ID: 1127127602

View in Genome Browser
Species Human (GRCh38)
Location 15:55827382-55827404
Sequence GCCCCTAGTGGGAGATGAAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127127602 Original CRISPR GCCCCTAGTGGGAGATGAAG GGG Exonic
900390343 1:2431177-2431199 GCCCCCAGGGGGAGCAGAAGCGG - Intronic
901626828 1:10629512-10629534 CCTCCTAGAGGGAGAAGAAGGGG - Exonic
902755532 1:18546964-18546986 ACCCCAAGAGGGAGAAGAAGAGG + Intergenic
903212742 1:21827986-21828008 GCCCCAAGACAGAGATGAAGTGG + Intronic
903264496 1:22149521-22149543 GCCACAACTGGGAGATAAAGGGG - Intergenic
903402721 1:23068313-23068335 GGCAGTAGTGGGAGAAGAAGAGG + Intronic
904825809 1:33273040-33273062 GGCCCTGGTGAGAGGTGAAGGGG - Intronic
906718751 1:47990312-47990334 TCCCCTAGAGGGAGAAGTAGTGG + Intronic
907668433 1:56453079-56453101 GCCCCCAGGGGGAAAGGAAGAGG - Intergenic
912381489 1:109250160-109250182 GCCACTATTGGGAGACCAAGTGG + Exonic
913666915 1:121057267-121057289 GCTCCTAGTGGGAGGAGCAGGGG + Intergenic
914657214 1:149752894-149752916 GCTCCTAGTGGGAGGAGCAGGGG + Intergenic
914753918 1:150552641-150552663 GAGCCTAGGGGGAGATGAAAGGG - Intronic
914875970 1:151512896-151512918 TCCCCTTGTGGGAGGTGATGGGG + Intronic
915319424 1:155048049-155048071 GCCCCCAGCGAGAGAAGAAGCGG + Exonic
915532522 1:156510966-156510988 GCCCTTAGTGAGAGAGGGAGAGG - Intergenic
915558096 1:156670974-156670996 GCCCCTGGTGGAAGATGATGTGG - Exonic
919384114 1:196897570-196897592 GCCCGAAGTGGGGGATGGAGTGG + Intronic
920065536 1:203266795-203266817 GCCCCTTCTGGGAGATGGGGGGG - Intronic
920624273 1:207580564-207580586 GCCCCAAGCTGGAGATTAAGTGG - Exonic
920626965 1:207611992-207612014 GCCCCAAGCTGGAGATTAAGTGG - Exonic
920636909 1:207712817-207712839 GCCCCAAGCTGGAGATTAAGTGG - Intronic
920784222 1:209025348-209025370 CTCTCTAGTGGGAGATAAAGAGG - Intergenic
1063432706 10:6005103-6005125 GCTCCTGGTGGGAGGTGAAGGGG + Intergenic
1064609018 10:17077756-17077778 GCCCCCAGTGAGAGAATAAGGGG + Intronic
1067162879 10:43842284-43842306 GGCCACAGTGGGAGGTGAAGAGG + Intergenic
1067660363 10:48232854-48232876 GGCTGTGGTGGGAGATGAAGAGG - Intronic
1069898664 10:71694765-71694787 GCCCTCTGTGGGAGAGGAAGCGG + Intronic
1073796864 10:106997894-106997916 TCCCCTAGTGGGAGGTGCATGGG + Intronic
1077668756 11:4137996-4138018 GCCCCTACTGGGAAGTGAGGAGG - Intronic
1078903977 11:15667218-15667240 GATCCAAGTGGGAGATGAGGTGG - Intergenic
1079258523 11:18853630-18853652 TCCCCTAGTGAGAGAGGAAAGGG + Intergenic
1080816985 11:35767914-35767936 GCCCCAAGTGGCAGCTGCAGTGG + Intronic
1081286371 11:41274938-41274960 GGCCCTACTGGGAGATGTATGGG + Intronic
1081807014 11:45896369-45896391 GTGCCAGGTGGGAGATGAAGGGG - Intronic
1082678886 11:56144001-56144023 GCCCCTACTGGGAAGTGAGGAGG + Intergenic
