ID: 1127134026

View in Genome Browser
Species Human (GRCh38)
Location 15:55900198-55900220
Sequence CAGGACTCCAAGGTGACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127134024_1127134026 -9 Left 1127134024 15:55900184-55900206 CCAGTGGGACACAGCAGGACTCC 0: 2
1: 1
2: 74
3: 2314
4: 31672
Right 1127134026 15:55900198-55900220 CAGGACTCCAAGGTGACAACAGG 0: 1
1: 0
2: 1
3: 13
4: 132
1127134023_1127134026 -8 Left 1127134023 15:55900183-55900205 CCCAGTGGGACACAGCAGGACTC 0: 1
1: 0
2: 1
3: 22
4: 270
Right 1127134026 15:55900198-55900220 CAGGACTCCAAGGTGACAACAGG 0: 1
1: 0
2: 1
3: 13
4: 132
1127134021_1127134026 -2 Left 1127134021 15:55900177-55900199 CCAGAGCCCAGTGGGACACAGCA 0: 1
1: 0
2: 9
3: 29
4: 224
Right 1127134026 15:55900198-55900220 CAGGACTCCAAGGTGACAACAGG 0: 1
1: 0
2: 1
3: 13
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127134026 Original CRISPR CAGGACTCCAAGGTGACAAC AGG Intronic
900557716 1:3288587-3288609 CAGGACCCCTAGGTGAGCACAGG - Intronic
900933717 1:5752546-5752568 CAGGCCTGCAAGGTGACAGCAGG - Intergenic
901775373 1:11557028-11557050 CAGGAAGCCTAGGTGACAAGTGG - Intergenic
902041749 1:13497554-13497576 GAGGAAGCCAAGGTGCCAACAGG - Intronic
904649343 1:31992771-31992793 CAGTTCTCAAAGGTAACAACTGG + Intergenic
906049492 1:42858604-42858626 CAGGCCTCCAAGAAGACACCAGG + Intergenic
906264019 1:44414986-44415008 CACAACTCCAGGGTGACCACAGG - Intronic
907900854 1:58740498-58740520 CATGCCTCTATGGTGACAACTGG + Intergenic
909197714 1:72648622-72648644 GAGGGCACCAAGGTGACAAGGGG - Intergenic
909919986 1:81369026-81369048 CAAGAATCCAAAGTGACAAGTGG + Intronic
912640780 1:111343950-111343972 CAGGACTGCAAGGTGAACATAGG - Intergenic
920039535 1:203086358-203086380 CGGGACTGCAAGGAGACAGCAGG - Intergenic
920778149 1:208961139-208961161 CATTACTCCAAGGTGATAATTGG - Intergenic
921342193 1:214145283-214145305 CAGAACTCCAAGGTGGCGGCGGG + Intergenic
924586559 1:245365851-245365873 CAGAACTCCAAGGTCACAAGTGG + Intronic
1063344316 10:5296956-5296978 CTGGCTTCCAAGGTGACTACAGG - Intergenic
1063875235 10:10469594-10469616 CAAGAAGGCAAGGTGACAACTGG - Intergenic
1064038012 10:11931099-11931121 CAGGACTCCAAGTAGACAAAAGG + Intronic
1066205582 10:33186262-33186284 TTGGACACCAAGGTGACCACTGG - Exonic
1071464587 10:85927710-85927732 CAGGACACTGAGGTTACAACAGG + Intronic
1073453586 10:103623439-103623461 CAGGGCTCCAGGGTGCCAGCTGG + Intronic
1073459921 10:103660550-103660572 CTGGACCCCATGGTGACAGCAGG + Intronic
1075187902 10:120279387-120279409 CAGGGCTGCAAGGTGCCAAGAGG + Intergenic
1076088031 10:127652928-127652950 TATGACTCCAATGTGACAACAGG - Intergenic
1077002388 11:330799-330821 CAGGCCTCCGAGGTGGGAACGGG - Intergenic
1077186220 11:1236551-1236573 CAGGACTACAAGGTGAGCTCGGG + Exonic
1080922649 11:36724142-36724164 GAGGAGTCCAAGGTGACATTTGG + Intergenic
