ID: 1127136290

View in Genome Browser
Species Human (GRCh38)
Location 15:55927177-55927199
Sequence CTGAGCTAAGACTTGAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127136290 Original CRISPR CTGAGCTAAGACTTGAAAGT TGG Intronic
901357654 1:8665171-8665193 TTGAGCTATGACTTGAAGGAAGG - Intronic
902511231 1:16967983-16968005 CTGGGCTAAAACTGGAAGGTGGG + Intronic
902557044 1:17253064-17253086 CAGAGCTAAAACTAGAAACTAGG + Intronic
903232110 1:21928154-21928176 CTGGGCCAAGACTTGAAGGCAGG + Intronic
903571956 1:24312293-24312315 CTGAGCTAAGTCTTGAATCTGGG - Intergenic
903916632 1:26769539-26769561 CTGAGCTAAGTCTTCATGGTTGG - Intronic
905304094 1:37005647-37005669 CAGAGCAAAGACGTGACAGTGGG + Intronic
905991307 1:42339222-42339244 ATGAGCCAAGACTTGCAAGAGGG + Intergenic
906072258 1:43025604-43025626 TTGAGCTAAAACATGAAAGAAGG - Intergenic
906292679 1:44630061-44630083 CTGAGCTAGGCCTTGAAACCAGG + Intronic
906534136 1:46542414-46542436 GTGAGCTCAGACTAGGAAGTGGG - Intergenic
906669717 1:47645597-47645619 CTGAGCTAAGCCTTCAAGGATGG + Intergenic
907559764 1:55377847-55377869 CTGTACTAAGTCTTGAAAGGGGG - Intergenic
910497729 1:87851661-87851683 CTGAGCTCTGACCTGACAGTGGG - Intergenic
910521543 1:88127459-88127481 TTGAGCAAAAACCTGAAAGTGGG - Intergenic
910553335 1:88501227-88501249 CTGAGCTGAGACTCAAAAGATGG + Intergenic
911615735 1:100008680-100008702 CTGAGCTGAGTCTTAAAGGTAGG - Intronic
912552909 1:110495855-110495877 TTGAGCAAAGACATGAAAGATGG + Intergenic
912718650 1:112001708-112001730 CTGAGCTGAGCCTGGAAAGAAGG + Intergenic
913984233 1:143550911-143550933 CTGAGCAAAGACTTGGAAGCTGG + Intergenic
916124606 1:161558081-161558103 CTGTGATAAGAACTGAAAGTTGG - Intergenic
916134496 1:161639431-161639453 CTGTGATAAGAACTGAAAGTTGG - Intronic
917496781 1:175547495-175547517 CTGAGCTGATACTTGAAGGATGG + Intronic
918320360 1:183358483-183358505 CTGAGCTGAGCCTTGAAAAGTGG + Intronic
918943928 1:191036156-191036178 TGGAGCTAAGACTTGAAACCAGG + Intergenic
920169847 1:204065203-204065225 CTCAGCTAAGGCTTGAATCTTGG + Intergenic
921331207 1:214038408-214038430 TTGAGCTAAGATTTGAAAGATGG - Exonic
922281694 1:224131408-224131430 CTGTACTAAGTTTTGAAAGTGGG - Intronic
922962183 1:229657418-229657440 CAGCGCTAAGACTTGAACCTAGG - Intronic
923032040 1:230256934-230256956 GTGAGTTCAGACTTGAAAGGTGG + Intronic
923146393 1:231201659-231201681 CTGAGCTGGGACTTGAACCTAGG - Intronic
923184914 1:231561674-231561696 CAGAGCTAAGATTTGAAGTTAGG + Intronic
923209362 1:231789194-231789216 GTGAGCAAAGACTTGCAGGTGGG + Intronic
923737727 1:236627339-236627361 TTGAGCAAAGACTTGAAAAAAGG - Intergenic
924318782 1:242826372-242826394 TTGAGCTAATACTTGAAGGAGGG + Intergenic
1063296946 10:4816039-4816061 CTAAGTTAGGACTTCAAAGTTGG - Intronic
1063393106 10:5662974-5662996 CTGAGCCCAGACTTGTAAGTGGG - Intronic
1064823778 10:19371546-19371568 CTGGGCCAAGATTTGAAAATTGG - Intronic
1065996814 10:31067163-31067185 CTGAGATATGTCTTCAAAGTAGG + Intergenic
1066026804 10:31366077-31366099 TTGAGCAAAGACTTGAAAGCGGG - Intronic
1066223218 10:33356312-33356334 CTTAGCTCAGACTTGAAGGATGG - Intergenic
1066497805 10:35959368-35959390 CTGATTTAAGACTTAAAAGGAGG - Intergenic
1067397385 10:45934602-45934624 CTGAGCTGAGTCTTGAAGGCTGG + Intergenic
1067865705 10:49903689-49903711 CTGAGCTGAGTCTTGAAGGCTGG + Intronic