1083159619 11:60847039-60847061 TCCCCCAGTTGGAGATGAAGTGG - Intronic
1083853811 11:65382337-65382359 GCCCCTTGGTGGAGATGAATGGG - Intronic
1083857742 11:65401399-65401421 GACCCAAGTGGGAGAGGGAGGGG - Intronic
1084550848 11:69840856-69840878 GCTCCTAGTGCCAGATGAAAAGG + Intergenic
1086414561 11:86575894-86575916 GCCCTTAGTGGTTGATAAAGTGG + Intronic
1088378658 11:109169411-109169433 GAGCCCAGTGAGAGATGAAGAGG - Intergenic
1089330245 11:117684292-117684314 GCCACTGGTGGGAGGTGAGGTGG - Intronic
1090888279 11:130898602-130898624 GCCTCTTGTGGGAGATGCAGGGG + Intronic
1093641102 12:21527734-21527756 GGCTCTGGTCGGAGATGAAGCGG - Exonic
1096513396 12:52144083-52144105 GCCTCCAGTGGGTGATGAGGTGG - Intergenic
1096812256 12:54178574-54178596 ACCCATAGAAGGAGATGAAGGGG - Intronic
1100653807 12:96618821-96618843 TCCCCAAATGGGAGAAGAAGGGG - Intronic
1101777215 12:107806060-107806082 GCCCCTCGTGGGAACTGACGAGG - Intergenic
1106624830 13:31409904-31409926 GCACCTAGTGGGGAATCAAGAGG + Intergenic
1107338775 13:39383886-39383908 ACCCTTAGTGGGTGATGAGGAGG - Intronic
1107694498 13:42986975-42986997 GCATCTTTTGGGAGATGAAGGGG - Intronic
1108827545 13:54432918-54432940 TGCCCTAATGGGAAATGAAGGGG - Intergenic
1113662061 13:112114518-112114540 GCCCGTAGTGGGGCAGGAAGCGG - Intergenic
1113915293 13:113867147-113867169 GCCCCTACTGGGAAGTGAGGAGG + Intergenic
1114562184 14:23601331-23601353 GTCCTTGGTGGGAGATGAACTGG + Intergenic
1114684846 14:24518960-24518982 GCCCCTACTGTGAGAAGCAGTGG + Intergenic
1115643045 14:35347561-35347583 GAGCCTAGTGGGAGATCAAAGGG + Intergenic
1117601733 14:57382755-57382777 TCCCCTATTGTTAGATGAAGAGG - Intergenic
1121150459 14:91628664-91628686 GGCCATGGTGGAAGATGAAGGGG - Intronic
1123720814 15:23060624-23060646 ACCCCTGGTGGAAGGTGAAGGGG + Intergenic
1123739810 15:23225887-23225909 GCAGCTCCTGGGAGATGAAGCGG + Intergenic
1124291035 15:28454860-28454882 GCAGCTCCTGGGAGATGAAGCGG + Intergenic
1125493267 15:40165062-40165084 GTCCCTGGAGGGAGATGAATGGG + Exonic
1127127602 15:55827382-55827404 GCCCCTAGTGGGAGATGAAGGGG + Exonic
1127377962 15:58402343-58402365 GCCCATGCTGGGACATGAAGAGG + Intronic
1128789862 15:70425215-70425237 GGGCCTGGTGGGAGATGAATGGG - Intergenic
1130424951 15:83787618-83787640 GCCCCTGGTGGGTGAGGAAATGG - Intronic
1131952377 15:97694725-97694747 GCCCCTAGAGGGAGAGGCAAGGG - Intergenic
1131973644 15:97918910-97918932 GCCCCAATTTGGAGATGAAGAGG + Intergenic
1133547871 16:6825691-6825713 GAACCTAGTAGCAGATGAAGAGG + Intronic
1136707727 16:32202783-32202805 GCAGCTCCTGGGAGATGAAGCGG - Intergenic
1136760181 16:32726628-32726650 GCAGCTCCTGGGAGATGAAGCGG + Intergenic
1136807923 16:33143758-33143780 GCAGCTCCTGGGAGATGAAGCGG - Intergenic
1138404188 16:56775741-56775763 GCCCCTATTTTGAGATGAGGAGG + Intronic