1081965304 11:47165637-47165659 CAGGAGTCCACGGTGAGAGCTGG + Intronic
1084875025 11:72124725-72124747 CTGGACTTCGAGGAGACAACCGG - Intronic
1085524274 11:77155181-77155203 CAGGACCTCAAGGCCACAACAGG + Intronic
1087270394 11:96105411-96105433 CAGGACTGCAATGTGTTAACTGG + Intronic
1088189330 11:107210167-107210189 CAGAAATCCAAGTTGACAGCTGG - Intergenic
1088706687 11:112470369-112470391 CCCGAATCCCAGGTGACAACAGG - Intergenic
1093528452 12:20133112-20133134 CACCACTCCAAGGTGACTTCAGG - Intergenic
1098454132 12:70653100-70653122 CAGGACTCCAAGGTATGAACTGG + Intronic
1098554111 12:71799202-71799224 CAGGGCTCCATGGTGACCAGAGG + Exonic
1101436897 12:104671840-104671862 CACGCCTACAAGGTGACAAAGGG - Intronic
1107333402 13:39326673-39326695 CAGGGGTCAAAGGTGACCACAGG - Intergenic
1113779700 13:112969098-112969120 CAGGACTCCCAGGTGACCCGCGG + Intronic
1115722245 14:36175880-36175902 CAGGTTTCCAAGTTGGCAACTGG + Intergenic
1121266839 14:92609363-92609385 ATGCACTCCAAGGTGACAGCAGG - Intronic
1121578280 14:95006783-95006805 CAGGCCTCCCAGGAGACAAGTGG + Intergenic
1123150971 14:106181559-106181581 CAGGGTTCCCAGGTGAGAACAGG - Intergenic
1123399386 15:19969416-19969438 CAGGGTTCCCAGGTGAGAACGGG - Intergenic
1123482058 15:20641212-20641234 CAGGGTTCCCAGGTGAGAACTGG - Intergenic
1123635957 15:22359156-22359178 CAGGGTTCCCAGGTGAGAACTGG + Intergenic
1124463950 15:29919611-29919633 CAGGTCTCCAAGGTCACCTCTGG - Intronic
1127134026 15:55900198-55900220 CAGGACTCCAAGGTGACAACAGG + Intronic
1130430910 15:83846100-83846122 CAGGTCTCCTGGGTGACCACGGG - Intronic
1130994089 15:88894686-88894708 CTGGACACCAAGGTCCCAACAGG + Intronic
1131256888 15:90868997-90869019 GAGCACCCCAAGGAGACAACAGG + Intronic
1132028096 15:98419895-98419917 CAGGAATTCAAGGTTACAGCGGG + Intergenic
1135195836 16:20393838-20393860 CAGTCCTGCAAGGTGACAATTGG - Intronic
1137271438 16:46904953-46904975 CAACACTCTAAGGTGCCAACTGG - Intronic
1138226803 16:55302852-55302874 CAGCAGTCCAAGGTGAGAAAAGG - Intergenic
1139563423 16:67758021-67758043 CATGACTTCAAGCTGACACCTGG - Intronic
1140082973 16:71767897-71767919 CAGGATTCCAAACAGACAACAGG + Intronic
1141514796 16:84536658-84536680 CAGAACCCAAAGGTGAGAACTGG + Intronic
1141516576 16:84549021-84549043 CTGGGCACCAAGGAGACAACAGG - Intronic
1141640164 16:85336143-85336165 CAGGACTCCAGGGTCACCAGGGG + Intergenic
1142265618 16:89062860-89062882 CAGGGGTCAAAGGTGACCACAGG - Intergenic
1143905653 17:10207265-10207287 CCGGACTGCAAGGGGAGAACTGG - Intergenic
1151624774 17:75270103-75270125 CAGCACTCAAAGGTGAGCACGGG - Exonic
1153953462 18:10076337-10076359 CAGGACGCCATGGTGACCAGCGG - Intergenic
1156658020 18:39310406-39310428 CAGTACTCCAAGGCAAAAACTGG + Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1159632171 18:70761437-70761459 CAGTTCTCCTACGTGACAACTGG - Intergenic