1067898560 10:50213340-50213362 CTGAGCTAAGACTTGAAGCCAGG + Intronic
1068346516 10:55786750-55786772 TTGAGCTCAGAATTAAAAGTGGG + Intergenic
1068601756 10:58964208-58964230 CTTAGCAAAGAGTTGAAAGTTGG - Intergenic
1069532455 10:69229414-69229436 CAGAGCCAAGATTTCAAAGTAGG - Intronic
1069642221 10:69963344-69963366 CTGAGCTGGGCCTTGAAAGGAGG - Intronic
1070568195 10:77619883-77619905 ATGAGCTAAGACTTGGAGGATGG + Intronic
1070625468 10:78047909-78047931 CAGAGCTAAGGCTTGAAAACAGG - Intronic
1070658167 10:78285442-78285464 CTGAGCTAAGACTTCAACTCAGG - Intergenic
1071732608 10:88263696-88263718 CTGAGCTGAGACTTGAACTCAGG - Intergenic
1072200334 10:93152089-93152111 CAGAGCTAAGACTTGAACCCAGG + Intergenic
1072759592 10:98045444-98045466 CTGATCAGAGACTAGAAAGTGGG - Intergenic
1073109294 10:101051238-101051260 CAGAGCTAAGACTTGAACCTGGG - Intergenic
1073872436 10:107880507-107880529 ATGAGCTAAGGCCTGAAACTTGG - Intergenic
1074823168 10:117196713-117196735 CTGAGCTGAAAATTGAAAGGTGG + Intergenic
1074869437 10:117565208-117565230 CTGAGCTGAGAATGGAAAGATGG + Intergenic
1074897834 10:117792448-117792470 CTAAGCTGAGACTTGAAGCTAGG + Intergenic
1077334539 11:1997553-1997575 CTGAGCTAGGGCTGGAAAGAAGG - Intergenic
1077637069 11:3850239-3850261 TTGAGCTGAGACTTGAAGGATGG + Intergenic
1078884962 11:15490875-15490897 CAGTGCTTAGACTTGAAAGATGG + Intergenic
1079283591 11:19109313-19109335 CTGTGTAAAGACTTGAAAGCTGG + Intergenic
1079494194 11:21022678-21022700 ATGAACTCAGACTTGAAACTAGG - Intronic
1080842241 11:35995195-35995217 CCTAAATAAGACTTGAAAGTTGG + Intronic
1081964116 11:47159196-47159218 CTGGACTAAGACTAGAAAGGAGG + Intronic
1082262023 11:50083708-50083730 TTGAGCAAAGACTTGAAGGAGGG - Intergenic
1082675681 11:56099140-56099162 GTGAGCAAAGACTTGAAGGAGGG - Intergenic
1083119369 11:60496004-60496026 CAGAGTTAGGACTTGAAAATGGG - Intronic
1083174427 11:60940569-60940591 CTGAGCTATGTCTTTAAAATGGG - Intronic
1084682180 11:70672875-70672897 CAGAGCCAGGACTAGAAAGTGGG - Intronic
1085384940 11:76152238-76152260 CAGAGCTAGGACTTGAAATCAGG + Intergenic
1085479317 11:76808272-76808294 TTGAGCTGAGACTTAAAAGAAGG + Intergenic
1085824306 11:79827323-79827345 CTAAGTTAAGACTTGAAGGATGG + Intergenic
1086295419 11:85361743-85361765 CTGAGCTAAAAGATCAAAGTTGG - Intronic
1086855181 11:91857744-91857766 CTTAGCTCAGACTTTAGAGTTGG + Intergenic
1086971222 11:93083210-93083232 ATGAGCAAAGGCTTGAAGGTGGG - Intergenic
1087590211 11:100177584-100177606 CTAAGCACAGACTTGAAAATGGG - Intronic
1089178046 11:116562327-116562349 CTGAGCTAAGATTTGAATCCTGG - Intergenic
1091146402 11:133283823-133283845 CTGAGCACAGACTAGAAAGTGGG - Intronic
1091155308 11:133366504-133366526 CTGAGCTGGGGCTTGAAATTGGG + Intronic
1202817522 11_KI270721v1_random:52735-52757 CTGAGCTAGGGCTGGAAAGAAGG - Intergenic
1091857504 12:3751588-3751610 CTGAGCAAAGCCGTGAAGGTGGG - Intronic
1092871088 12:12806401-12806423 TTAAACTGAGACTTGAAAGTTGG - Intronic
1093410398 12:18858334-18858356 TTGAGCAAAGACTTGAAGGAGGG - Intergenic
1093540253 12:20274211-20274233 CTGAGCTAAGACTAGGATGGAGG - Intergenic
1095179722 12:39133584-39133606 CTTAGATAGGACTTGAAAGCTGG + Intergenic
1096915471 12:55027288-55027310 CTGAGCTTAGACTTGAAGAAGGG - Exonic
1098254603 12:68604070-68604092 CTCAGCTAAGACTTGAGATGGGG + Intergenic
