ID: 1127131848

View in Genome Browser
Species Human (GRCh38)
Location 15:55874273-55874295
Sequence CCAAACAAGCAGAAACTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 7, 3: 31, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127131848 Original CRISPR CCAAACAAGCAGAAACTGGA GGG Intronic
901219596 1:7575888-7575910 CCAGGGAAGCAGGAACTGGAGGG - Intronic
903957480 1:27035330-27035352 CCAGACACGCAGAGACTGGGAGG - Intergenic
904936601 1:34134098-34134120 CCAAACAGGCAGAAATAGGAGGG + Intronic
908167022 1:61468736-61468758 CCAAAGAGGCAGAACGTGGATGG - Intergenic
908270417 1:62416620-62416642 ACAAACAAACAAACACTGGAAGG - Intergenic
909301492 1:74018332-74018354 CCAACCAGGCAGAAACTAAATGG - Intergenic
910242522 1:85103041-85103063 CCAAACAATCACAAACCTGATGG - Intronic
911658461 1:100473001-100473023 TTAAACAAGGAGAAAGTGGAAGG - Intronic
912114670 1:106390591-106390613 CAAAACAAGCAAAAGATGGATGG + Intergenic
912696131 1:111843484-111843506 CCAAAGAAGCAGAAACAGTCAGG - Intronic
915282426 1:154831669-154831691 AAAATCAAGCAGAGACTGGATGG - Intronic
916865276 1:168849850-168849872 CCAAAAAGGCAGGAAATGGATGG - Intergenic
917568842 1:176242204-176242226 GCAAGCAAGAAGAAAGTGGAAGG - Intergenic
920196747 1:204232909-204232931 CCCAACAAGGAGAAATTGGAAGG - Intronic
921705500 1:218318165-218318187 CTAAACAAACAAAAACTAGATGG - Intronic
923061896 1:230483463-230483485 AGAAAACAGCAGAAACTGGAAGG + Intergenic
1064846772 10:19664003-19664025 ACAAACAAGCAAAAACAAGAGGG + Intronic
1065158999 10:22899753-22899775 ACAAAGTAGCATAAACTGGATGG - Intergenic
1066299021 10:34080579-34080601 CCAAAGAAGCAGGAACTAAAAGG + Intergenic
1066354735 10:34671634-34671656 CAAGAAAAGCAGAAACTGAAAGG + Intronic
1067479264 10:46584697-46584719 GTATGCAAGCAGAAACTGGATGG - Intronic
1067615475 10:47757104-47757126 GTATGCAAGCAGAAACTGGATGG + Intergenic
1067901263 10:50244087-50244109 GCAAAGAAGCAGGAGCTGGAGGG + Intronic
1068396799 10:56472564-56472586 TAAAGCAGGCAGAAACTGGAGGG + Intergenic
1069955724 10:72050192-72050214 CAAGACAAGCAGAAACTGGTGGG + Intergenic
1070518559 10:77230725-77230747 CCAAAGAGGCAGGAACTGGGAGG - Intronic
1071349680 10:84727601-84727623 CCAAGGAAGCTGAAACTGGGTGG + Intergenic
1072547650 10:96452323-96452345 ACAAACAAACAAAAACTGCAAGG + Intronic
1073435294 10:103512633-103512655 CCAAACAAACATAAAAAGGACGG + Intronic
1073564866 10:104526436-104526458 GCAAATGAGCAGAGACTGGATGG - Intergenic
1074089457 10:110235050-110235072 TCTAAGAAGCAGAAATTGGATGG - Intronic
1074953617 10:118365449-118365471 CCAAGCAGGCAGACAATGGAGGG + Intergenic
1075198173 10:120379005-120379027 GAAGACAGGCAGAAACTGGAGGG - Intergenic
1075374793 10:121970174-121970196 CCAAAAAAGCAAAACCTGGCTGG + Intronic
1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG + Intronic
1077983655 11:7328791-7328813 CCAAACAAGTAAAAACTGAGAGG - Intronic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079397529 11:20078224-20078246 TCAGGCAAGCAGGAACTGGAAGG + Intronic
