ID: 1127134861

View in Genome Browser
Species Human (GRCh38)
Location 15:55909626-55909648
Sequence CTTTGTAGGCTGAAGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127134861_1127134865 -10 Left 1127134861 15:55909626-55909648 CCAAGCCCCTTCAGCCTACAAAG 0: 1
1: 1
2: 1
3: 22
4: 245
Right 1127134865 15:55909639-55909661 GCCTACAAAGCCTCTTGTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 99
1127134861_1127134868 0 Left 1127134861 15:55909626-55909648 CCAAGCCCCTTCAGCCTACAAAG 0: 1
1: 1
2: 1
3: 22
4: 245
Right 1127134868 15:55909649-55909671 CCTCTTGTCCTGGCTTCTCCTGG 0: 1
1: 1
2: 4
3: 50
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127134861 Original CRISPR CTTTGTAGGCTGAAGGGGCT TGG (reversed) Intronic
900481836 1:2903120-2903142 CGGTGTCGGCTGAAGGAGCTGGG - Intergenic
901393786 1:8965590-8965612 TTTTAAAGGCTGAAGTGGCTGGG + Intronic
901985553 1:13072966-13072988 CTTGGGAGGCTGAGGAGGCTTGG + Intronic
901996256 1:13153801-13153823 CTTGGGAGGCTGAGGAGGCTTGG - Intergenic
903122679 1:21226458-21226480 CTTTGGAGGCAGAAGGATCTGGG - Intronic
903241149 1:21983576-21983598 ATTTGGAGGGTGAAGGAGCTGGG + Intronic
903338137 1:22638307-22638329 CTCTGAAGCCTGAAGGGGCTGGG - Intronic
905018583 1:34793496-34793518 CTTTGGAGGTGGAAGGGGGTGGG + Intronic
905018704 1:34794094-34794116 CTTTGTAGGTAGAACGGGCGTGG + Intronic
905182081 1:36173479-36173501 GTGAGTAGGCTGGAGGGGCTGGG + Intronic
906676077 1:47694466-47694488 CTGTGGGGGCTGCAGGGGCTGGG + Intergenic
906990309 1:50730075-50730097 CTCTGGAGGGTGAAGGGGGTTGG + Intronic
907309421 1:53530760-53530782 CTTTGAAGGCTGAGGGAGGTTGG - Intronic
910549049 1:88455275-88455297 CTTGGTAGGGTGAAGGTGTTGGG + Intergenic
911095462 1:94051330-94051352 CTTTGAACCCTGAAGTGGCTTGG + Intronic
912596108 1:110878028-110878050 CTTTGGAGGCTGAAAGAACTTGG + Intronic
913134947 1:115879179-115879201 ATTTTTAGCCTGAAGAGGCTTGG + Intergenic
915307157 1:154987133-154987155 CTTGGGAGGCTGAAGTGGGTGGG - Intronic
915492562 1:156259264-156259286 CCTTGTTGGCTGAGGTGGCTGGG - Intronic
917712946 1:177705793-177705815 CTGTGGAGGATGAAGGGTCTGGG - Intergenic
919897392 1:202017920-202017942 CTTTAGAAGCTGAAGAGGCTGGG - Intergenic
921175962 1:212594788-212594810 CTTTGTGGGCTGAAGCTACTGGG + Intronic
923351607 1:233112844-233112866 CTTTGAAGGCTGAAGGGCAGAGG + Intronic
923867130 1:237951487-237951509 ATTGGTAGGCTTAAGGGGATTGG + Intergenic
923918059 1:238530595-238530617 CTTTCAAGGCTGCAGGGGCAGGG + Intergenic
924543260 1:245001262-245001284 CTTTATAGGCTAAATGGTCTTGG - Intronic
1064397239 10:14991810-14991832 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1064534698 10:16346645-16346667 CATAGTAGGGAGAAGGGGCTGGG - Intergenic
1065368288 10:24955647-24955669 CTTTTAAGGTTGATGGGGCTAGG + Intergenic
1068298522 10:55107737-55107759 TTTTGGAGGCTGAGGGGGGTGGG - Intronic