1098679635 12:73335999-73336021 CAAAGCTAAGATTTGAACGTAGG - Intergenic
1098985546 12:77008018-77008040 CAGAGCTAAGACTTGACCCTGGG - Intergenic
1100362532 12:93891760-93891782 CTGAGCTGAGACTTGAATGCCGG + Intronic
1102017735 12:109659045-109659067 CAGAGCCAAGACTTGAACTTGGG + Intergenic
1102277461 12:111593952-111593974 TTGAGCAAAGATTTGAAGGTTGG - Intronic
1102449546 12:113030510-113030532 CTGAGCTAGGACTTGAACCCAGG + Intergenic
1105603961 13:21911531-21911553 CTGAGCTGAGTCTTAAAAGATGG - Intergenic
1107056456 13:36109743-36109765 CTGAGCCAAGACTTGAATCCTGG + Intronic
1107821052 13:44286046-44286068 CTGAGCTGAGTGTTGAAAGGTGG - Intergenic
1108365799 13:49711115-49711137 CTAAGCTAAAACTTGAAATTTGG - Intronic
1108392620 13:49961709-49961731 CTGAGCTAAAAGCTGAAAGCTGG - Intergenic
1108911627 13:55559994-55560016 CTGAGAAAGGACTTGAAAGGTGG + Intergenic
1109722876 13:66298924-66298946 TTAAGCTAAGACTTGAAGCTAGG + Intergenic
1110162885 13:72400599-72400621 ATGAGCTAAGATTTGAAAGATGG + Intergenic
1110164794 13:72428016-72428038 CTGAAGTAAGACATGTAAGTGGG + Intergenic
1110299291 13:73907426-73907448 CTGAGCTGGGTTTTGAAAGTAGG - Intronic
1110738752 13:78969531-78969553 CTGAGCTGAGTGTGGAAAGTTGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1113804345 13:113104601-113104623 CTGAGCTAAGACTTGGCTGTTGG + Intergenic
1114752013 14:25215455-25215477 TTGAGCAAAGACTTGAGAGAAGG + Intergenic
1115266489 14:31506176-31506198 CTGAGCTGAGACTTGAATTTAGG + Intronic
1115779553 14:36754289-36754311 CTGAGCTCAGCCTTTAAACTGGG + Intronic
1115876644 14:37868922-37868944 CAGAGCTAAGGTTTGAATGTGGG + Intronic
1116377933 14:44227518-44227540 CTTACCTAAGCTTTGAAAGTTGG + Intergenic
1116656871 14:47665178-47665200 AACAGTTAAGACTTGAAAGTGGG - Intronic
1116786927 14:49297887-49297909 CTGTGCTAAGTATTGAACGTTGG - Intergenic
1117571556 14:57054166-57054188 CTTAGCTGGGACTTGAAAGATGG - Intergenic
1117824055 14:59682237-59682259 TTGAGCTAAGTCTTGAAATATGG - Intronic
1119647033 14:76355391-76355413 TTGGGCTGAGTCTTGAAAGTTGG - Intronic
1120403291 14:84061003-84061025 CTGAGCTAAGTCTTGATTCTGGG - Intergenic
1120847622 14:89139736-89139758 CAGAGCTAAGACTTGAACCCAGG - Intronic
1121418975 14:93799011-93799033 GTGAGCCAAGTCTTGAAAGAGGG - Intergenic
1122021470 14:98841224-98841246 AGGAGCTAAGATTTGAAAGCAGG + Intergenic
1122353332 14:101109984-101110006 TTGAGCAAAGACTTGGAGGTGGG + Intergenic
1122464195 14:101918960-101918982 CTGAGGTAAGAAGTGAAAGTAGG + Intronic
1127136290 15:55927177-55927199 CTGAGCTAAGACTTGAAAGTTGG + Intronic
1127214119 15:56806473-56806495 CTGACTCAAGTCTTGAAAGTGGG - Intronic
1128777608 15:70335461-70335483 CTGAGCCAAGTCTTGAAACCAGG + Intergenic
1130896763 15:88176573-88176595 CTGAGCCAGGACTAGAATGTGGG - Intronic
1131505160 15:93011418-93011440 TTCAGCAAAGGCTTGAAAGTGGG + Intronic
1132463156 16:65495-65517 CTGAGCAAAGGCTTGAAGGAGGG + Intronic
1135552875 16:23411773-23411795 GTCAGGTAAGACATGAAAGTGGG + Intronic
1135769748 16:25208393-25208415 CTTAGTTGAGACTTGAAAGATGG + Intergenic
1137266538 16:46873652-46873674 CAAAGCTAAGACTTGAACTTAGG - Intergenic
1137475146 16:48801364-48801386 TTGAGCAAAGACTTGAAGATAGG - Intergenic
1137606577 16:49790701-49790723 CAGAGCTGAGATTTGAAGGTGGG - Intronic
1139925616 16:70484228-70484250 CTGAGCCAGGACTTGAACCTAGG - Intronic
