ID: 1127141674

View in Genome Browser
Species Human (GRCh38)
Location 15:55984268-55984290
Sequence ATTAGTAGCAGGAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127141671_1127141674 18 Left 1127141671 15:55984227-55984249 CCTGAGAAAAAGTCTCTTCTGTT 0: 1
1: 0
2: 2
3: 27
4: 325
Right 1127141674 15:55984268-55984290 ATTAGTAGCAGGAAAGTGGAAGG 0: 1
1: 0
2: 1
3: 24
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127141674 Original CRISPR ATTAGTAGCAGGAAAGTGGA AGG Intronic
901336863 1:8456893-8456915 ATTAAAAGCAGGAAAGTGATAGG - Intronic
901461599 1:9395199-9395221 TTTAGAAGCTGGAAAGTGGAAGG - Intergenic
904225635 1:29015980-29016002 ATAAGTATCAGGAAATTGGCAGG + Intronic
904526306 1:31136395-31136417 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
906631851 1:47376851-47376873 ATTAGTGGCTGGAAAGTACATGG + Exonic
908263054 1:62353543-62353565 TTTTCAAGCAGGAAAGTGGAAGG + Intergenic
908999752 1:70204613-70204635 ATCATTAGAAGGAAAATGGAAGG + Intronic
909029664 1:70524349-70524371 AGGAGAAGCAGGAAAGAGGAAGG - Intergenic
909837505 1:80275732-80275754 ATTACTAACAGAAATGTGGATGG + Intergenic
909972211 1:82004266-82004288 ATCAGAAGGAGGATAGTGGAGGG + Intergenic
910538945 1:88332705-88332727 ATTAGTAGCAGCATATTTGACGG - Intergenic
910776132 1:90877106-90877128 ATTAGTATCAGCAAAGTTGCAGG - Intergenic
912244358 1:107945369-107945391 ATTAGTAGCAGTAAACAAGAGGG - Intronic
912678774 1:111714182-111714204 ATAAGTAGAAGGGAAGTGTAAGG - Exonic
913977474 1:143474349-143474371 ATTAGTATCAAGAATGAGGAAGG + Intergenic
914071879 1:144299980-144300002 ATTAGTATCAAGAATGAGGAAGG + Intergenic
914107276 1:144666376-144666398 ATTAGTATCAAGAATGAGGAAGG - Intergenic
915514939 1:156407223-156407245 CGTAGTAGCAGGAAACTGGATGG + Intronic
916668665 1:166990754-166990776 ATTTGTATCAGGAAAGTGCCAGG + Intronic
919542542 1:198868500-198868522 TTTAGTAAAAGGTAAGTGGAAGG + Intergenic
920147142 1:203871881-203871903 ATTAGTAGCAGGTAGGCAGAAGG + Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921838213 1:219800033-219800055 ATATGTAGAGGGAAAGTGGAAGG - Intronic
922686816 1:227645656-227645678 ATTAGTTAAAGGAAAGTTGATGG + Intronic
923139495 1:231148967-231148989 ATAAGTAGCAGGAAAGTAACTGG + Intergenic
923837100 1:237624131-237624153 ATTAGTGGCAGGAAATGGGAAGG + Intronic
923933396 1:238729794-238729816 ATAATTAGCAGTAAAGTGCATGG - Intergenic
923952473 1:238973594-238973616 ATCAGTAGTAGGAAAGTGAAAGG - Intergenic
924560168 1:245152241-245152263 ATTAGTAGCACAAAGGAGGAAGG + Intergenic
1063386875 10:5621305-5621327 CTCAGCAGCAGGACAGTGGAAGG + Intergenic
1064490941 10:15856430-15856452 ATTTGTAGCAGTACAGTGGGTGG - Intronic
1064662756 10:17622892-17622914 AATAGTCGTTGGAAAGTGGATGG + Intergenic
1066332183 10:34436261-34436283 ATTTGTTGGAGGAAAGGGGAAGG + Intronic
1068103295 10:52582476-52582498 ATTAGTAGGAGTAGAGTGGCGGG - Intergenic
1068174047 10:53434387-53434409 ATTAATATCTGGAAAGGGGAAGG - Intergenic
1068449441 10:57166511-57166533 ATTAGTACCAGAGAAGTGGGGGG - Intergenic
1068669270 10:59708259-59708281 ATTTGGTCCAGGAAAGTGGAAGG + Intronic
