ID: 1127132663

View in Genome Browser
Species Human (GRCh38)
Location 15:55883281-55883303
Sequence CCACAGGCAGAGTCTCTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127132663_1127132668 -4 Left 1127132663 15:55883281-55883303 CCACGGAGAGACTCTGCCTGTGG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1127132668 15:55883300-55883322 GTGGAAAGAGAAGGGAAGAGTGG 0: 1
1: 12
2: 106
3: 467
4: 2261
1127132663_1127132670 15 Left 1127132663 15:55883281-55883303 CCACGGAGAGACTCTGCCTGTGG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1127132670 15:55883319-55883341 GTGGGAAGAACTTTGTCTTATGG 0: 4
1: 21
2: 110
3: 220
4: 469
1127132663_1127132669 -3 Left 1127132663 15:55883281-55883303 CCACGGAGAGACTCTGCCTGTGG 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1127132669 15:55883301-55883323 TGGAAAGAGAAGGGAAGAGTGGG 0: 3
1: 28
2: 176
3: 506
4: 1989

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127132663 Original CRISPR CCACAGGCAGAGTCTCTCCG TGG (reversed) Intronic
904052955 1:27651307-27651329 CCCCAGGCAGACTCTCGCCTTGG - Intergenic
912486250 1:110031216-110031238 CCACAGGCAGAGCAGCTCCGAGG + Intergenic
915510602 1:156384976-156384998 CCACAGGCAGCGTCTCCACAGGG + Exonic
917630255 1:176884474-176884496 ACACAGGCTGAGACTCTCCACGG - Exonic
921175279 1:212587985-212588007 CCACATGCTGAGTCTCACAGGGG - Intronic
922905581 1:229171279-229171301 GCTCAGGCAGAATCTCTCTGAGG + Intergenic
923360021 1:233201912-233201934 CCACAGCCAGAGCATCTCCAGGG - Intronic
924440334 1:244080622-244080644 CATCCGGCAGAGTCTCACCGGGG - Intergenic
924556842 1:245125889-245125911 CCATAGGCAGAGCAGCTCCGAGG + Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1064176598 10:13080766-13080788 ACACAGGAAGTGTCTGTCCGTGG - Intronic
1065903189 10:30226251-30226273 GCACAGGGAGAGGCTCTCCGGGG + Intergenic
1067812274 10:49439129-49439151 CCCCAGGCAGAGTCCCTACTGGG - Intergenic
1071239703 10:83692005-83692027 CCAGTGGCAGAGTCACTCTGCGG - Intergenic
1075945148 10:126426316-126426338 CAACAGGCAGAGTCCCACCAGGG + Intronic
1076294251 10:129372370-129372392 CAGCAAGCAGAGTCTCTCTGTGG + Intergenic
1077538023 11:3133800-3133822 CCCCAGGGACAGTCTCACCGTGG - Intronic
1080605567 11:33862186-33862208 CCTCAGGCAAAGTCCCTCAGAGG + Intronic
1080798710 11:35589568-35589590 CCACAGGCTGTGGCTCTCCCAGG - Intergenic
1081582374 11:44360965-44360987 CCACAGGCAGAGGCCCTGGGAGG + Intergenic
1082059042 11:47845104-47845126 CCATAGACAGAGTAGCTCCGAGG - Intronic
1083291470 11:61692688-61692710 CCCCAGGCAGAGTGGCTCTGGGG - Intronic
1084592882 11:70100550-70100572 CCACAGTCAAAGTGTCTCCAGGG - Intronic
1086072151 11:82811409-82811431 CCCCAGGGAGAGGCTCTCCAAGG - Intergenic
1088767845 11:113001930-113001952 TCCCAGGCAGCTTCTCTCCGTGG + Intronic
1089620383 11:119718619-119718641 GACCAGGCAGATTCTCTCCGAGG + Intronic
1092038526 12:5362755-5362777 CCACAGGAAGAGCCTCAGCGAGG + Intergenic