1139929901 16:70517840-70517862 CTGAGCTAAGAGTTACAGGTAGG - Intronic
1140071415 16:71653607-71653629 CAGAGCTGAGATTTGAAACTAGG - Intronic
1140502373 16:75444872-75444894 TGGAGCTAAGACTTAAAATTAGG - Intronic
1143266783 17:5644034-5644056 CTGGACTAAGACCTGAGAGTGGG + Intergenic
1147141506 17:38463163-38463185 CAGAGCTATGACCTGAGAGTAGG - Exonic
1147575411 17:41596069-41596091 TGGAGCCAAGACTTGAAAGCTGG - Intergenic
1147801937 17:43098002-43098024 CTGAGCTCAGAATTCAAACTGGG - Intronic
1148231154 17:45935794-45935816 TTGAGCTAAGACTTGAAGGGAGG - Intronic
1148445097 17:47732937-47732959 TTGAGCTGAGACTTCAAAGCTGG + Intergenic
1150267424 17:63840574-63840596 CTGAGCAAATAGTTGAAAGAAGG - Intronic
1151129647 17:71883179-71883201 ATAAGCTAAGGCTTGAAAGATGG + Intergenic
1151971961 17:77462381-77462403 CTGAGCTGGGACTTAAGAGTGGG - Intronic
1152126990 17:78453159-78453181 CTGAGGAAAGACTGGAAAGAGGG - Intronic
1153113719 18:1627406-1627428 GAGAGCTAAGCCTTCAAAGTAGG + Intergenic
1153328042 18:3842055-3842077 CTTAGATGAGACTGGAAAGTTGG + Intronic
1153485954 18:5598050-5598072 AAGAGCTGAGACTTGAAAGTAGG + Intronic
1153814605 18:8781856-8781878 CTCAGCTAAGAGATGACAGTGGG + Intronic
1155013727 18:21810475-21810497 TTGTGGTAAGTCTTGAAAGTAGG - Intronic
1155802026 18:30117612-30117634 TTGAGCTAATCCTTAAAAGTAGG - Intergenic
1155914712 18:31545003-31545025 TTAAGCTAATACTTGAAGGTGGG - Intronic
1156909620 18:42395165-42395187 CTGAGCTCAGACATGAAGGCGGG + Intergenic
1157058572 18:44258983-44259005 CTGAGCTGAGATTTGAACCTGGG - Intergenic
1158550246 18:58429770-58429792 CTGAGCCAAGACAAGGAAGTAGG - Intergenic
1158799481 18:60889514-60889536 CTGAGATAACCCTTGAAAATTGG - Intergenic
1158875191 18:61727083-61727105 TTGAGCTGAGTCTTGAAAGATGG - Intergenic
1158878563 18:61754800-61754822 CAGCTCTAAGACTTGAAAGCAGG - Intergenic
1162179630 19:8859215-8859237 CTGAGCTAGGATTTTAAAGGTGG + Intronic
1162801489 19:13113126-13113148 CTGAGCCAGGACTTGAACTTGGG - Intronic
1163191763 19:15682164-15682186 CAGAGCTGAGACTTGAATGCAGG + Intronic
1202646264 1_KI270706v1_random:144797-144819 TTGAGCAAAGACTTGAAGGAGGG - Intergenic
925090901 2:1155550-1155572 CTGAGCTCAGCCCTGAAATTTGG - Intronic
925427881 2:3765885-3765907 TTGAGCCAAGACTTGACAGGAGG + Intronic
926039949 2:9665039-9665061 GTGAGCAAAGACTTGGAAGAAGG - Intergenic
927013761 2:18934258-18934280 CTTACCTAAGAATTTAAAGTAGG - Intergenic
927614556 2:24579276-24579298 CTGAGGAAAGACCTGACAGTAGG + Intronic
927692840 2:25220472-25220494 CTGAGCTGAGACCTGAATGATGG + Intergenic
928192280 2:29182557-29182579 CTGAGCTAAGAATAGACTGTGGG + Exonic
928358245 2:30640374-30640396 CTGAGTTCAGACTTGCAAGGTGG - Exonic
928591778 2:32824205-32824227 TTGAACTAAGTCTGGAAAGTAGG - Intergenic
928796338 2:35025537-35025559 CTGAGCTAACACATGAAAAAGGG + Intergenic
931550401 2:63438985-63439007 CTGAGCTAAGATTTGAATACAGG - Intronic
932055454 2:68438712-68438734 AGGAGCTGAGACTTGAACGTAGG + Intergenic
932195290 2:69777764-69777786 CTGAACTAAGACCTGAATGAAGG - Intronic
932981424 2:76672921-76672943 CTGAGCTAAGATTTGAATGATGG + Intergenic
933340502 2:81019560-81019582 CTGAGCAAAGATTTGGAAGTTGG + Intergenic
934509405 2:94925226-94925248 TTGAGCAAAGACTTGAAGGAGGG - Intergenic
935055317 2:99561110-99561132 CTGAGCTGAGATTTGAACCTAGG - Intronic
936984893 2:118299827-118299849 GTGAGCTATGATTTGAAAGTTGG - Intergenic