1081552117 11:44123301-44123323 ACAAACAAACAAAAAATGGATGG + Intronic
1081625376 11:44652193-44652215 CCAAACAGGCAGACTGTGGAAGG + Intergenic
1083774575 11:64888127-64888149 GCAAAGATGCAGAAACCGGACGG - Intronic
1085879839 11:80453637-80453659 ACAAATTAGCACAAACTGGATGG + Intergenic
1086431996 11:86745061-86745083 CAAAAACATCAGAAACTGGATGG + Intergenic
1087225351 11:95592600-95592622 CCGCACAAGAAGAATCTGGATGG - Intergenic
1089524487 11:119088036-119088058 CCAGAGAAGCAGAGACTAGAGGG - Intronic
1089944151 11:122450410-122450432 ACAAACTATCACAAACTGGAGGG - Intergenic
1089960186 11:122610277-122610299 CAAGACATGCAGAAACAGGAGGG + Intergenic
1090167347 11:124563830-124563852 CCCTACAAGAATAAACTGGAAGG + Intergenic
1090423910 11:126594025-126594047 CCAATAAAGCAGAAAGTGAAAGG - Intronic
1090911049 11:131119750-131119772 ACAAACATGCAGAAACTTTAAGG - Intergenic
1091159422 11:133406291-133406313 CCAAACCTGCAGAGATTGGAGGG + Intronic
1093489150 12:19684887-19684909 CCATTCAAGCAGAATATGGATGG + Intronic
1095049728 12:37545043-37545065 CCAATCAAGCAGAAACATGTTGG - Intergenic
1095166104 12:38973879-38973901 CCAAAACAGCTGAAACTGGTTGG + Intergenic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095736511 12:45562414-45562436 CCAAACAACCAAATACTGAATGG - Intergenic
1096196882 12:49654319-49654341 CCAGAGAAGCAGCAACAGGAAGG + Intronic
1097323612 12:58251834-58251856 CCAAGCAAGCAGAACCAGTAGGG - Intergenic
1097363615 12:58686158-58686180 CCAAAATAGCAGAAACAGAAAGG - Intronic
1099312637 12:81047006-81047028 ACAAACATGCTGAAACTGCAAGG - Intronic
1099418644 12:82425001-82425023 CAAAATAACCACAAACTGGATGG - Intronic
1099610490 12:84862183-84862205 AGAAAGAAGCAGAAATTGGAAGG - Intronic
1100272090 12:93035661-93035683 TTAAACAAGCAGAAACTGCAGGG - Intergenic
1102593033 12:113971682-113971704 TCAAATTACCAGAAACTGGATGG + Intergenic
1102688746 12:114744075-114744097 CCAAAGAAACAGATATTGGAGGG - Intergenic
1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG + Intronic
1104269568 12:127270737-127270759 CCACTCAAGCAGATAGTGGAGGG - Intergenic
1105047805 12:133020669-133020691 ACAAAGAACCACAAACTGGATGG + Exonic
1107061045 13:36160184-36160206 GAAATCAAGCAGTAACTGGAGGG + Intergenic
1107815431 13:44240288-44240310 ACAAACAAACAAAAACTAGAGGG + Intergenic
1108778094 13:53791639-53791661 CCCAATAAGCATAAACTAGATGG - Intergenic
1108911322 13:55555457-55555479 ACAAACAAGCAAAAACTGTAAGG - Intergenic
1109724782 13:66326029-66326051 TGAAACAACCCGAAACTGGATGG - Intronic
1110912510 13:80981759-80981781 ACAAACAAACAAAAACTAGAGGG - Intergenic
1110926324 13:81157982-81158004 CTAAACATCCAGAAGCTGGATGG + Intergenic
1111243454 13:85505614-85505636 CTGAACAAGCAAAAACTGAAAGG - Intergenic
1111965269 13:94855629-94855651 CCTAACAAGGATAAAATGGAAGG + Intergenic
1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG + Intronic
1112489434 13:99848536-99848558 CCAAACATCCAGATACTTGAAGG - Intronic
1112532652 13:100219997-100220019 ATAAACAAGCAAAAACTGGCTGG - Intronic