1098426424 12:70369876-70369898 CCACAGGGAGATTATCTCTGTGG + Intronic
1100586396 12:95984273-95984295 ACACAGGCAGATTCACTCCCAGG + Intronic
1101824099 12:108207337-108207359 CAGCAGGAAGAGTCTCTCAGGGG - Intronic
1103320817 12:120091953-120091975 CCACAGGCTGACTCACTCAGGGG + Intronic
1104800622 12:131553187-131553209 CCACAGGCAGAGTAGCCCTGAGG + Intergenic
1104800753 12:131554023-131554045 CCAGAGGCTGAGTCTCCCCACGG - Intergenic
1104905235 12:132209877-132209899 CCACAGGCAGAGTGGCCCCCAGG - Intronic
1107058474 13:36131118-36131140 CCCCCGGCGGCGTCTCTCCGCGG - Exonic
1110318079 13:74133881-74133903 GCACACGCAGAGCCTCTCAGCGG + Intronic
1112970204 13:105252437-105252459 CCACAGGCAGAATCTGGCCCAGG - Intergenic
1113642041 13:111964617-111964639 GCTCAGGCAGAGCCTCTCCACGG - Intergenic
1113642054 13:111964696-111964718 GCTCAGGCAGAGCCTCTCCGCGG - Intergenic
1119696218 14:76715287-76715309 CCACAATCAGAGTCTCTCCGGGG - Intergenic
1120473523 14:84957529-84957551 ACGGAAGCAGAGTCTCTCCGAGG - Intergenic
1120609912 14:86626732-86626754 CCAAAGGCAGATTCTCTCTGTGG - Intergenic
1121092151 14:91190340-91190362 CCACTGGAAGATACTCTCCGTGG - Intronic
1121629419 14:95411759-95411781 CCACAGGCACAGCCTCCCTGGGG + Intronic
1122356550 14:101126229-101126251 CCAAAGGCAGGGTCTCTCCTAGG - Intergenic
1124630527 15:31334286-31334308 CCACAGGCAGCCTGTCTCCTAGG + Intronic
1126890124 15:53196250-53196272 CCACAGCCCGAGTCACTTCGTGG + Intergenic
1127132663 15:55883281-55883303 CCACAGGCAGAGTCTCTCCGTGG - Intronic
1127207895 15:56739475-56739497 ACACAGGGAGAGGCTCTCCCTGG - Intronic
1130152489 15:81322178-81322200 CCCCAAACAGAGTCTCTGCGGGG - Intronic
1130550731 15:84888674-84888696 CCTCAGCCAGGGTCTCACCGTGG + Intronic
1130977820 15:88790717-88790739 CCACAGGCAGGAGCTCTCCGTGG - Intergenic
1131264020 15:90905187-90905209 CCACAGGGAGGGTCTCTGCTTGG - Intronic
1132032251 15:98447543-98447565 CCAAACGCACAGTATCTCCGAGG - Intronic
1132143766 15:99414921-99414943 CCACAGGCACAGGCTGGCCGTGG + Intergenic
1142434092 16:90046386-90046408 CCCCAGGCACAGGCTCTGCGCGG - Intergenic
1142631551 17:1229332-1229354 CCCGAGGCCGAGTCTCCCCGCGG - Intergenic
1142631570 17:1229374-1229396 CCCGAGGCCGAGTCTCCCCGCGG - Intergenic
1144816375 17:18038526-18038548 TTACAGGCAGACTCTCTCAGAGG - Intronic
1151552641 17:74830957-74830979 CCATAGGCAGAGCCTCACTGAGG - Intronic
1152181360 17:78823667-78823689 CCACAGGCATGGGCTCTCAGGGG + Intronic
1153453795 18:5259079-5259101 CCACAGGCTAAGGCTCTCTGGGG + Intergenic
1156463705 18:37335746-37335768 CCACAGGCAGAGTCTCTAAGGGG - Intronic
1158403789 18:57143488-57143510 CCACAGGCTGAGTCTGCCCTGGG + Intergenic
1159258253 18:65976788-65976810 CCCCAACCAGACTCTCTCCGAGG + Intergenic
1159287054 18:66367723-66367745 CCACAGGCAGAATTTCTTCTGGG + Intergenic
1162551452 19:11360667-11360689 GCACAGCCAGAGTCTCACCCAGG - Intronic
1162779197 19:12997771-12997793 CCACAGGCATTTTCTCTCCCAGG - Intronic
1163577325 19:18118341-18118363 CCACAGACAGACGCTCGCCGTGG - Intronic