1068901485 10:62274297-62274319 ATTTGTAGCAGCAACATGGATGG + Intergenic
1070470714 10:76776192-76776214 ATTGGGAGCATGAGAGTGGAGGG + Intergenic
1070707187 10:78648241-78648263 GTTAGGAACAGGAAGGTGGAAGG - Intergenic
1076609033 10:131709097-131709119 ATTGGCAGCAGGAACGTGGAAGG - Intergenic
1078614278 11:12850482-12850504 ATTAGTAACAGAAAATGGGAAGG - Intronic
1078659725 11:13277495-13277517 ATTGGTGGCAGGAAAGTAGCAGG + Intronic
1080648468 11:34204261-34204283 CTAAGTAGCAGCAAAGTGGGTGG - Intronic
1081624481 11:44641084-44641106 AATAGTAGCTGGTAGGTGGAAGG + Intergenic
1085224433 11:74906907-74906929 ATTAGAAGCAGCAAAGAGAAAGG - Intronic
1086038549 11:82446001-82446023 ATCTGTAGGAGGAAAGTGGATGG + Intergenic
1086739033 11:90343863-90343885 AGTAGTAGGAGGGAAGTGGTGGG + Intergenic
1087973093 11:104510211-104510233 ATTAGTAGTAGGATAATGTATGG - Intergenic
1088175545 11:107049193-107049215 ATTAGTACCTGGCAAGTGGTAGG + Intergenic
1090557301 11:127890359-127890381 ATTAGAAGCAGCAAAGTAGGAGG - Intergenic
1092569083 12:9702239-9702261 ATAGGGAGCTGGAAAGTGGATGG + Intergenic
1093289599 12:17303783-17303805 ATGGGTAGCAGGAAAAAGGATGG - Intergenic
1095286297 12:40414893-40414915 ATTAGTAGCAAAACAGTTGAAGG + Intronic
1095309655 12:40683199-40683221 ATTGGAAGTAGGAAAGGGGATGG + Intergenic
1095560771 12:43562658-43562680 AGTAGTAGTAGGAAAGTAGTAGG + Intergenic
1096261609 12:50095989-50096011 ATCACTTGCAGGAAGGTGGATGG + Intronic
1097585592 12:61512079-61512101 TTTATTAGCAAGAAGGTGGAAGG - Intergenic
1098538246 12:71620524-71620546 ATTCTTACCAGGAAAGTTGAGGG - Intronic
1099721471 12:86366565-86366587 ACTAGGAGGAGGAGAGTGGAAGG + Intronic
1102391909 12:112556161-112556183 ATTGGTGGAAGGAAAGAGGAAGG - Intergenic
1102747717 12:115264333-115264355 ATGAGTATCAGGAAAGTGCTAGG + Intergenic
1102817261 12:115877031-115877053 AGTAGTGTCAGGAAAGTGTATGG + Intergenic
1103061290 12:117860659-117860681 ATTAGTACCAGTTCAGTGGAGGG + Intronic
1105221858 13:18337043-18337065 ATTAGTATCAAGAATGAGGAAGG - Intergenic
1105947688 13:25203469-25203491 AATAGGGGCAGTAAAGTGGAAGG + Intergenic
1106384200 13:29268204-29268226 ATGAGTAGCAAGAATGAGGAAGG + Intronic
1106942294 13:34792309-34792331 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
1108255157 13:48602656-48602678 ATTAGAAGCAGCAAATTAGAAGG - Intergenic
1109408418 13:61932435-61932457 ATCAGTTTCAGGAAATTGGAAGG + Intergenic
1110003708 13:70238612-70238634 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
1110215804 13:73023565-73023587 ATTATTAGAAGAAAAGTGCATGG - Intergenic
1110714305 13:78683988-78684010 ATTGGGAGCTGGAAAGGGGATGG - Intergenic
1111654124 13:91130981-91131003 ATTAGCAGAAGGTAAGAGGATGG + Intergenic
1112149029 13:96736063-96736085 ATCAGAAGGTGGAAAGTGGAAGG + Intronic
1112846088 13:103645924-103645946 ATTCTTTGCAGGAAAATGGATGG + Intergenic
1112996330 13:105578676-105578698 ACTAGGAGCAGCAAAGAGGAAGG + Intergenic
1113236079 13:108276639-108276661 ATGAGTATCAGGAATGTGAAGGG + Intronic
1114713705 14:24803786-24803808 ATGAGCGGCAGGAAAGGGGAAGG - Intergenic