1138726057 16:59140552-59140574 GGCCCTAGTGGGAGATGCCTGGG + Intergenic
1139543671 16:67637773-67637795 GCCCGCAGAGGGAGAGGAAGAGG + Exonic
1140041374 16:71410450-71410472 GATCCTGGTTGGAGATGAAGAGG - Intergenic
1141683739 16:85558410-85558432 GCCTCCAGTGGCAGGTGAAGAGG - Intergenic
1203062336 16_KI270728v1_random:986950-986972 GCAGCTCCTGGGAGATGAAGCGG + Intergenic
1144719629 17:17459674-17459696 GCCTCCAGAGGGTGATGAAGGGG - Intergenic
1146726891 17:35163778-35163800 GCCCCTAGAGGGAGGTGAATTGG + Intronic
1147690633 17:42312630-42312652 GCCCCAAGAGGGAGGTGCAGGGG + Intergenic
1148225486 17:45895696-45895718 GACCCTGGTGGGCGAGGAAGGGG + Intronic
1148859268 17:50595613-50595635 GACCCAAGTGGGTGATGAAGGGG - Intronic
1149329602 17:55567524-55567546 GCCCCAAGTGGGAAATGGGGTGG + Intergenic
1150506901 17:65708297-65708319 TCCCTTAGTGGGAGATCAAATGG - Intronic
1153327177 18:3832814-3832836 GGCCCTTGTGGGGGATGCAGGGG + Intronic
1160023394 18:75198895-75198917 GCCTCTAATGGGAGGTGAAACGG - Exonic
1160436342 18:78855500-78855522 TCCCCCAGTGGGTGATGATGGGG - Intergenic
1160436353 18:78855549-78855571 TCCCCCAGTGGGTGATGATGGGG - Intergenic
1160436377 18:78855647-78855669 TCCCCCAGTGGGTGATGATGGGG - Intergenic
1160912794 19:1482554-1482576 GCCCCGCGTGGGAGCTGAAGGGG - Intronic
1164590293 19:29503136-29503158 GCCCCTGATGGGAAATGGAGTGG + Intergenic
1166364220 19:42270321-42270343 GCCCCTAGTGAGAGAGCATGAGG + Intronic
1167367802 19:49064121-49064143 GCCCCATCTGGGAGATGAATGGG - Intronic
925451929 2:3976326-3976348 TGCCCTAATGGGAGATGAAGGGG - Intergenic
925651105 2:6090270-6090292 GATCATAGTGGAAGATGAAGGGG + Intergenic
927155321 2:20217919-20217941 GCTCCTTGTGGGAGCTGGAGTGG - Intronic
927197963 2:20560964-20560986 GCCCCTTGTGGGGACTGAAGAGG - Intronic
927704874 2:25290842-25290864 GCTCCCAGTGGGAAAGGAAGAGG - Intronic
931182553 2:59917333-59917355 GCCCCCAGGAGGAGAAGAAGGGG + Intergenic
931714828 2:65020893-65020915 GTCCCTGGTGGGAAAAGAAGAGG - Exonic
932002204 2:67895418-67895440 GCACCTAGTGGGAGGAGAGGAGG + Intergenic
932676751 2:73788279-73788301 GCCCCTTGTAGGAAATGATGTGG - Intronic
932677336 2:73793176-73793198 GCCCCTTGTAGGAAATGATGTGG - Intronic
932677921 2:73798074-73798096 GCCCCTTGTAGGAAATGATGTGG - Intronic
932678508 2:73802974-73802996 GCCCCTTGTAGGAAATGATGTGG - Intronic
932679092 2:73807874-73807896 GCCCCTTGTAGGAAATGATGTGG - Intronic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
935663369 2:105488670-105488692 GGACCAAGTGGGAGAAGAAGGGG - Intergenic
938122447 2:128643544-128643566 GGCCCTAATGGGAGCAGAAGAGG - Intergenic
942080750 2:172397382-172397404 GCCAGAAGTGGGAGATAAAGGGG + Intergenic
942165196 2:173234515-173234537 GGCCATGGTGGGAGATGGAGAGG + Intronic