1069236145 10:66076649-66076671 CTTTATAGGCTTCAGGGACTGGG + Intronic
1069913950 10:71775734-71775756 GTGTGCAGGCTGCAGGGGCTGGG - Intronic
1069959450 10:72071035-72071057 CTTAGAAGGCTGCAGGGGCATGG - Intronic
1070305841 10:75238727-75238749 CTCTGTTGGCTGCAGGGTCTGGG - Intergenic
1072741408 10:97912256-97912278 CTTTGAAGCCTGAAAGTGCTGGG - Intronic
1072874952 10:99162733-99162755 CTTGGTAAACTGAAGGGGCAGGG - Intronic
1073293779 10:102426027-102426049 CTATGTAGGGTTAAGGGGCATGG - Intronic
1075694621 10:124424579-124424601 CTTGGTAAGCTGAATGGGCCTGG - Intergenic
1075840540 10:125498629-125498651 CGTTGCATGCTGCAGGGGCTTGG + Intergenic
1077667747 11:4129174-4129196 CTTTGAAGGCAGAAGGGTTTAGG + Intronic
1078267552 11:9766311-9766333 CTTTGTGGGCAGAATGAGCTTGG - Intergenic
1079252902 11:18800416-18800438 CTTGGAAGGGTGAAGGGGGTGGG + Intergenic
1083486103 11:62983914-62983936 CTGGGTAGGGTCAAGGGGCTGGG - Intronic
1084261135 11:67979476-67979498 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1084844596 11:71889083-71889105 CTTTCTAGGCTGAAGTGGCCTGG - Intronic
1084909161 11:72373607-72373629 CTTTGGAGGATGAAGAGGATGGG - Intronic
1085353409 11:75815311-75815333 GTTTCTAGGCTGCAGGGGCTTGG + Exonic
1086568113 11:88250005-88250027 CTTTGGAGGCTTATTGGGCTTGG - Intergenic
1087116696 11:94533091-94533113 CTTTGTAAGGGGTAGGGGCTGGG - Intergenic
1088630178 11:111766629-111766651 CGTTGTAGTCTGAAGGAGCCAGG + Intergenic
1089108585 11:116036110-116036132 CTTTGAGGGGTGAAGGGGATGGG + Intergenic
1090941838 11:131393870-131393892 CTTAATAGGCTGAAGGAGGTAGG - Intronic
1092432394 12:8420032-8420054 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1094570154 12:31634547-31634569 CTTTGGAGGCTGAAGTGGGAGGG + Intergenic
1095951303 12:47783387-47783409 CTTCCTAGGCTCTAGGGGCTAGG - Exonic
1096558120 12:52416373-52416395 CTGTGTAGGCTGAAAGGGCTGGG + Intergenic
1097118651 12:56717170-56717192 CTTTGGGGGCTGAAGTTGCTGGG + Intronic
1100608748 12:96172957-96172979 TTTAGCAGGCTGAAAGGGCTAGG + Intergenic
1101012311 12:100463577-100463599 CTTTGTGTGCTTCAGGGGCTGGG - Intergenic
1101162534 12:101993860-101993882 CTTTGTTGGCTCAAGGCCCTGGG + Intronic
1101713651 12:107291537-107291559 GTTTATAGCCTGAAGGGGTTAGG + Intergenic
1102119352 12:110428845-110428867 CTTTGTAGGGAAGAGGGGCTGGG - Intergenic
1102867479 12:116385679-116385701 CTTTGGAGGCTGAGGCGGGTGGG - Intergenic
1103565432 12:121812947-121812969 CTTTGAAGGCTGAGGGGGAGTGG - Intronic
1103734732 12:123052986-123053008 CTTGGGAGGCTGAAGGGGGAGGG - Intronic
1104144207 12:126017349-126017371 CTTTGTAGATGGAAGGGGCCAGG - Intergenic
1107544176 13:41421598-41421620 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1110583076 13:77155385-77155407 CTTTGAAGGAGGAAAGGGCTGGG + Intronic
1111205667 13:85006711-85006733 CCTTGTAAGCTGAAGAGTCTAGG - Intergenic