937506027 2:122537317-122537339 CAAAGCTAAGACCTGAAACTAGG - Intergenic
937577903 2:123446670-123446692 CTGAGCAAAGGTTTGAATGTTGG - Intergenic
938623959 2:133088336-133088358 ATGAGGTAAGACTGGAAAGTGGG - Intronic
938831478 2:135053902-135053924 ATGAGCTGGGCCTTGAAAGTGGG + Intronic
941474135 2:165927377-165927399 CTGAACAAAGACTTGAAAATAGG - Intronic
941475338 2:165944882-165944904 TTGAGCTAAAACCTGAAAGATGG - Intronic
942362425 2:175186072-175186094 TTGAGCTAGGACTTGAAAGATGG + Intergenic
946009152 2:216550856-216550878 CTGAGTTAGGATTTGAAAGTAGG + Intronic
946948053 2:224842970-224842992 CTGAGCTAAGATCTGAAGGATGG + Intronic
947614389 2:231545838-231545860 CACAGCCAAGACTTGAAATTAGG + Intergenic
948131319 2:235602578-235602600 CTGAGCAAAGGCTTGAAGGAAGG - Intronic
1169220958 20:3822696-3822718 CAGAACTAAGATTTGAGAGTAGG + Intronic
1169510591 20:6259846-6259868 TTGAGCTAAGAGTAGAAAGAAGG + Intergenic
1169870615 20:10244539-10244561 CAGAGCCAAGATTTGAATGTAGG + Intronic
1169973112 20:11292425-11292447 CTGAGCTCAGAATTGAAATTGGG + Intergenic
1170973137 20:21134966-21134988 TTCAGCTAAGACCTGAAAGATGG - Intronic
1172610029 20:36243852-36243874 CAGAGCTAAGATTTGAAGCTAGG + Intronic
1173226986 20:41167918-41167940 CTGAGCTGTACCTTGAAAGTTGG - Exonic
1174527652 20:51186648-51186670 CAGAGCTAATACTTGAACCTTGG + Intergenic
1174787888 20:53449692-53449714 CTGAGCTAAGCCTTGAAGAAGGG - Intronic
1175165783 20:57043462-57043484 CTGAGCTAAGAGTTTTAAGCAGG - Intergenic
1176605610 21:8827964-8827986 TTGAGCAAAGACTTGAAGGAGGG + Intergenic
1177341584 21:19809776-19809798 TTTAGCCATGACTTGAAAGTTGG - Intergenic
1179021053 21:37641553-37641575 TTGAGCTAAGATTTGAAGGATGG + Intronic
1179210643 21:39321718-39321740 TTGAGCCAAGACTTGAAGGAGGG - Intergenic
1180347907 22:11719568-11719590 TTGAGCAAAGACTTGAAGGAGGG + Intergenic
1180355686 22:11837670-11837692 TTGAGCAAAGACTTGAAGGAGGG + Intergenic
1180382568 22:12154655-12154677 TTGAGCAAAGACTTGAAGGAGGG - Intergenic
1181922386 22:26330529-26330551 ATGAGCTAAGGCATGAAAGATGG + Intronic
1181978219 22:26747640-26747662 TTGAGCAAAGACTTCAAAGGAGG + Intergenic
1182137213 22:27917928-27917950 CTGAGCAAAGACCTGGAAGAAGG + Intronic
1182844546 22:33419525-33419547 TTGAGCTAAGACCTGAAGGATGG - Intronic
1182862170 22:33569666-33569688 CTAAGTTGAGACTTGAAAGAGGG - Intronic
1183839663 22:40488219-40488241 ATGAGCTAGGACTTGGAGGTAGG + Intronic
949935545 3:9112930-9112952 CTGAGCTCAGACTAGAAGGATGG + Intronic
950049248 3:9973937-9973959 CTGAGCTGTGACCTGAAATTTGG + Intronic
950227193 3:11245388-11245410 CTAAGTTAAGATTTGAACGTAGG - Intronic
950380951 3:12614350-12614372 GTTAGCTAAGTGTTGAAAGTGGG + Intronic
951595418 3:24313153-24313175 CTGAGCTGAGCCTTGAAAATTGG - Intronic
952087595 3:29845036-29845058 CTGAGCTAAGCCTTGAAGGCTGG - Intronic
953248630 3:41222028-41222050 CTGAGATAAAACTTGAAACTAGG - Intronic
953502084 3:43446385-43446407 CAGAGCAAAGACTTGCCAGTTGG - Intronic
953831352 3:46300223-46300245 CAAAGCTCAGACTTTAAAGTAGG - Intergenic
954441323 3:50523782-50523804 CTGAGCTATGACTTGAGCCTGGG - Intergenic
954745199 3:52783859-52783881 CTGAGCTCAGTCTAGAAAGAGGG + Intronic
955086187 3:55705252-55705274 TTGAGTTAAGATTTGAAAGTTGG + Intronic
956421843 3:69094017-69094039 CTGAGCTGAGACTTGAAGGAGGG + Intronic