1112946717 13:104937115-104937137 GAATATAAGCAGAAACTGGAAGG - Intergenic
1114175248 14:20312735-20312757 CCTAACAAGCAGAAAAGAGATGG + Intronic
1114223010 14:20713864-20713886 CGAAAACTGCAGAAACTGGAGGG - Intergenic
1115182661 14:30647544-30647566 CAAAGCAGGCAGAAACTGGAGGG - Intronic
1115624267 14:35174236-35174258 AAAAGCAGGCAGAAACTGGAGGG - Intronic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117717542 14:58596337-58596359 CCAAAAAAACAAAAACTGGTTGG + Intergenic
1118282970 14:64445994-64446016 CCAAAAAAGCAGAAATAGGTAGG - Intronic
1120379775 14:83761927-83761949 CCTAACAATCAGAAACAGTATGG - Intergenic
1121062617 14:90929276-90929298 CCAAACACACAGAAACTAAAAGG + Intronic
1121978943 14:98436202-98436224 CCAAAAAAGCACATACTGAATGG - Intergenic
1123485877 15:20738080-20738102 CCAAAGAAACAGTAACTTGAAGG + Intergenic
1123542365 15:21307124-21307146 CCAAAGAAACAGTAACTTGAAGG + Intergenic
1125948258 15:43728317-43728339 ACAAACGTGCAGAAACTGGTGGG + Intergenic
1126263753 15:46728265-46728287 TTAATCAAGCAGAAGCTGGAAGG - Intergenic
1126802754 15:52315257-52315279 CCACACTTGCAGAAACTGGGAGG + Intronic
1127131848 15:55874273-55874295 CCAAACAAGCAGAAACTGGAGGG + Intronic
1127505240 15:59591662-59591684 CCAAAAAAGCAGAGGCTAGAAGG - Intergenic
1128497762 15:68207910-68207932 CAAATCAAACAGAAACTTGACGG + Exonic
1128536398 15:68493897-68493919 ACAAACAAGCAGAGGCTGGAAGG - Intergenic
1129493563 15:75954244-75954266 ACAAAAAAACAAAAACTGGATGG - Intronic
1129510574 15:76118727-76118749 CCAAAAGGGTAGAAACTGGAGGG - Intronic
1129768214 15:78183572-78183594 ACAAACAAAAAGAAACTCGAAGG + Intronic
1129989445 15:79949451-79949473 ACAAACAAACAGACACTGGCTGG - Intergenic
1130302445 15:82690080-82690102 GCAAACAACCAGAAGCTAGAAGG + Intronic
1130571433 15:85048483-85048505 CAGAAAAAGCATAAACTGGAGGG - Intronic
1202950683 15_KI270727v1_random:34265-34287 CCAAAGAAACAGTAACTTGAAGG + Intergenic
1135129892 16:19844715-19844737 CCAAACATGAAGAAAGAGGATGG - Intronic
1135129900 16:19844773-19844795 CCAAACATGAAGAAAGGGGATGG + Intronic
1135167711 16:20155501-20155523 ACAAACAACCACAAACTGGATGG + Intergenic
1135511270 16:23085993-23086015 CCACCCAAACAGACACTGGACGG + Intronic
1136410224 16:30072201-30072223 CAAAATAAGCAGAAAAGGGAAGG - Intergenic
1137235012 16:46609374-46609396 CCAAGCAATCAGAATCTGGTGGG + Intronic
1138252433 16:55512365-55512387 CAAATCAGACAGAAACTGGAGGG + Intronic
1139620299 16:68135043-68135065 CCAAAAAATGAGAACCTGGAGGG - Intronic
1140067429 16:71623795-71623817 GTAAACAAGCAGACACAGGATGG - Intergenic
1141270113 16:82531868-82531890 CCAAATAAGCCTAAACTGGAGGG - Intergenic
1141969964 16:87474570-87474592 CAAGACAAGCAGAAACTGGAGGG + Intronic
1145370344 17:22302129-22302151 CCAATCAAGCAGAAACAGGTTGG - Intergenic
1146089980 17:29867196-29867218 CAAAACAAGGAGATACTGCAAGG + Intronic
1150374374 17:64668124-64668146 CCAAACAAGCAGCCTCTGGCTGG - Intergenic
1150440979 17:65191244-65191266 CCAAACAGAAAGAAAATGGAAGG + Intronic