1161477326 19:4493924-4493946 CAGGGCTCCAAGGTGACCAGGGG - Intronic
1164939208 19:32238984-32239006 CAGTACTCTAAGGTAAGAACTGG - Intergenic
1166300910 19:41911741-41911763 CAGGACCCCAAGGTGACAAGAGG + Intronic
1167859860 19:52273850-52273872 CTGCACTCCAATGTGAAAACAGG - Intronic
925518012 2:4706719-4706741 GAGGACTCCAAGGTAACACGTGG + Intergenic
925568480 2:5283162-5283184 CGGGATTTCAAGGTCACAACTGG + Intergenic
926162339 2:10497926-10497948 CAGGAGCCCAAGGTGCCAGCCGG + Intergenic
926362014 2:12098120-12098142 CAGGCTTCAAAGGTGACAAAGGG - Intergenic
926401886 2:12505539-12505561 GAGGACTCCAAGTAGACCACTGG - Intergenic
926493864 2:13559419-13559441 CAGCACTCCTAGGTGAGAAAGGG + Intergenic
927937379 2:27083386-27083408 CAGGACCCCGAGGAGGCAACAGG - Exonic
928633055 2:33214008-33214030 TAGGAATCCAAGGTGAAAATTGG + Intronic
929163080 2:38853010-38853032 AAGGAATCCCAGGTGACAAACGG - Intronic
929584468 2:43105171-43105193 CAGGTCTCCATGGTAGCAACAGG - Intergenic
931655234 2:64504897-64504919 CAGGGCTCCCTGGTGAGAACTGG + Intergenic
935453695 2:103240386-103240408 GAGGACTCCAAGATGACTTCCGG - Intergenic
937060032 2:118974330-118974352 CAGGTCTTCAAGGTCACAAGGGG + Exonic
937404469 2:121614080-121614102 GAGCACTCCAAGATGACAAAGGG + Intronic
945680955 2:212913612-212913634 CAGGACTCCAAATTGAGAAGGGG + Intergenic
948883032 2:240870019-240870041 CAGGACCCCAAGTGGACATCAGG + Intronic
1171146791 20:22791553-22791575 CAGGCCAAGAAGGTGACAACAGG + Intergenic
1171375660 20:24692570-24692592 CAGGACTGCAGGGTGAAAAGAGG + Intergenic
1171857724 20:30362230-30362252 CTGGACTCCCACGTGACAAATGG - Intergenic
1171981633 20:31632997-31633019 CAGGACCCTAAGGTGAAAATAGG - Intergenic
1174254346 20:49243159-49243181 GAGGATCCCAAGGTGAGAACAGG + Intronic
1174445242 20:50586709-50586731 CAGCTCACCAAGGTGACACCTGG + Exonic
1175485369 20:59342320-59342342 CAGGCAGCCAAGGTGACAAGGGG + Intergenic
1175698883 20:61123306-61123328 CAGGAGTCCCAAGTGACAAGTGG + Intergenic
1176125574 20:63473119-63473141 CCGGACTCAAAGGTGACCGCAGG - Intergenic
1177269652 21:18830780-18830802 CTGTGCTCCAAGGTGAAAACAGG - Intergenic
1177589209 21:23140075-23140097 CAGGACTAGAAGCTAACAACAGG + Intergenic
1180204155 21:46247008-46247030 CAGGCCTCCAAGGGCACAGCTGG + Intronic
1180500457 22:15924672-15924694 CAGGACACCCAGCTGACAAAAGG - Intergenic
1182147490 22:28005642-28005664 CGAGACTGCAAGGTGGCAACGGG - Intronic
1183314554 22:37129681-37129703 CAGGTCACCAAGGAGACATCAGG + Intronic
1184294909 22:43517082-43517104 GAGGACTCCAAGATGATAAGAGG + Intergenic
949141474 3:638626-638648 AAGGACTACACTGTGACAACTGG - Intergenic
952961975 3:38598067-38598089 CAGGGCTGCTAGGTGACAGCGGG + Intronic
954366301 3:50147983-50148005 CAGGACTGCAAGCTGAGATCTGG - Intergenic
954558265 3:51535315-51535337 CCAGATTCCAAGGTGACAAAGGG - Intergenic