956874465 3:73448176-73448198 CTGAGCTGGGATTTGAAATTAGG - Intronic
957408654 3:79807378-79807400 CTGAGCTAGGACTCAAAAGTGGG + Intergenic
960067338 3:113387753-113387775 AAGAGCTAAGGCTTGAAATTGGG - Intronic
960844292 3:121992804-121992826 ATGAGCTAGGACTTGAATGCAGG - Intronic
961337767 3:126193317-126193339 TTGAGCTAAGACTTTAAGGAAGG - Intronic
962565502 3:136654738-136654760 TTGAGGTAAGTTTTGAAAGTAGG - Intronic
963942307 3:151107313-151107335 CTGAGCTCTGACTGCAAAGTAGG - Intronic
966922730 3:184624258-184624280 TTGAGCTGGGACTTGAAAGCAGG + Intronic
967492119 3:190104676-190104698 CCGTGCTAGGAATTGAAAGTAGG - Intronic
967751952 3:193125337-193125359 CAGAGCTAGGACTTGAACGCAGG + Intergenic
967786525 3:193502963-193502985 TTGAGTTAAGCCTTGAAAGATGG - Intronic
970005624 4:11408148-11408170 CAGAGCTAAGATTTGAGACTGGG - Intronic
970138936 4:12958742-12958764 CTGAGCTGAAACTAGGAAGTAGG - Intergenic
970716923 4:18937170-18937192 TAGAGCTAGGACTTAAAAGTTGG - Intergenic
970842687 4:20493828-20493850 CTGAGCTAGAGCTTGAAAGATGG + Intronic
971591424 4:28473860-28473882 CTAAGATAAGACTTTAAACTTGG + Intergenic
973345485 4:49050278-49050300 TTGATTTCAGACTTGAAAGTAGG + Intronic
973372500 4:49263025-49263047 TTGAGCAAAGACTTGAAGGAGGG - Intergenic
973388503 4:49532116-49532138 TTGAGCAAAGACTTGAAGGAGGG + Intergenic
974402096 4:61420939-61420961 CAGAGCTAAAACTTGAATATAGG - Intronic
974889851 4:67868508-67868530 GTGAGCTATGCCTTGAAAGACGG + Intronic
977742949 4:100508591-100508613 CTGAATTAAGACTTCAGAGTTGG + Intronic
979125531 4:116968181-116968203 CTTAGGTAAGACTTTAGAGTTGG - Intergenic
982352141 4:154427613-154427635 CTGAGTTATGTCTTGAAAGATGG + Intronic
982850222 4:160305515-160305537 TTGAGCAAAGACTTAAAAATAGG - Intergenic
983408429 4:167363571-167363593 CTGAGCTAAGACTATAGATTTGG - Intergenic
984048295 4:174830244-174830266 CTAAGTTAAGAGATGAAAGTAGG - Intronic
987183418 5:15389334-15389356 CAGAGCTAAGATTTCAGAGTAGG + Intergenic
989178444 5:38553237-38553259 CTGAGCTGAGAGTTGAATGAGGG - Intronic
989702559 5:44287570-44287592 CTGAGCCAAGATTTGAATGTAGG + Intergenic
992538531 5:77738323-77738345 CAGAACTAAGACTTGAACATAGG - Intronic
992653646 5:78886617-78886639 CAGAGTTAAGACATTAAAGTGGG + Intronic
992691372 5:79243712-79243734 TTGATGAAAGACTTGAAAGTTGG + Intronic
992745339 5:79815181-79815203 CTGAGGAAAGAATTGACAGTTGG + Intergenic
992846794 5:80758074-80758096 CTGTGCTGAGACTGGACAGTAGG - Intronic
994353516 5:98771497-98771519 CTGACCTATGTCTTGAAAATAGG + Intronic
995042348 5:107603276-107603298 CTAAGCTAAGACTGGAATGGGGG - Intronic
997265632 5:132493519-132493541 CTGAGCAGAGATTTGAATGTGGG - Intergenic
997471358 5:134119017-134119039 CTGCTCTGAGACCTGAAAGTAGG + Intronic
997598734 5:135125055-135125077 CAGAGCCAAGACTTGAACCTAGG - Intronic
997709291 5:135990490-135990512 CTGAGCCAAGATCTGAAAGACGG + Intergenic
997799430 5:136844912-136844934 CTGAGCTAAGACTGTAAGTTAGG - Intergenic
997855828 5:137371696-137371718 CTAAGCTAAGAGGAGAAAGTTGG - Intronic
998919519 5:147052544-147052566 TTGAGCTGAGAGTTGAAGGTTGG + Intronic
999510305 5:152243386-152243408 CTAATCTAGGACTTGAAATTTGG - Intergenic
999610691 5:153366145-153366167 CTGAGCCAAGACTTCAAAGAAGG + Intergenic
999624477 5:153505919-153505941 CTGAGCTCAGATATAAAAGTTGG + Intronic
1000978034 5:167786352-167786374 CTGAGCTAAGAGATGAACATAGG - Intronic