1111987366 13:95078689-95078711 CTTTGTAGGGTAATGGGGCCTGG - Intronic
1112066469 13:95798535-95798557 CTTTGTAAGTTAGAGGGGCTCGG - Intergenic
1114551241 14:23534026-23534048 CCTGGAAGGCTGCAGGGGCTGGG + Exonic
1117339812 14:54783546-54783568 CTCTGCAGGCAGTAGGGGCTCGG - Intronic
1117406877 14:55412214-55412236 CAAAGTAGGGTGAAGGGGCTGGG + Intergenic
1120832267 14:89008141-89008163 CTTGGTAGGCTGAGAGGGCCAGG - Intergenic
1122810658 14:104286174-104286196 GTTTGGAGGCTGGAGGGGCAAGG + Intergenic
1123144861 14:106119009-106119031 GTTTGTGGGGTGAAGGGGCTTGG - Intergenic
1123162413 14:106291401-106291423 GTTTGTGGGATGAAGGGGCTTGG - Intergenic
1124625390 15:31304649-31304671 CTTTGCAAGCTGGAAGGGCTGGG + Intergenic
1125007398 15:34833195-34833217 CATTCTTGGCTGAAGGGGCTAGG + Intergenic
1125649153 15:41299287-41299309 ATTTCTAGGCTGAAAAGGCTGGG + Intergenic
1126033690 15:44526780-44526802 CTGTGTGAGCTGAAGGGGCTGGG - Exonic
1126815092 15:52446628-52446650 TTTTCTAGGCTGAAGGTGCAAGG - Intronic
1127134861 15:55909626-55909648 CTTTGTAGGCTGAAGGGGCTTGG - Intronic
1127239704 15:57099155-57099177 CTTTTTAGGCTGTAGAGGCAGGG - Intronic
1127803915 15:62501134-62501156 CTCAGAAGGCTGAAGGAGCTTGG + Intronic
1129084011 15:73069059-73069081 CTTGGGAGGCTGAAGGGGGGAGG - Intronic
1129384420 15:75188129-75188151 CACTCTATGCTGAAGGGGCTGGG - Intergenic
1129413634 15:75362841-75362863 CTTTCCAGGGTGAAGGGCCTGGG - Intronic
1131232245 15:90667714-90667736 TTTGGGAGGCTGAAGGGGGTGGG + Intergenic
1136694335 16:32063970-32063992 GTTTGTGGGGTGAAGGGGCTTGG + Intergenic
1136794834 16:33007233-33007255 GTTTGTGGGGTGAAGGGGCTTGG + Intergenic
1136875074 16:33847152-33847174 GTTTGTGGGGTGAAGGGGCTTGG - Intergenic
1137569112 16:49553126-49553148 CTCTGAAGGCAGAAGGAGCTGGG + Intronic
1137711575 16:50570735-50570757 CTTTGGAGGCAGAACGGGGTAGG + Intronic
1137725587 16:50654691-50654713 CCTTGTAGTCAGAATGGGCTGGG - Intergenic
1139354116 16:66357161-66357183 CTGTGGAGGCTGATGGGGCGAGG - Intergenic
1141162178 16:81636791-81636813 CTTTGGAGACGGAAGTGGCTCGG - Intronic
1203097095 16_KI270728v1_random:1268884-1268906 GTTTGTGGGGTGAAGGGGCTTGG + Intergenic
1143184204 17:5000611-5000633 CTTTGGTGGCTGGAGGGGGTGGG + Intronic
1144740542 17:17579932-17579954 CCTTGTTGGCTGCAGGCGCTGGG - Intronic
1145779521 17:27553108-27553130 CTTTGGAAGGTGAAAGGGCTTGG - Intronic
1146721075 17:35123977-35123999 TTTTGTAGACTGAAGAGTCTGGG - Intronic
1147511635 17:41074560-41074582 CTTGGGAGGCTGAAGTAGCTAGG - Intergenic
1149251550 17:54776059-54776081 CTGTGGAGGCTGAACGTGCTTGG - Intergenic
1149854644 17:60070260-60070282 CTTTGCTGGCTGAAGAAGCTGGG + Intronic
1151322529 17:73360416-73360438 CATTCTTGGCTGAAGGGGGTGGG + Intronic
1153392586 18:4578914-4578936 CTTGGTAGGCTCATGTGGCTTGG + Intergenic
1154055837 18:11013303-11013325 CTTTGAAGACAGAAGGGGCCAGG + Intronic
