818942 CCATTTTCATTGTGCTTCTCCCT No data
Right 1127126664 15:55818936-55818958 TCTCCCTCCCCAGGGCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127126661 Original CRISPR AGGGAGAAGCACAATGAAAA TGG (reversed) Intergenic
No off target data available for this crispr