1152106352 17:78331540-78331562 CCAAACAAACAAAAACAGGCTGG - Intergenic
1152485193 17:80586547-80586569 CGACACAGGCAGAAACAGGAAGG - Intronic
1153852247 18:9106331-9106353 CCAAACAGGCAGACACAGAAGGG - Intronic
1155589659 18:27411889-27411911 ACATACAAACAGGAACTGGAAGG + Intergenic
1157129437 18:44990952-44990974 CCAAAAAAGAAGAAACGGGATGG + Intronic
1158373438 18:56834450-56834472 CAAAACAAGCAAAATATGGAAGG - Intronic
1158583550 18:58707788-58707810 CCTAACAACTACAAACTGGATGG - Intronic
1159418840 18:68188490-68188512 GCAAGGAAGCAGGAACTGGAAGG - Intergenic
1160431334 18:78814853-78814875 CCCAAACAGCAGGAACTGGAGGG + Intergenic
1161010549 19:1957643-1957665 CCACACAGGCAGAGACTGGAGGG + Intronic
1161246126 19:3253146-3253168 CAAACCAACCAGAAGCTGGAGGG + Intronic
1161912222 19:7202944-7202966 CCAAAAAAGCAGACATTGTACGG - Intronic
1162099653 19:8332153-8332175 ACAAAAAAGCAGAAACTAGCTGG - Intronic
1162876424 19:13624098-13624120 CCACAAAAGCAGACACTGAACGG + Intergenic
1164047360 19:21554346-21554368 ACAAACAAACAAAAACTGGACGG - Intronic
1168631052 19:57956361-57956383 CCAAAAAAACAGAACCTGGAAGG + Intergenic
925514591 2:4666478-4666500 CCAAACCAGCAGCACTTGGATGG - Intergenic
926029462 2:9573353-9573375 TCAACCATGTAGAAACTGGAGGG + Intergenic
926673640 2:15600474-15600496 CAAAACACTCTGAAACTGGAGGG - Intronic
927526867 2:23751683-23751705 GCAAACAGGAGGAAACTGGATGG - Exonic
927656904 2:24956431-24956453 CCAATCAAGCAGGAAATAGAGGG - Intronic
927883103 2:26702645-26702667 GTATACAAGCAGACACTGGATGG + Intronic
928054429 2:28037851-28037873 CAAAGCAGGCAGATACTGGATGG + Intronic
929625146 2:43399036-43399058 ACAAACAATCAGAAACTTAAAGG + Intronic
929774743 2:44922048-44922070 ACAAACAGGAAGAAACTGGCAGG + Intergenic
930142369 2:47965300-47965322 CCAAACAATCAGAGGCTGAAGGG - Intergenic
932145555 2:69313000-69313022 CCACAGAGGTAGAAACTGGAGGG - Intergenic
932206676 2:69889513-69889535 CCACACAGGCAGAGATTGGATGG - Intergenic
932324497 2:70848400-70848422 CCGAAAAAGGAAAAACTGGAAGG + Intergenic
932882181 2:75513029-75513051 CAAAAAAGGCAGAAAATGGAAGG - Intronic
934060653 2:88289564-88289586 CAAAGCAAGCAGAAACTGGAAGG + Intergenic
935514735 2:104022053-104022075 CAAAACAGGCAGAGACTAGAAGG + Intergenic
935791349 2:106593091-106593113 TAATGCAAGCAGAAACTGGAGGG - Intergenic
937517686 2:122673869-122673891 CCAAAGAGGGACAAACTGGAAGG + Intergenic
938022189 2:127915175-127915197 ACAAACAAACAAAAACTGTATGG - Intergenic
938907867 2:135855689-135855711 CCAAACACTCACAAAATGGAAGG + Intronic
940877240 2:158910188-158910210 ACAAACAAACAAAAACTAGAAGG + Intergenic
941453978 2:165693957-165693979 CCAAACAAGCCAAAAATGCATGG - Intergenic
941587244 2:167375917-167375939 CTGAACAGGCAAAAACTGGAAGG - Intergenic
942549740 2:177102662-177102684 CCAAATATCCAAAAACTGGAAGG + Intergenic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
943967490 2:194355421-194355443 CCTACCAAGATGAAACTGGAAGG + Intergenic
945812917 2:214570027-214570049 CAAAACCAGCAGAAAATTGAAGG - Intronic
