ID: 1127126664

View in Genome Browser
Species Human (GRCh38)
Location 15:55818936-55818958
Sequence TCTCCCTCCCCAGGGCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127126658_1127126664 20 Left 1127126658 15:55818893-55818915 CCAGCACTCTTCCAAGGGCCTCA No data
Right 1127126664 15:55818936-55818958 TCTCCCTCCCCAGGGCCACCTGG No data
1127126661_1127126664 -7 Left 1127126661 15:55818920-55818942 CCATTTTCATTGTGCTTCTCCCT No data
Right 1127126664 15:55818936-55818958 TCTCCCTCCCCAGGGCCACCTGG No data
1127126660_1127126664 2 Left 1127126660 15:55818911-55818933 CCTCAGAGTCCATTTTCATTGTG No data
Right 1127126664 15:55818936-55818958 TCTCCCTCCCCAGGGCCACCTGG No data
1127126659_1127126664 9 Left 1127126659 15:55818904-55818926 CCAAGGGCCTCAGAGTCCATTTT No data
Right 1127126664 15:55818936-55818958 TCTCCCTCCCCAGGGCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127126664 Original CRISPR TCTCCCTCCCCAGGGCCACC TGG Intergenic
No off target data available for this crispr