943128628 2:183828263-183828285 GTCCCGAGTGGGAGAGGATGGGG - Intergenic
944792396 2:203144302-203144324 TCCCACAGTGAGAGATGAAGAGG - Intronic
945571889 2:211478545-211478567 GCCTCTAATTGGAAATGAAGTGG - Intronic
947827157 2:233114294-233114316 GCCCCACGTGGGTGAAGAAGTGG - Intronic
948201949 2:236135921-236135943 TCCCCTGGTGGGAGAGGAGGGGG - Intergenic
1173340369 20:42147760-42147782 TCCCTTAGTGGGGGCTGAAGGGG + Intronic
1173353019 20:42262258-42262280 GCTCTTAGTGGGAGGTGAGGAGG + Intronic
1173867705 20:46323130-46323152 GCCCCAAGTGGGAGCTGATGAGG + Intergenic
1179656575 21:42849694-42849716 GCTCCTAGAGGAAGATGCAGCGG + Exonic
1180704816 22:17802798-17802820 GCCTCCACGGGGAGATGAAGGGG + Intronic
1182159336 22:28105946-28105968 GCCCTTAGAGTGAGATGCAGAGG + Intronic
1182737013 22:32537980-32538002 GGCCATAGTAGGAGCTGAAGGGG - Intronic
949562539 3:5215645-5215667 GCACCTAGTGGGAGAGGCAAGGG + Intronic
949888137 3:8712451-8712473 GCCCCTGCTGGGAACTGAAGCGG - Intronic
949969008 3:9386388-9386410 GCCCTTAGTGGGGGGTGGAGTGG - Exonic
961165791 3:124762883-124762905 GCCCCCAGTGGGGATTGAAGCGG - Exonic
961870523 3:129984437-129984459 GGCCCTAGAGGGAGATGGTGGGG + Intergenic
965878261 3:173354750-173354772 TACCCTAGTAGGAAATGAAGGGG - Intergenic
967836514 3:193968753-193968775 GGGCCTAGTGGGAGGTGAGGTGG - Intergenic
967836522 3:193968775-193968797 GGGCCTAGTGGGAGGTGAGGTGG - Intergenic
973563548 4:52161654-52161676 GCTCCTTGTGTGAGATTAAGAGG - Intergenic
974550223 4:63362863-63362885 GCCGGAAGGGGGAGATGAAGTGG + Intergenic
977937788 4:102826858-102826880 GACCCGGGTGGGAGAGGAAGAGG + Intronic
979287926 4:118947571-118947593 GCCCCGACAGGGAGAGGAAGAGG - Intronic
982082246 4:151801782-151801804 GCCCCTAGTGGCAGAAGAGAAGG + Intergenic
988249310 5:28734742-28734764 GATCATAGTGGAAGATGAAGGGG - Intergenic
988580291 5:32462838-32462860 GCCCCTCCTGGTAGAAGAAGAGG - Intergenic
992776059 5:80090314-80090336 TCCCCTGGTGGAAGATGGAGGGG - Intergenic
994355033 5:98785234-98785256 GCCCACTGTGGGAGATGTAGAGG + Intronic
997779763 5:136644773-136644795 GCTCATGGTGGAAGATGAAGGGG - Intergenic
1000636465 5:163649616-163649638 TGCCCCAGTGGGAAATGAAGGGG + Intergenic
1001887946 5:175312717-175312739 GGCCCAGGTGAGAGATGAAGTGG - Intergenic
1002717191 5:181234913-181234935 GCTCCTAGAGGGAGAAGCAGGGG - Exonic
1006613849 6:35311785-35311807 TTCCCTTGTGGGAGAGGAAGGGG - Intronic
1006735745 6:36271180-36271202 GCCCAGAGTGGGAGAAGAATAGG + Intronic
1006971594 6:38050963-38050985 GACCCTGGTAGGAGATGATGAGG + Intronic
1007116575 6:39347455-39347477 GCTCCTCTTGGGAGGTGAAGAGG + Intronic
1007794499 6:44336919-44336941 GCTCCAAGTTGGAGACGAAGAGG - Intronic
1013311234 6:108895827-108895849 ACCCCTAGAGGGAGAGGAGGAGG + Intronic
1014892558 6:126860642-126860664 GCCACTAATGGGACATGAGGAGG - Intergenic