947196278 2:227571219-227571241 AATAACAGGCAGAAACTGGAGGG + Intergenic
948176305 2:235946211-235946233 CCACACACACACAAACTGGAAGG - Intronic
948205761 2:236162095-236162117 TCAAACAAACAGAAACAAGAGGG + Intergenic
1169000270 20:2163349-2163371 CCAACAAAGCAGGGACTGGAGGG - Intronic
1169895774 20:10503630-10503652 ACAAACAACCACAAACTGGGTGG + Intronic
1170790193 20:19502037-19502059 GAAAACAAGCAGAGACTGGAGGG + Intronic
1172718838 20:36983933-36983955 TCTAACAAGCAGAGCCTGGAGGG - Intergenic
1173939737 20:46900249-46900271 CCAAAGAATGAGGAACTGGAGGG + Intronic
1175001638 20:55635513-55635535 ACAAACAAACAGAAACTGGAGGG - Intergenic
1175157864 20:56984704-56984726 CAAAAGAGGCAGAAACTGCAGGG + Intergenic
1175422073 20:58840854-58840876 GAAAACAAGGAGAATCTGGACGG - Intronic
1175617635 20:60414795-60414817 CCTAAGAAGCAGAAACTGTGTGG - Intergenic
1176088792 20:63309863-63309885 CCAAACGATCAGATACTTGAGGG - Exonic
1176360580 21:5993594-5993616 CCAGACAAGCAAAAACTTAAAGG - Intergenic
1176375506 21:6085220-6085242 CCACAGCAGCAGACACTGGACGG + Intergenic
1178455437 21:32745817-32745839 GCAAACAACTAAAAACTGGACGG + Intronic
1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG + Intronic
1179747968 21:43453024-43453046 CCACAGCAGCAGACACTGGACGG - Intergenic
1179762938 21:43544956-43544978 CCAGACAAGCAAAAACTTAAAGG + Intronic
1182193758 22:28492519-28492541 ACAAACAAACAAAAACAGGAAGG + Intronic
1184730713 22:46369635-46369657 CCAAACATGCATGAGCTGGAAGG - Intronic
950021347 3:9789848-9789870 CCCAAGAAGCAGAAACTGGAAGG - Exonic
950714600 3:14838776-14838798 CCAAACAGGGAGAAAATGGAAGG + Intronic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
953100487 3:39820931-39820953 CAACCCAAGCAGAAAGTGGATGG - Intronic
953140944 3:40228599-40228621 CAAAACAGGCAGAAGCTGAAGGG - Intronic
954177975 3:48859288-48859310 ACAGACAGGCAGAAACTGGTTGG + Intronic
954586525 3:51741489-51741511 CCAACCAAGCATGAACTGTATGG + Intergenic
954603565 3:51891526-51891548 CCAAGCATGGAGAAACTGCATGG + Intergenic
955254849 3:57320620-57320642 TCACACCTGCAGAAACTGGAAGG + Intronic
955921834 3:63965172-63965194 ACAACCAAGGAGAAACTGGATGG - Intronic
957179884 3:76862718-76862740 AGAAAAAAGCAGAAACAGGAAGG - Intronic
957429357 3:80082268-80082290 ACAAACAACCAAAAACTGGCAGG + Intergenic
958536425 3:95410268-95410290 CAAAACAAGAATAAACTGAATGG + Intergenic
958972524 3:100628211-100628233 AAAAACAGGCAGAAACTGAAAGG - Intronic
959359881 3:105375033-105375055 ACAAACAAGCTGAATTTGGAAGG - Intronic
959872505 3:111344347-111344369 ACAAACAACCAAAAATTGGAAGG - Intronic
959945279 3:112119390-112119412 ACAAACAAACAGAAACAGTAGGG + Intronic
960242629 3:115363557-115363579 TGAAACAAGCAGAAAATGCAAGG - Intergenic
963532595 3:146489508-146489530 CCAAGCAATCAGTCACTGGAGGG - Intronic
964699556 3:159549825-159549847 AAAAACAAGCAGATTCTGGAAGG - Intronic
965006355 3:163031223-163031245 ACCAACAAGCAGAAAAAGGAGGG - Intergenic
965086193 3:164101359-164101381 ACAAACAGGCTGAAAATGGAAGG - Intergenic