1001118005 5:168955656-168955678 CTCAACAAAGACTTGGAAGTTGG - Intronic
1001371580 5:171209713-171209735 TTGAGCAAAGCCTTGAAAGATGG + Intronic
1003741091 6:8940728-8940750 CTGAGCTAAGTGTTGAATATAGG - Intergenic
1007518179 6:42429940-42429962 CTGAGCCAAGACTTGAAAGAGGG + Intronic
1007731978 6:43952932-43952954 TTGAGTAAAGACTTGAAACTGGG - Intergenic
1009297527 6:61972014-61972036 CTGAGATAAGAATTGGAAATAGG - Intronic
1011389737 6:86838632-86838654 CAGAGCTACGTCTTGAAACTGGG + Intergenic
1011550486 6:88527385-88527407 CTGAGGTAAGAATAGACAGTAGG + Intergenic
1011627767 6:89297333-89297355 CTGCGCCAAGACATGCAAGTAGG + Intronic
1012424032 6:99094881-99094903 CTGAGCCAGGACTAGAAAGATGG + Intergenic
1012568467 6:100691836-100691858 CTGAGCTATGATTTGAACATAGG - Intronic
1017196258 6:151703822-151703844 TGGATCTAAGACTTCAAAGTGGG - Intronic
1017414820 6:154208353-154208375 CTGAGCGAAACCTTGAAAGGTGG - Intronic
1017770795 6:157643014-157643036 CAGAGCTAGGACTTGAATGCCGG - Intronic
1020371060 7:7432455-7432477 CAAAGGTAAGACTTTAAAGTAGG - Exonic
1021716102 7:23464097-23464119 CTGTCCTAAGACTTTGAAGTCGG + Intronic
1021794542 7:24240792-24240814 CTCAGCTAAAACTTAAAACTTGG + Intergenic
1022381903 7:29868246-29868268 CTGAGCACAGGCTTGGAAGTGGG + Intronic
1022907366 7:34870092-34870114 TTGAACTAAGTCTTGAAGGTAGG - Intronic
1023351180 7:39321476-39321498 GGGAGCTAAAACCTGAAAGTGGG + Intronic
1024882465 7:54104149-54104171 CAGAGTTAAGACTTGAAATTAGG + Intergenic
1024936627 7:54718105-54718127 TTGACCTAAGACTTGGAACTTGG - Intergenic
1025183541 7:56838068-56838090 TTGAGCAAAGACTTGAAGGAGGG - Intergenic
1025688385 7:63738899-63738921 TTGAGCAAAGACTTGAAGGAGGG + Intergenic
1025978151 7:66385883-66385905 TTGAGCAAAGACTTGAAGGAGGG - Intronic
1027631978 7:80618150-80618172 CTGAGCTAAGAGTTAAATGCTGG - Intronic
1027805762 7:82820092-82820114 CAGAGCTATGAGTTGAAGGTTGG + Intronic
1028655724 7:93204425-93204447 CTCAGTTAAAACTTTAAAGTAGG + Intronic
1030249768 7:107429437-107429459 CTGGGCAAAGACTTGAATATAGG - Intronic
1031940975 7:127788858-127788880 CTGAGCTAAGTCTTGAAGGATGG - Intronic
1032597674 7:133257987-133258009 CTGAGCCGAGTCTTGGAAGTTGG + Intronic
1035041216 7:155928909-155928931 CTGAGCTAAGACTTGGATGATGG - Intergenic
1035920607 8:3671822-3671844 TTGAGCAATGACTTGAAAGCAGG + Intronic
1036974390 8:13394706-13394728 CAAAGCTAAGACTGGAGAGTTGG - Intronic
1037252320 8:16910839-16910861 CTGAGCTGAGTGTTGAAGGTTGG - Intergenic
1038085265 8:24189079-24189101 CAGAGCTAAGATTTGAACCTGGG - Intergenic
1038873932 8:31527411-31527433 CTGAGCTAGGTCTTGAAAAGTGG - Intergenic
1040089741 8:43385705-43385727 CTGAGCCAAGAATTGAAACCAGG + Intergenic
1040346703 8:46508252-46508274 CTGAGATAAAACTAGAAAGAAGG - Intergenic
1040402340 8:47063907-47063929 CTGAGCCAAGAATTGAAACCAGG - Intergenic
1041232983 8:55772349-55772371 ACAAGCTCAGACTTGAAAGTTGG - Intronic
1042066457 8:64882783-64882805 CTGAGGTAAGTCTTGATAGGTGG + Intergenic
1042519269 8:69693585-69693607 CTGAGCTAGGGTTTGAAATTAGG - Intronic
1042521132 8:69711650-69711672 CTGAGCTGAGATTTGAACTTAGG - Intronic
1043483384 8:80675165-80675187 TTGAGCTGGGACCTGAAAGTTGG + Intronic
1043523715 8:81073888-81073910 CTGAGCACAGACCTGAAGGTGGG + Intronic
1043637486 8:82404628-82404650 CACAGCTTAGAGTTGAAAGTAGG + Intergenic