1154193470 18:12249157-12249179 GTTTGTAGGCAGAAGGGCCAGGG - Intergenic
1154281278 18:13005353-13005375 CTGTGCAGTCTTAAGGGGCTTGG + Intronic
1161106822 19:2447898-2447920 CACTGTAGGCTGACGGGACTTGG - Intronic
1162567139 19:11450797-11450819 CTTTGAAGGCTGTTGGGGCCTGG - Exonic
1162646412 19:12053245-12053267 CCGTGTAGGATGAAGGGGCAGGG - Intergenic
1165312787 19:35039103-35039125 CTCTGTTGGCTGCAGGGGCCAGG - Intronic
1165729777 19:38137593-38137615 CTTTGAAGGCAGCATGGGCTGGG - Intronic
1165944908 19:39436128-39436150 CTCTGTGGGCGGAAGGGGCGGGG + Intergenic
1166042650 19:40213068-40213090 CCCCGCAGGCTGAAGGGGCTGGG + Exonic
1166098560 19:40556943-40556965 CATTGTAGGCTGGAGGGGGCTGG + Intronic
1166737766 19:45096277-45096299 GTTTGTGGGCTGAAGGGTCAGGG + Intronic
1167052723 19:47089601-47089623 CTTTGTCAGGTGATGGGGCTGGG + Intronic
1167317251 19:48771724-48771746 CTTGGGAGGCTGAAGTGGGTGGG + Intergenic
926803794 2:16686012-16686034 CTTGCTGGGCTGAAAGGGCTAGG + Intergenic
927155748 2:20220202-20220224 CGTTTTGGGCTGAGGGGGCTGGG - Intronic
931489181 2:62725695-62725717 CTTTGGAGGCAGCAGTGGCTGGG + Intronic
933084822 2:78042908-78042930 TTTTGGAGGTTGCAGGGGCTGGG + Intergenic
933733134 2:85473258-85473280 CTGGGTATGGTGAAGGGGCTGGG - Intergenic
936068946 2:109352840-109352862 CTTTGCTGTCAGAAGGGGCTGGG - Intronic
937335525 2:121059936-121059958 CTTGGCAGGCTGATGGGCCTGGG + Intergenic
938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG + Intronic
938945539 2:136208805-136208827 CTTTGTAAAGTGAAGGGACTTGG + Intergenic
939017731 2:136920959-136920981 CTTTGAAGCCTGCAGGGGTTGGG + Intronic
939690353 2:145252599-145252621 CTTTGAAGGCTCAAGAGTCTAGG - Intergenic
941892624 2:170597417-170597439 CTTGGTTGGCTGAAGAGTCTGGG - Intronic
942653145 2:178189679-178189701 CTTTGAGGGCTGAGGGGCCTTGG - Intergenic
942734816 2:179097414-179097436 CATTGTAGGCTTAAGGGATTTGG - Intergenic
942798713 2:179851340-179851362 CTTTGTAGGCTGAGGTGGAAGGG + Intronic
945336060 2:208593879-208593901 CTTTGGAGGCTGAGGTGGATGGG - Intronic
948161779 2:235830586-235830608 CTTTGGGGGCTCAGGGGGCTTGG + Intronic
948705902 2:239792355-239792377 CTGGGAAGGCAGAAGGGGCTGGG - Intronic
948788871 2:240366754-240366776 CTTTGTCGGCAGAGGGGCCTGGG + Intergenic
1168888808 20:1280392-1280414 ATAAGTAGGCTGAAGAGGCTTGG + Intronic
1169127314 20:3138847-3138869 CTTTGTAGGCTGAAGGAAGCTGG - Intronic
1169490465 20:6067239-6067261 CTTTGTAGGTTGGCGGGGCCGGG - Intergenic
1169892883 20:10472595-10472617 CTTTGGAGGCAGAAAGGCCTGGG + Intronic
1170789666 20:19497282-19497304 CTTTTTGGGTAGAAGGGGCTAGG + Intronic
1173058243 20:39636748-39636770 CTCTGCAGGCTGAGGGAGCTGGG - Intergenic
1173186610 20:40845062-40845084 CTTTGAAGGGAGAAGGGGCTGGG - Intergenic
1174545550 20:51322496-51322518 ATTTGGAGGCTGAAGCGGCAAGG - Intergenic
1175065932 20:56288702-56288724 CATTTTTGGCTGAAGGAGCTGGG - Intergenic