966135445 3:176693075-176693097 CCAGAAAAGCATAAACTTGAGGG + Intergenic
968634136 4:1669174-1669196 CCAAAAAAGAGGAAACAGGATGG + Intronic
970573851 4:17408420-17408442 CCCAGCAAGCAGAAACTGGAGGG + Intergenic
970757574 4:19444712-19444734 CCAAACAAGCACAAACAAAAAGG + Intergenic
970917070 4:21348482-21348504 CCAAACAAGATGAACCAGGATGG - Intronic
970941773 4:21642352-21642374 TCAAACCAGCAGCAACAGGATGG - Intronic
972786425 4:42330601-42330623 CTAAACAAGAAGAAACTAAATGG - Intergenic
972811092 4:42586823-42586845 CTAAACAAGATGAAAATGGATGG + Intronic
974163633 4:58172014-58172036 ACAAACAAACAAAAACTTGAAGG - Intergenic
974393565 4:61306037-61306059 CCAAACCAGCTAAAACTGGTAGG - Intronic
975077793 4:70234315-70234337 TAAAACAAACAGAAACTGAAAGG - Intronic
975171075 4:71232371-71232393 AAAAACCAGCAAAAACTGGAGGG - Intronic
975465303 4:74702365-74702387 CCAAACAACCAGCAGCTGAAGGG - Intergenic
976333895 4:83863521-83863543 AGAAACAAGTAGAGACTGGAGGG - Intergenic
977144861 4:93425880-93425902 CAAAGCAGGCAGAAACTGCAGGG - Intronic
978144461 4:105355327-105355349 ACAAACAAACAAAAACTGGCAGG - Intergenic
979064932 4:116118754-116118776 CCATACAGGCAGAAAATAGATGG + Intergenic
979168381 4:117566190-117566212 CCAAACAAACAGAAATTTCATGG + Intergenic
979709328 4:123759501-123759523 CAAAGCAAGCAGAAACTGAAAGG + Intergenic
980314130 4:131174332-131174354 CTAAACAAGTAGGTACTGGAAGG - Intergenic
982438575 4:155406343-155406365 CCAAAAAAGCACAACCAGGATGG - Intergenic
983081141 4:163386944-163386966 CCAGAGAAGCAGAACCTGTAGGG + Intergenic
983319083 4:166172421-166172443 ACAAAAATGCAGAAACTGGAAGG - Intergenic
983671961 4:170247709-170247731 CCAGACATTCAGCAACTGGAGGG - Intergenic
984414985 4:179446615-179446637 ACAAAGAAGCACAAACTGGATGG + Intergenic
984674831 4:182534952-182534974 CCAAGCAAGCTGAAACTTGGTGG + Intronic
986952434 5:13105809-13105831 GCAGAGAAGTAGAAACTGGAAGG + Intergenic
987178140 5:15338001-15338023 CCAAACATGCAGCAACAGGTAGG - Intergenic
987510808 5:18835704-18835726 ACAAACAAACAGAAAATGAAAGG + Intergenic
989003943 5:36789115-36789137 ACAAACAAGCAGAAACCCCAAGG + Intergenic
990108647 5:52295189-52295211 CAAATCGTGCAGAAACTGGAAGG + Intergenic
991482392 5:67095382-67095404 CCAAACAAGTAGAAAGGGAATGG - Intronic
991591008 5:68251464-68251486 CCAAACAAGTAAAAACTTCAAGG - Intronic
992661217 5:78962899-78962921 TCAAACAGGCAGAAACTGGAAGG + Intronic
993225114 5:85159777-85159799 CCAGACAAGCAGAAGCAGTAAGG - Intergenic
993501344 5:88671306-88671328 CAAAATATGCAGAATCTGGAGGG + Intergenic
994044085 5:95288543-95288565 CAACACAAGCAGAAAGTGAATGG + Intergenic
994728083 5:103460112-103460134 CAAAACAGGCAGAAAATGAAAGG - Intergenic
994943401 5:106354762-106354784 CCAAACAAACAAAAATTGAAAGG - Intergenic
999334244 5:150701199-150701221 CCAAGCAGGCAAAAACTCGAAGG - Intergenic
1000148294 5:158474473-158474495 CTAAACAAGGACAAACTCGAAGG + Intergenic
1000493912 5:161953433-161953455 TCAAAAAAGCAGAAACTAAATGG + Intergenic