925036266 2:688830-688852 CCACAGGCTTGGTCTCTCTGTGG - Intergenic
925526986 2:4813969-4813991 CCCCAAGCAGAGTCTCTACTGGG - Intergenic
925754079 2:7117089-7117111 CTTCAGGCAGAGTCTCTTCAAGG - Intergenic
926126472 2:10275375-10275397 CCACAGGCAGAGCGGCCCCGAGG + Intergenic
927940425 2:27099897-27099919 CCACAGGGAGAGGCTCTGGGGGG + Exonic
929533381 2:42765915-42765937 GCACAGGCAGAGGCTCCACGCGG - Intergenic
929881250 2:45839094-45839116 CCACGTGCAGAGTGTCTCCTGGG + Intronic
930602802 2:53461152-53461174 ACACAGGCAGCGACTCTCCCTGG - Intergenic
933937393 2:87217577-87217599 CCACAGCCATGTTCTCTCCGGGG - Intergenic
934676568 2:96253659-96253681 CTAAAGGCAGAGTCTCTCCTGGG + Exonic
935170111 2:100604334-100604356 CCTCAGGAAGAGTCTATCCCAGG + Intergenic
936355747 2:111748225-111748247 CCACAGCCATGTTCTCTCCGGGG + Intergenic
938485731 2:131705810-131705832 CCACAGGCAGAGAGTCTTCTTGG + Intergenic
938736076 2:134187937-134187959 CCACAGGCGGAATCTCTCCACGG - Intronic
941997206 2:171611929-171611951 CCAGAGGCAGAGTATCTCCCAGG - Intergenic
944616520 2:201465727-201465749 CCACAGGCTGAGGCCCTCTGGGG - Intronic
945760031 2:213903212-213903234 CCCCATGCAGAGTCCCTACGGGG - Intronic
946853782 2:223933237-223933259 CCACAGGCAGATTTTATCCAGGG + Intronic
948516723 2:238508729-238508751 CCACAGGACGAGTCTCTGAGTGG + Intergenic
948867363 2:240782750-240782772 CCCCAGGCAGGGTCCCTCCAGGG + Intronic
949050379 2:241894675-241894697 GCTCAGGCACAGTCTCTCCGGGG - Intronic
1169039675 20:2482684-2482706 CCACATGCAGATTCTCCCTGTGG + Exonic
1171486330 20:25489130-25489152 CCGCAAGCAGAGGCTCTCCCTGG + Intronic
1174409006 20:50321596-50321618 CCCCAGGCGGAGTCTTCCCGAGG + Intergenic
1175304151 20:57964546-57964568 ACACAGGCAGAGCCTCTGTGTGG - Intergenic
1175612786 20:60365333-60365355 CCAGAGGCAGATTCTCTTCTTGG + Intergenic
1176379584 21:6105402-6105424 CCACAGGCAGAGCCACTGAGAGG - Intergenic
1176924345 21:14729127-14729149 AAACAGGCAGTGTCTTTCCGGGG + Intergenic
1179408042 21:41141346-41141368 CCACAGGCAGAGGCTGTGCAAGG + Intergenic
1179713183 21:43274650-43274672 CCACATGCAGAGACTCTGAGTGG - Intergenic
1179743890 21:43432835-43432857 CCACAGGCAGAGCCACTGAGAGG + Intergenic
1180150677 21:45945650-45945672 CCAGAGGCAGAGAGTCGCCGCGG - Intergenic
1181298059 22:21858024-21858046 CCAGAGGCAGACACTCTCCCAGG + Intronic
1182259664 22:29064296-29064318 TCACAGGCAGATTCCCTCCTGGG - Intergenic
1183284399 22:36953145-36953167 CCACAGGCAGAAGCTCACCCTGG - Intergenic
1183387896 22:37525509-37525531 CCCCAGGCAGAGTTCCTCCATGG - Intergenic
1183585180 22:38749310-38749332 CCTCAGGCAGAGCCTCTTTGTGG + Intronic
1183978992 22:41528748-41528770 CCACAACCACAGTCACTCCGTGG - Exonic
1184018808 22:41806692-41806714 ACACAGGCAGAGTGTGTCCAAGG + Intronic
949621443 3:5817043-5817065 CAACAGGCAGAGTCTGTGCATGG + Intergenic
949924661 3:9031567-9031589 CCACAGGCAGAGACAGTCCTGGG + Intronic
954761367 3:52877111-52877133 CCACAGGCAGGGTGTGTCAGAGG - Intronic