1044124235 8:88437848-88437870 GAGAGATAAGACTTGAAAGGAGG - Intergenic
1045161335 8:99549418-99549440 CTGAGGAAAGATTTCAAAGTAGG + Intronic
1045445643 8:102260356-102260378 CTGAGCTCTGACTCTAAAGTGGG + Intronic
1046527963 8:115405496-115405518 TTGAGCCAAGACTTAAAAGAGGG - Intergenic
1046608759 8:116401215-116401237 TTGAGCTAAGTCTTGAAAGAAGG + Intergenic
1047715270 8:127589507-127589529 CTAAGATAAGACTTGAAAAGAGG - Intergenic
1048692064 8:136977671-136977693 CAGAGATAAGAATTGAAAGTGGG + Intergenic
1048849586 8:138631710-138631732 CTGAGCTAAGACCTGTAGGATGG - Intronic
1049544495 8:143223454-143223476 CAGAGCTATGGCTTGAAACTGGG - Intergenic
1050152881 9:2634561-2634583 GTGAACTAAGACTTCTAAGTGGG - Intronic
1050155657 9:2664009-2664031 CTGAGCCAAGTTTGGAAAGTAGG + Intergenic
1050252367 9:3758393-3758415 CTGAGCTGAGATTTGAATTTAGG + Intergenic
1051688245 9:19681277-19681299 TTGAGCAAAGACTTGAAGGAAGG - Intronic
1052318527 9:27142431-27142453 CTAAGCAAAGTCCTGAAAGTTGG + Intronic
1053656027 9:40219040-40219062 TTGAGCAAAGACTTGAAGGAGGG + Intergenic
1053906374 9:42848242-42848264 TTGAGCAAAGACTTGAAGGAGGG + Intergenic
1054352396 9:64029070-64029092 TTGAGCAAAGACTTGAAGGAGGG + Intergenic
1054368133 9:64365264-64365286 TTGAGCAAAGACTTGAAGGAGGG + Intergenic
1054528587 9:66157255-66157277 TTGAGCAAAGACTTGAAGGAGGG - Intergenic
1054675754 9:67855007-67855029 TTGAGCAAAGACTTGAAGGAGGG + Intergenic
1055640182 9:78313405-78313427 CTTAGCAAAGACTTGCAGGTGGG + Intronic
1057372961 9:94490616-94490638 TTGAGCAAAGACTTGAAGGAGGG + Intergenic
1057781333 9:98053121-98053143 CTGAGCCAAGAATTGAACCTGGG + Intergenic
1058082409 9:100713844-100713866 CAGAGCTAAGACTTGAACACTGG - Intergenic
1059339108 9:113587411-113587433 CAGAGCTGAGACTTGAACCTGGG - Intronic
1059361195 9:113743151-113743173 TCGAGCAAAGACTTGAAAGAGGG - Intergenic
1060457092 9:123808783-123808805 CTGAGCTGAGACTAGAAGGATGG - Intronic
1060958569 9:127662842-127662864 CTGAGCAAGGGCTTGAAGGTGGG - Intronic
1203553003 Un_KI270743v1:179972-179994 TTGAGCAAAGACTTGAAGGAGGG + Intergenic
1187549019 X:20282632-20282654 CTTAGATAAGGCTTGAAAGATGG + Intergenic
1188371105 X:29370622-29370644 CTGAGATAATATTTGAAACTAGG - Intronic
1190286717 X:48966355-48966377 CTGAGCAAAGGCTTGAGGGTGGG - Intronic
1194671065 X:96733323-96733345 CTGAGCAAAACCTTGAAAGCAGG + Intronic
1196137536 X:112226295-112226317 CTGAGCTAGGCCTTGAAGGATGG - Intergenic
1196349425 X:114708327-114708349 CATAGCTAAGAAGTGAAAGTTGG + Intronic
1196593234 X:117513398-117513420 CTGAACTAAGTCCTGAAAATAGG + Intergenic
1196921136 X:120586422-120586444 TTGAGCAAAGACTTGAAGGAAGG + Intergenic
1197128711 X:122978837-122978859 CTGAGCTAGGCCTTGAAGGATGG + Intergenic
1197156293 X:123273502-123273524 CAGAGTTAAGACTTGAACTTAGG + Intronic
1197637338 X:128930012-128930034 CTGAGCTGAAACTTGAAAAAAGG + Intergenic
1198126220 X:133646632-133646654 CTGAGCTTGGAGTTGAAAGGAGG + Intronic
1198789312 X:140325986-140326008 CAGAGCAACGATTTGAAAGTAGG - Intergenic
1199456825 X:148038377-148038399 GAGAGATAAGACTTGAAGGTAGG + Intergenic
1199741510 X:150740413-150740435 ATGAGGGAAGACCTGAAAGTTGG - Intronic
1199808181 X:151322896-151322918 TTGAGCTGAGTCTTGAAGGTTGG - Intergenic
1201154282 Y:11115627-11115649 TTGAGCAAAGACTTGAAGGAGGG + Intergenic
1201325977 Y:12758880-12758902 CTGAACTAAGACCTGAAAGGCGG - Intronic