1000939116 5:167338706-167338728 TCAAAGAAGCAGGAACTGGGTGG + Intronic
1002632192 5:180589675-180589697 CAAAACCAGCAGAAACTGCAGGG + Intergenic
1003019847 6:2500306-2500328 CCAAACAAACAAAAACTAGCTGG - Intergenic
1003272198 6:4617097-4617119 TCAAATAGGGAGAAACTGGAAGG + Intergenic
1004654918 6:17650183-17650205 AAAAGCAAGAAGAAACTGGATGG + Intronic
1005228688 6:23673401-23673423 GCAAGCAAGAAGAAAGTGGAAGG - Intergenic
1005369053 6:25111241-25111263 CCAAATAAGTAGAATCTGGAAGG + Intergenic
1008749563 6:54716055-54716077 CAAGAAAAGCTGAAACTGGAAGG - Intergenic
1010377804 6:75193240-75193262 CCCAACATCTAGAAACTGGATGG + Intronic
1010672641 6:78704632-78704654 CCAAAGATGCAGAAACTGACAGG - Intergenic
1012261156 6:97089218-97089240 CCAAAGTAGCAGAAACAAGAAGG + Intronic
1013192033 6:107811800-107811822 CTAAACAAGCAGAACCCAGAGGG + Intronic
1014613344 6:123570839-123570861 GAAACCAAGCAGGAACTGGAGGG + Intronic
1015455875 6:133425534-133425556 CAAAACAGGAAGAAAGTGGAGGG - Intronic
1017265887 6:152445517-152445539 TAAAAGAAGAAGAAACTGGAAGG - Intronic
1017702759 6:157091489-157091511 TCAAACAAGCAGAATCTGGAAGG + Intronic
1018579121 6:165292502-165292524 ACAAAAAAGCAGAAACTTAAGGG - Intronic
1020786132 7:12574776-12574798 ACAAACAAGCATAAAGTGGGGGG - Intronic
1023318215 7:38963975-38963997 CCTGACAATCAGAAACTGGGAGG - Intergenic
1024594868 7:50923642-50923664 CACAAAAAGTAGAAACTGGATGG - Intergenic
1025295639 7:57773630-57773652 CCAATCAAGCAGAAACAGGTTGG - Intergenic
1026402069 7:70024278-70024300 TCAAACAAGCAGGTACTGGGTGG + Intronic
1026644522 7:72156165-72156187 CAAACCAAGGAGAACCTGGAAGG + Intronic
1027253800 7:76417044-76417066 ACAAACAAACAAAAACTGAAAGG - Intronic
1027353918 7:77338488-77338510 CCAAAATACCATAAACTGGATGG + Intronic
1032066775 7:128777149-128777171 CAAAGCAGGCAGAAACTGAAAGG + Intergenic
1032293094 7:130607898-130607920 AAAAGCAAGCAAAAACTGGAGGG - Intronic
1033363997 7:140657634-140657656 CGAAACCTTCAGAAACTGGAAGG + Intronic
1035097190 7:156365312-156365334 CTGAACCAGAAGAAACTGGATGG + Intergenic
1037616607 8:20524896-20524918 CAAAACTATCAGAAACTGGCTGG - Intergenic
1038241534 8:25812699-25812721 CAAAGCCAGCAGAAACTAGAAGG + Intergenic
1039731082 8:40279366-40279388 GCAAACAAGAAGAGAGTGGAAGG - Intergenic
1039768545 8:40658888-40658910 AAAACCAGGCAGAAACTGGAGGG - Intronic
1040295222 8:46145510-46145532 CCCCACAAGCAAAAACGGGATGG - Intergenic
1040417294 8:47206610-47206632 CCAAGCAAGGAGAATCTGGCGGG + Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041860760 8:62510273-62510295 CCAAACTAGCTCAAACTGAAAGG + Intronic
1042458185 8:69029711-69029733 ACAAAGAACCACAAACTGGATGG - Intergenic
1043347733 8:79319514-79319536 GCAAACCACCAGAAACTGGGAGG - Intergenic
1045751384 8:105488349-105488371 CCTAACAAGCAGCCACTGAATGG - Intronic
1046598492 8:116289432-116289454 ATAAACAAGCAGTTACTGGACGG + Intergenic
1047822407 8:128535760-128535782 GCAAACAACCACAAACTGGGAGG - Intergenic
1048440092 8:134453322-134453344 ACAAACAACCACAAACTGGATGG + Intergenic