1181319833 22:21995658-21995680 CTTGCTAGGCTGTAGAGGCTTGG + Intergenic
1181359815 22:22325629-22325651 CTTTGTGTCCTGAAGGGGCAGGG - Intergenic
1181369880 22:22407362-22407384 CTTTGTGTCCTGAAGGGGCAGGG - Intergenic
1182008419 22:26980485-26980507 CTTTTTGGGCTGAAGGGGCATGG + Intergenic
1182411593 22:30191472-30191494 CTTTGTACCCTGAAGGGGAGGGG - Intergenic
1184068017 22:42131102-42131124 CTTTGCAGGCTTCAGGAGCTTGG - Intergenic
1184289480 22:43490737-43490759 TTCTGTTGGCTGATGGGGCTGGG + Intronic
1184413310 22:44338137-44338159 CCTTGGAGGAGGAAGGGGCTGGG - Intergenic
949599300 3:5580962-5580984 CTCTCTAGGCTGCAGGGGCAAGG - Intergenic
950148323 3:10667370-10667392 CTCTGGAGGCTGAGGGGGCTGGG + Intronic
950199235 3:11031079-11031101 CTCTGGAGGCTGATGGGGCTGGG - Intronic
950430831 3:12950002-12950024 CTTTCTGGGCTGATGTGGCTGGG + Intronic
950874680 3:16260781-16260803 CTTTGTTGGCTGAAGGGGCTGGG + Exonic
951363327 3:21750741-21750763 CTTTGAAGGCTGCACCGGCTTGG + Intronic
951435370 3:22656896-22656918 CTATGTTTGCTGAAGGGCCTGGG + Intergenic
953824672 3:46240519-46240541 CCATGTGGGCTGAAGGGACTGGG - Intronic
955322289 3:57982933-57982955 TGGTGTAGGCTGAAGGGGCATGG - Intergenic
955543758 3:60005394-60005416 CTCTCCAGGCAGAAGGGGCTGGG - Intronic
957044406 3:75362854-75362876 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
957076203 3:75605037-75605059 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
959862938 3:111236110-111236132 CTGTGTAGACTGAAAGAGCTGGG - Intronic
960903662 3:122576879-122576901 CCATCTAGGCTGAAGGGGCAAGG - Intergenic
960916676 3:122702164-122702186 TCTTGTAGGCTGCAGGGGCATGG + Intronic
961275099 3:125720145-125720167 CTTTCTGGGCTGAAGTGGCCTGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961876399 3:130026888-130026910 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
964887308 3:161499229-161499251 CTTTGTAGCCTCTAGGGCCTTGG - Exonic
967690154 3:192464294-192464316 CTTTGGAGGCTCAAGGGGAAGGG - Intronic
967758143 3:193193521-193193543 CTTGGTAGGCTGAAGGGAAGTGG - Intergenic
967781341 3:193443195-193443217 CCTTGTAGGCTAAAGGGCATGGG + Intronic
968032906 3:195518199-195518221 GTTGCTAGGCTGCAGGGGCTGGG + Intronic
968988672 4:3894094-3894116 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
969439164 4:7207329-7207351 CTGTGTGGGCGGGAGGGGCTCGG - Intronic
969729462 4:8945428-8945450 CTTTCTGGGCTGAAGTGGCCTGG - Intergenic
969793788 4:9510135-9510157 CTTTCTGGGCTGAAGTGGCCTGG - Intergenic
969860110 4:10028916-10028938 CTTTGAAGGCTGGAAGGGATTGG - Intronic
970135115 4:12913551-12913573 CACTGTAGGCAGTAGGGGCTTGG - Intergenic
972286189 4:37650801-37650823 TTTGGGAGGCTGAAGGGGGTGGG + Intronic
973002447 4:44967929-44967951 CTTTGTAGGATCAATGGACTGGG - Intergenic
974220774 4:58968290-58968312 CAGTGTAGGATGGAGGGGCTTGG + Intergenic