1018654287 6:166019154-166019176 TGCCCTAATGGGAAATGAAGGGG + Intergenic
1019669290 7:2268793-2268815 GCCCCTACTGGGAAGTGAGGAGG + Intronic
1019896996 7:3990335-3990357 GGCCCGAGTGGGAGTTGCAGAGG - Intronic
1020470301 7:8527113-8527135 GCCACTAATGAGAGAGGAAGAGG - Intronic
1024213306 7:47225985-47226007 TGGCCTAGTGGGAGAGGAAGTGG - Intergenic
1024656811 7:51458010-51458032 GCCCCCAGTGGGAGATGGGATGG - Intergenic
1024927553 7:54633355-54633377 TCCTATAGTGGGAAATGAAGTGG - Intergenic
1026978977 7:74515670-74515692 GCCCATAGTGGGACAGGAGGGGG - Intronic
1027472033 7:78585525-78585547 GCACCTAGTGAAAGAAGAAGGGG + Intronic
1028241089 7:88421587-88421609 GACCATAGTGGTAGATTAAGAGG + Intergenic
1028607112 7:92667003-92667025 CCTCCTAGTGGGACAAGAAGTGG + Intronic
1028744738 7:94315158-94315180 AGCCCCAGTGGAAGATGAAGAGG - Intergenic
1030764804 7:113395668-113395690 GTCCCTGGTGGGAGGTGATGGGG + Intergenic
1036558924 8:9884846-9884868 GCCCCCAGAGGCACATGAAGTGG - Intergenic
1036749451 8:11434699-11434721 GCCCCTAGTGGCAGATCTAGGGG - Intronic
1044794011 8:95878066-95878088 GGGCCTATTGGTAGATGAAGAGG + Intergenic
1044932244 8:97261248-97261270 GCCACTACTGACAGATGAAGGGG - Intergenic
1046115502 8:109778953-109778975 GCCCCATGTGGAAGATGAGGAGG - Intergenic
1051161049 9:14207634-14207656 GACTTTGGTGGGAGATGAAGAGG - Intronic
1053308400 9:37000109-37000131 GGCCCTAGGGGGAGGTAAAGAGG - Intronic
1055257053 9:74384183-74384205 GCCCCTACTGAGAGAAGAAAGGG - Intergenic
1056426960 9:86487293-86487315 GCACCTGGTGGGAGGTGAGGGGG - Intergenic
1056683894 9:88743874-88743896 GCTGTTAGTGGGAGATGACGCGG + Intergenic
1056833221 9:89933238-89933260 GCCCCCAGTAGGAGGTGAAGAGG + Intergenic
1056843312 9:90016365-90016387 CCTCCTAGTGGGAGAGGAATGGG + Intergenic
1059440762 9:114305616-114305638 GCCACGTGTGGGAGAGGAAGAGG - Intronic
1059516825 9:114903539-114903561 TGCCCTAATGGGAAATGAAGGGG - Exonic
1060202268 9:121658240-121658262 GCCCCGAGAGGGAGGTGCAGGGG - Intronic
1062065703 9:134525143-134525165 GCCCCTCGCAGGAGATGACGTGG - Intergenic
1062232206 9:135487813-135487835 GCCCCAGGTGGGGGCTGAAGAGG - Exonic
1062498438 9:136842427-136842449 GCCCCTGATGGCAGCTGAAGGGG - Intronic
1062540393 9:137039404-137039426 GCCCCAAATGGGAGATGAGGCGG + Intergenic
1185596685 X:1311333-1311355 ACTCCTGGTGGGAGAGGAAGGGG - Intergenic
1186477744 X:9871430-9871452 GCCCCAAGAGGGAGACCAAGGGG - Intronic
1190491678 X:50988945-50988967 TCTCCAAGTGGGGGATGAAGGGG - Intergenic
1191678074 X:63812452-63812474 GAACCTAGTGGGAGATGTATGGG + Intergenic
1194714650 X:97275424-97275446 GCCCCGTCTGGGAGGTGAAGGGG - Intronic
1200107817 X:153724524-153724546 GCTCCGAGCGGGAGAGGAAGAGG + Intronic
1200366934 X:155676483-155676505 GACCTTAGTGGCAAATGAAGTGG + Intergenic