1048608873 8:136000395-136000417 CCAAACAGGCAGAGACTGAGTGG - Intergenic
1049828040 8:144683017-144683039 AAAAACAAGCAAAAACTGGCTGG + Intergenic
1050057440 9:1670519-1670541 CCCAACAAGCAGGAGCTTGAAGG + Intergenic
1050306736 9:4312597-4312619 GCAATCAAGAAGAAACTGGGAGG - Intronic
1050309601 9:4339770-4339792 CCAGAGAACCAGAAACTGTAGGG + Intronic
1050586998 9:7123388-7123410 CCAAAGAAACAGAACCTGTAGGG + Intergenic
1051149195 9:14062154-14062176 ACAAAAAAGCAGCAGCTGGATGG + Intergenic
1052671544 9:31563720-31563742 CCATACAATCAGAAAAAGGAAGG + Intergenic
1052754991 9:32531840-32531862 ATCAAAAAGCAGAAACTGGAGGG - Intergenic
1053485471 9:38451339-38451361 CCAGACAAGCAAAAACTGGGGGG - Intergenic
1054161609 9:61675261-61675283 CCTATCAAGCAGAAACAGGTTGG + Intergenic
1055681463 9:78720148-78720170 CCAAAATAGCATAAACTGGGTGG + Intergenic
1056283252 9:85062912-85062934 CCAAATTGGCTGAAACTGGAAGG - Intergenic
1056622344 9:88224810-88224832 TCAAACAGGCAGAAACAGGATGG + Intergenic
1058250303 9:102686496-102686518 TCAAATTAGCAGAAACTTGAGGG + Intergenic
1060232100 9:121832958-121832980 ACAAACAAACAAAAACTGGGGGG + Intronic
1060501836 9:124163476-124163498 ACAAGCAGGCAGAAACTGAAGGG - Intergenic
1060753631 9:126192268-126192290 ACAAACAAGCCGAAACTTAATGG - Intergenic
1060946154 9:127570090-127570112 GTCAACAAGCAGAAAGTGGATGG - Intronic
1060976193 9:127766550-127766572 ACAAACAAACAAAAACAGGAAGG - Intronic
1203655169 Un_KI270752v1:16915-16937 CCAAAGAAGTAGAAACAGGGAGG - Intergenic
1187613956 X:20972904-20972926 CCAAAGAAGCAGAAAGTGATTGG - Intergenic
1187762084 X:22598466-22598488 GCAAACTACCAGAAACTGAATGG - Intergenic
1188174012 X:26965470-26965492 CAAAACAGGCAGAAACTAGGGGG + Intergenic
1189576563 X:42359800-42359822 CCATAGAGGCAGAGACTGGAGGG - Intergenic
1189764345 X:44354699-44354721 CAAAAGAAGCAGAAACTGGCCGG + Intergenic
1189880841 X:45490625-45490647 GCAATCTAGCAGCAACTGGAAGG - Intergenic
1190950109 X:55135226-55135248 GAAAACAATCTGAAACTGGATGG + Intronic
1193170927 X:78334513-78334535 CCAAACAAGGATAAAATGAAAGG - Intergenic
1193543609 X:82800674-82800696 ACAAAACAACAGAAACTGGATGG - Intergenic
1193956490 X:87870414-87870436 TCAAATATGCAGAAACAGGAGGG + Intergenic
1194095225 X:89631678-89631700 CCAAATAAGAAGGAACTGGCAGG - Intergenic
1194646584 X:96465332-96465354 CCAACCAATCAGAATCTGCAAGG + Intergenic
1195832971 X:109080516-109080538 TAAAACAAGGAGAAAGTGGAAGG - Intergenic
1197259770 X:124305521-124305543 ACAAACAAACAAAAACTAGAAGG - Intronic
1197380712 X:125735873-125735895 ACAAACAAGCACAGACTGCAAGG - Intergenic
1197407940 X:126076612-126076634 TCAATCAAGTAGAAACTGAATGG - Intergenic
1197530315 X:127616103-127616125 ACAAACAAACAAAAACTGAAGGG - Intergenic
1198390072 X:136165163-136165185 ATAAACAAGCAAAAACTGGAAGG - Intronic
1200447859 Y:3287856-3287878 CCAAATAAGAAGGAACTGGCAGG - Intergenic
1201638594 Y:16153694-16153716 ACAAAGAGGCAGAGACTGGAAGG - Intergenic
1201947638 Y:19528976-19528998 CCACACAAGCAAAAACTGAGGGG + Intergenic