980237310 4:130125672-130125694 GCTTGTAGGGTGAAAGGGCTTGG - Intergenic
985025219 4:185733512-185733534 ATTGGTGGGCTGGAGGGGCTTGG + Intronic
987427399 5:17789019-17789041 CTTTGGAGGCTGAAGCGGGCAGG + Intergenic
987718944 5:21610268-21610290 CTTTGGAGGATAATGGGGCTGGG - Intergenic
988428404 5:31090936-31090958 CTTTGTTGGCTTAAAGGGCTTGG + Intergenic
989266970 5:39486304-39486326 CTTTGAAGGCAGAGGGAGCTAGG - Intergenic
990008232 5:50966788-50966810 CATTGTATGTTGAAGGGGCGGGG - Intergenic
990965846 5:61447041-61447063 CTTTGGAGTCTGAGGGGGTTTGG - Intronic
991202316 5:64008639-64008661 CTTTGAAGGATGAAGGGGAACGG - Intergenic
993090645 5:83421904-83421926 CTTTGTAAGCTGATATGGCTTGG + Intergenic
995543755 5:113209437-113209459 CTCTGTAGGCTTTATGGGCTGGG - Intronic
995834992 5:116391340-116391362 CCTTGAACACTGAAGGGGCTAGG - Intronic
999119082 5:149195141-149195163 ATTTGTAAGATGAAGGGGCTGGG - Intronic
999161990 5:149509166-149509188 CTTGGTAGGCTGAAGGAGGGTGG - Intronic
1000028175 5:157378012-157378034 CACTGTGGGCTGGAGGGGCTTGG + Intronic
1001527224 5:172437505-172437527 CTTTGGAGGCTGGCAGGGCTGGG - Intronic
1003081300 6:3023893-3023915 GATTGTAGGCTGCAGAGGCTGGG + Intergenic
1003127916 6:3370553-3370575 CACTGCATGCTGAAGGGGCTGGG - Intronic
1003268707 6:4588978-4589000 CTTTGAAGGCTGCAGGAGATAGG - Intergenic
1004372225 6:15062417-15062439 TTTTGTAGACTGAGGGGCCTGGG - Intergenic
1006848161 6:37077785-37077807 CCTTTTAGGCTGAAGGGGGCAGG - Intergenic
1008786767 6:55177181-55177203 CTTTTTAGGCTGAATGGAATTGG - Intronic
1009287674 6:61842301-61842323 CTGTGTAGGCTGACAGGGCCTGG + Intronic
1011724083 6:90190673-90190695 CTTTGTAAGCTGAAGCCCCTTGG + Intronic
1011876366 6:91966600-91966622 TTTTACAGGCTGAAGGGACTAGG + Intergenic
1014969079 6:127791938-127791960 CTTTTGAGCCTGAAGGGGCAAGG + Intronic
1015244382 6:131061668-131061690 GTTTCTATGCTGCAGGGGCTAGG - Intronic
1015738882 6:136431876-136431898 CTTTGAAGACTGAAGTGGTTAGG + Intronic
1016807394 6:148225556-148225578 CTTTGGAGACTGAAGGGGAAAGG + Intergenic
1019640899 7:2103156-2103178 CTTTGTAGGGTGCAGGGGCAGGG - Intronic
1020307040 7:6843364-6843386 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1020311516 7:6872208-6872230 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1021002440 7:15349406-15349428 CTTTATAGGTTGAAAGGGCATGG + Intronic
1021466043 7:20944565-20944587 CTTTGTAGCTTGAAGGGGTAAGG + Intergenic
1023312714 7:38903840-38903862 CCCAGTAGGCTGAATGGGCTTGG - Intronic
1023600851 7:41880494-41880516 CTTTGTAGGCTTATAGGGCCTGG - Intergenic
1025907934 7:65803001-65803023 TTTTGGAGGCTGAAGTGGGTGGG - Intergenic
1026931194 7:74223880-74223902 CTTTGAAGCCTGAAGGCTCTCGG + Intronic
1029078194 7:97952308-97952330 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1029731105 7:102438858-102438880 CTCTGTAGGTTGAATGGGCTTGG + Intronic