958038354 3:88195931-88195953 CCACAGGCAGAGTAGCCCCAAGG + Intergenic
958684745 3:97378423-97378445 CCCCACGCAGAGTCCCTCCCGGG + Intronic
963545541 3:146653131-146653153 CCACTGGCAGATTTTCTCCATGG - Intergenic
963906249 3:150775273-150775295 CCACAGGCAGCGTCTTCCCAGGG + Intergenic
963983105 3:151562368-151562390 CCATAGGCAGAGCAGCTCCGAGG - Intergenic
964080813 3:152754201-152754223 CCACAATCAGAGACTCTCAGGGG + Intergenic
966474274 3:180325688-180325710 CCACAGGCAGCCTCTGTCTGTGG - Intergenic
967099411 3:186203870-186203892 CCACAGGTAGAGCCTTTCCCTGG - Intronic
967946149 3:194805751-194805773 CCACAGGCAGAGCCAGTCCACGG - Intergenic
969534679 4:7748452-7748474 CCACAGGTAGGGTCTCACCCTGG + Intergenic
971875356 4:32301172-32301194 CCCCAGACAGAGTCTCTACTGGG + Intergenic
973707841 4:53597630-53597652 CCACACTCTGAGTCTCTCCAGGG + Intronic
976747137 4:88414547-88414569 CCACAGGCAGAGCAGCTCCTTGG + Intronic
979067450 4:116156408-116156430 CCACAGGCAGAGCAGCCCCGAGG + Intergenic
979627663 4:122863857-122863879 CCACAGGCAGAATTTCTGCTGGG + Intronic
982163836 4:152596748-152596770 CCACAGCCAGAGTCTCCCGTTGG - Intergenic
986338792 5:6773449-6773471 CCACAGGCTGAGTCTACCTGCGG - Intergenic
986756727 5:10843814-10843836 CCCCACGCAGAGTCTCTACTGGG - Intergenic
990738325 5:58888030-58888052 CAACAGACAGCCTCTCTCCGAGG - Intergenic
992872779 5:81023176-81023198 CTCCAGGCAGATTCTCTCCCAGG - Intronic
993753608 5:91700877-91700899 CCACAGACAGAGTCCCTACTGGG - Intergenic
997951211 5:138243992-138244014 GCACAGGCAGAATCTCCCTGGGG + Intergenic
1001956846 5:175853588-175853610 CAAGGGGCAGAGTCTCTCGGAGG + Intronic
1002569656 5:180133000-180133022 CAACAGGCAGCCCCTCTCCGAGG - Intronic
1002674417 5:180899181-180899203 GCTCACGCAGAGCCTCTCCGTGG + Exonic
1003117314 6:3291641-3291663 CTACAGGCACAGTTTCTCCATGG + Intronic
1003461326 6:6331286-6331308 CCACAGGCAGAGCCACTGCGAGG - Intergenic
1004516267 6:16324937-16324959 CCAGAGGTATAGTCTCTCCTAGG + Intronic
1006315472 6:33288954-33288976 CCACAGCCGGAGCCTCTCCAGGG - Exonic
1008499839 6:52169987-52170009 CCTCATGCAGAGTCTCTACTGGG - Intergenic
1013831902 6:114282564-114282586 CCACAGGAAGAGGCTTTCCAGGG - Intronic
1014732543 6:125050412-125050434 ACACAGACAGAGTTTCTCCAGGG - Intronic
1015223521 6:130830948-130830970 CCACAGGCAGAGCAGCCCCGAGG - Intronic
1017838421 6:158201445-158201467 TCTCAGGCAGAGTCTTTCGGAGG + Intergenic
1020402574 7:7795556-7795578 CCACAGGCAGAGCAGCTGCGAGG + Intronic
1021577353 7:22116449-22116471 ACACAGGCCGAGTTTCTCCTGGG + Intergenic
1024039973 7:45545124-45545146 CCATAAGCAGAGTCACCCCGAGG - Intergenic
1024645407 7:51366796-51366818 CCACAGGCAGAGGCTTTTCATGG + Intergenic
1026921813 7:74161139-74161161 CCACAGGCAGAGCAGCCCCGAGG - Intergenic
1032239989 7:130153220-130153242 CCGCAGGCAGAGTCTGCTCGGGG - Intergenic
1034623103 7:152471520-152471542 CCCCAGACAGAGTCTCTACTAGG + Intergenic