956515773 3:70046315-70046337 CAGGACTCCAAAGTGCTCACCGG - Intergenic
956771955 3:72534531-72534553 CAAGACTCCAAGGTGAAGAAAGG + Intergenic
961918920 3:130405604-130405626 CAGGACCCCAAGGAGACAAAGGG + Exonic
963423663 3:145095234-145095256 CAGAACTACAAAGTGACTACAGG - Intergenic
969027290 4:4183677-4183699 CAGATATCCAGGGTGACAACAGG - Intergenic
969866931 4:10082341-10082363 CAGGACTACCGGGTGACAAAGGG + Intronic
980072994 4:128263548-128263570 CAGGACTCCCAGTTGACACTGGG - Intergenic
980996775 4:139786640-139786662 CAGTTCTCCAAGGTGTCAGCTGG + Intronic
985679740 5:1249655-1249677 CAGGTCTCCAAGGTGCCATCTGG - Intergenic
989377177 5:40776697-40776719 CAGGAATCCAAGGTTTCAAAAGG - Intronic
993929787 5:93923733-93923755 CAGGAGTTCAAGGTTACAATGGG + Intronic
995865614 5:116686793-116686815 CAGGACTCCAGGGTGGTAACTGG + Intergenic
1001801624 5:174549201-174549223 CATGACACCAAGGAGAAAACAGG - Intergenic
1003843720 6:10150243-10150265 GAATACACCAAGGTGACAACTGG + Intronic
1006030916 6:31175973-31175995 CAGAACTCCAAAGTTACAAGAGG + Intronic
1006556725 6:34873268-34873290 CAGGACTCCAGGCGGACAACAGG - Exonic
1007323307 6:41042362-41042384 AAGGAATCCACGGTGTCAACAGG + Intronic
1008211371 6:48729117-48729139 TGGGACTCCAAGGTGACCAGGGG + Intergenic
1017011338 6:150065764-150065786 CAGGACTTGGAGGAGACAACAGG - Intronic
1019212325 6:170416781-170416803 CAGCCCTCCCAGGTGACAAGCGG + Intergenic
1023083513 7:36547285-36547307 AAGGGCACCAAGGTGACATCTGG + Intronic
1026395693 7:69951676-69951698 CAGGATTCCAAGATGGCAGCTGG + Intronic
1026515088 7:71062573-71062595 CAGGAGCCCAAGCTGACACCAGG + Intergenic
1033277158 7:139980640-139980662 AAGGACTCCAAGGAGAAGACGGG - Intronic
1033725823 7:144117428-144117450 AATGACTCCAAAGTGACCACTGG + Intergenic
1035042094 7:155936413-155936435 CAGGGCTCCATGGTGACCCCAGG + Intergenic
1036361000 8:8076899-8076921 CAGGACACCAGGGTGCAAACTGG - Intergenic
1037473917 8:19237720-19237742 CAGGACACCAAGGTCAAGACTGG + Intergenic
1037684941 8:21130672-21130694 CAGGACCCAGAGGTGCCAACAGG - Intergenic
1037926960 8:22851208-22851230 CAGGACTCCACGGAGACTCCTGG + Intronic
1038402589 8:27296721-27296743 CATGACTCCACGATGACTACTGG + Intronic
1039892332 8:41694020-41694042 CGGGGCTCCACGGTGACAATGGG + Exonic
1043385616 8:79744806-79744828 CGGGGCTCCAAGGTGTCATCAGG + Intergenic
1047338371 8:123957109-123957131 CAGGCCTCCCAGGAGACAAGAGG - Intronic
1048375561 8:133819537-133819559 CAGGAGCCCCACGTGACAACTGG - Intergenic
1055152319 9:73017110-73017132 CTGGACTTCAAGGAGACAACTGG + Intronic
1057467159 9:95324662-95324684 CAAGACTCAAATGTAACAACAGG + Intergenic
1061648220 9:132023970-132023992 CAGGACTACGAGGAGGCAACGGG + Intronic
1062101417 9:134730563-134730585 GAGGACACCAAGGTGAGAACTGG - Intronic
1190633444 X:52411500-52411522 CAGGACTACAGGGTGCCAAATGG - Intergenic