1031503223 7:122547787-122547809 CTTTGTAGGGTGAACAGGATGGG + Intronic
1033544974 7:142391602-142391624 CAGTGGAGGGTGAAGGGGCTGGG + Intergenic
1033634993 7:143203954-143203976 GCTTGTAGGCAGGAGGGGCTGGG + Intergenic
1036262061 8:7248959-7248981 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1036304529 8:7590599-7590621 CTTTCTGGGCTGAAGTGGCCTGG - Intergenic
1036314100 8:7707498-7707520 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1036355382 8:8038591-8038613 CTTTCTGGGCTGAAGTGGCCTGG - Intergenic
1036419508 8:8582900-8582922 TTCTGAAGGCTGGAGGGGCTGGG - Intergenic
1036816626 8:11907422-11907444 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1037371544 8:18184373-18184395 CTTTGTGGGCAGAAGGGTTTTGG - Intronic
1038037563 8:23699455-23699477 CTCGGTTGGCTGAAGGGGTTTGG - Intergenic
1038126580 8:24679976-24679998 CTTTGTTGCCGGAAGGGGCCCGG - Intergenic
1041009006 8:53523371-53523393 CTTTCTGGGCTGAAGTGCCTTGG + Intergenic
1042272578 8:66970236-66970258 CTTTGGAGGCTGAAGTGGGAGGG - Intronic
1044013904 8:87027591-87027613 CTTTGGAGTCTGAAGAGGTTTGG - Intronic
1045714749 8:105028036-105028058 ATTAGTAGGCTTAAGTGGCTGGG + Intronic
1046867465 8:119166729-119166751 CTCTGTATGCTGAAGGGTCATGG - Intronic
1049226026 8:141450882-141450904 CTTTGGAGTCAGAAGGGTCTAGG + Intergenic
1049662379 8:143825306-143825328 CTCTGGAGGCTGAAGGACCTGGG - Intronic
1055339162 9:75263307-75263329 CTATGTTCGCTGAAGGGCCTAGG + Intergenic
1056536874 9:87536021-87536043 CTTGGGAGGCGGAAGAGGCTGGG - Intronic
1056865832 9:90226699-90226721 CTTTCTGGGCTGAAGTGGCCTGG - Intergenic
1056917187 9:90756203-90756225 CTTTCTGGGCTGAAGTGGCCTGG + Intergenic
1057784444 9:98076092-98076114 CTTTGAGGCCTGAAAGGGCTCGG + Intronic
1057907872 9:98996236-98996258 CTTTCTAAGCTAAAGGGGCTGGG - Intronic
1058379352 9:104361558-104361580 CTTTGAAGGATGAAGGGGAACGG - Intergenic
1059476427 9:114551500-114551522 CTTGGGAGGCTGAAGGGGGAGGG - Intergenic
1059869912 9:118561505-118561527 CTTTGAAGGCTTAATGGGCTAGG + Intergenic
1061239108 9:129358874-129358896 CTCTGAAGGCTGCAGGGGCACGG + Intergenic
1061901703 9:133675983-133676005 CTTGGAAGGCTGAAGGGGGGAGG + Intronic
1186526980 X:10257790-10257812 CTTTGTTGGCTCAAGGAACTGGG + Intergenic
1186710319 X:12187889-12187911 GTTTGCAGTCTGAAGGTGCTTGG - Intronic
1187671147 X:21667243-21667265 CTTTGTAGGGTGACAGGGCAGGG - Intergenic
1187944477 X:24412750-24412772 CATTCTAGGCTGAAAAGGCTTGG - Intergenic
1190109894 X:47582918-47582940 GTTTGGAGGTTGAAGGGGTTGGG - Intronic
1192276961 X:69642198-69642220 CTTTAGAGGCTGAAAGGCCTGGG + Intronic
1195179095 X:102339557-102339579 GTTTCTAGGCAGAAGGGGGTGGG - Intergenic
1200124134 X:153805328-153805350 CTCTGAAGGCTGAGGGGGCTGGG - Intronic
1200436148 Y:3154155-3154177 CTATGTTTGCTGAAGGCGCTGGG + Intergenic
1201297874 Y:12480296-12480318 TTTGGGAGGCTGAAGGGGGTGGG + Intergenic