1035115230 7:156518179-156518201 CCACAGGCAGAATCCGTCAGAGG - Intergenic
1035690781 8:1558026-1558048 CCAATGGCTGAGTCTCTCCAGGG - Intronic
1037768643 8:21786620-21786642 CCAGAGGCAGCTTCTCTCTGGGG - Intronic
1038246161 8:25858470-25858492 ACACAAGCAGCATCTCTCCGCGG - Exonic
1038847781 8:31245717-31245739 ACAGAGGCAGAGGCTCTCAGGGG - Intergenic
1040390783 8:46948988-46949010 CCTCACGCAGAGTCTCCCTGGGG + Intergenic
1043004937 8:74807746-74807768 CCACAGACAGAGTAGCTCCGAGG - Intronic
1045507868 8:102791248-102791270 ACGCAGGCAGAGCCTCCCCGGGG + Intergenic
1049672596 8:143876582-143876604 CCAGAAGCAGAGTCTGTCTGAGG - Intronic
1051316892 9:15846692-15846714 CTGCTTGCAGAGTCTCTCCGAGG + Exonic
1053161229 9:35814793-35814815 CCACAGGCAGGAGCTCTGCGCGG + Intronic
1060531060 9:124347180-124347202 CCACAGGCAGCAGCTCTGCGAGG + Intronic
1061442897 9:130618663-130618685 CCACATTCAGAGTAGCTCCGGGG + Intronic
1062171883 9:135139292-135139314 TCACAGAGAGAGTGTCTCCGTGG - Intergenic
1062396181 9:136353754-136353776 CCAGAGGCAGAGGCCCCCCGCGG + Intronic
1062648864 9:137565268-137565290 TCACAGACAGAGTCACCCCGGGG - Intronic
1062648913 9:137565500-137565522 TCACAGACAGAGTCACCCCGGGG - Intronic
1062648967 9:137565770-137565792 TCACAGACAGAGTCACCCCGGGG - Intronic
1062648974 9:137565800-137565822 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649116 9:137566472-137566494 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649123 9:137566502-137566524 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649130 9:137566532-137566554 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649137 9:137566562-137566584 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649184 9:137566802-137566824 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649191 9:137566832-137566854 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649235 9:137567038-137567060 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649266 9:137567186-137567208 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649380 9:137567714-137567736 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649411 9:137567864-137567886 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649418 9:137567894-137567916 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649425 9:137567924-137567946 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649432 9:137567954-137567976 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649469 9:137568132-137568154 TCACAGACAGAGTCACCCCGGGG - Intronic
1062649560 9:137568572-137568594 TCACAGACAGAGTCACCCCGGGG - Intronic
1187058191 X:15760711-15760733 CCACAGTCTGAGTGTCTCAGAGG + Intronic
1192547545 X:72026558-72026580 CCACAGCCAGAGGCTGTCCCAGG + Intergenic
1194046138 X:89005823-89005845 CCAAAGGCTGAGTATCTCCTTGG + Intergenic
1200166882 X:154042115-154042137 GCACAGGCAGAGTGTCTCAGTGG + Intronic
1202019835 Y:20452867-20452889 CCACACACAGAGTCTCTACTGGG + Intergenic