1115552604 14:34518067-34518089 ATTAATAGAAGGAAAGAGGCTGG - Intronic
1115977129 14:39009044-39009066 ATGAGCAGCAAGAAGGTGGAAGG + Intergenic
1116708144 14:48330028-48330050 ACTAGTAGCATGTAAGTGGCTGG + Intergenic
1118037048 14:61879068-61879090 ATTAATAGCAGGAAAGGGTTGGG - Intergenic
1120970951 14:90206581-90206603 ATTAGAAGCAGCAGAGTGGGAGG - Intergenic
1124137069 15:27044034-27044056 TTTATTAGAAGGAAAGAGGAAGG + Intronic
1125030687 15:35072970-35072992 ACTAGAAGCAGGAGAGAGGAAGG - Intergenic
1127032932 15:54884013-54884035 ATTAGGATCAGGAAAGTTGATGG + Intergenic
1127078181 15:55348604-55348626 AGCAGAAGCAAGAAAGTGGAAGG - Intronic
1127141674 15:55984268-55984290 ATTAGTAGCAGGAAAGTGGAAGG + Intronic
1127210041 15:56764697-56764719 TTTAGTTGGAAGAAAGTGGAGGG + Intronic
1127216382 15:56827050-56827072 ATTAGAAGAAAGAAAGTAGAAGG + Intronic
1128487318 15:68106691-68106713 AATATTAGGAGGAAACTGGAGGG - Intronic
1129545906 15:76394585-76394607 ATTAGAAGGTGGAAAGTGCAAGG - Intronic
1129691004 15:77713476-77713498 ATTAGTAGCAGCCAAGCGGGAGG + Intronic
1131526780 15:93159033-93159055 AATAGTGGCAGGATAGAGGATGG - Intergenic
1132009476 15:98263122-98263144 ATTCATAGGAGGAAAGGGGACGG - Intergenic
1132069495 15:98763313-98763335 ATTAACAAAAGGAAAGTGGAAGG - Intronic
1132290399 15:100697012-100697034 ATTTGTAGCAGGAAGATAGAGGG + Intergenic
1133816786 16:9203712-9203734 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
1133876042 16:9735557-9735579 AATAGAAACAGGAAAGAGGAAGG + Intergenic
1134383346 16:13748332-13748354 ATTAGAACCAGGATAGTAGAAGG + Intergenic
1134666271 16:16021240-16021262 ATTACCAGCAAGAAAGAGGAAGG + Intronic
1135987961 16:27197985-27198007 ATTACCAGCAGGTGAGTGGAGGG + Intergenic
1137528235 16:49256186-49256208 ATTAGAAGGAGCAAAGAGGATGG + Intergenic
1137711803 16:50571907-50571929 ATGAGAAGCAGGAAAGGGGCAGG - Intronic
1138933755 16:61694263-61694285 TTTTCTAGAAGGAAAGTGGAAGG + Intronic
1139016716 16:62698189-62698211 ATTAAAAGAATGAAAGTGGAAGG + Intergenic
1144171496 17:12663884-12663906 ATGAGAAGAAGGAAAGTGGAGGG - Intergenic
1146682684 17:34819558-34819580 TTTAAAGGCAGGAAAGTGGAAGG - Intergenic
1149501232 17:57154049-57154071 AGTGGTAGAAGGAAAGAGGAAGG - Intergenic
1150996065 17:70318979-70319001 AGTAGGAGAAGGAAAGAGGAAGG - Intergenic
1152612770 17:81323701-81323723 ATTAGTTGCAGGTGAGTGGATGG - Intronic
1153928435 18:9856310-9856332 ATGAGAAGCAGCAAAGAGGAAGG + Intronic
1154932713 18:21017040-21017062 ATTATTAGGAGAAGAGTGGAAGG - Intronic
1156082371 18:33353267-33353289 ATAAGTAGCTTAAAAGTGGAAGG - Intronic
1156242732 18:35268994-35269016 CTGAATAGGAGGAAAGTGGAGGG + Intronic
1156361410 18:36387613-36387635 GTTAGAATCACGAAAGTGGATGG - Intronic
1158184820 18:54759875-54759897 ATAAGGAGCTGGAAAGGGGATGG - Intronic
1160036753 18:75308952-75308974 ATTAGGATGAGGAAACTGGAGGG - Intergenic
1160149454 18:76388113-76388135 ATGAGGAGCTGGAAAGGGGATGG - Intronic
1160618241 18:80150376-80150398 ACTAGTTTCAGGAAAGAGGAAGG - Intronic
1161888805 19:7019023-7019045 ATTCATAGCAGGAAAGAGGACGG + Intergenic
1167598155 19:50438080-50438102 ATCAGTGGGTGGAAAGTGGAGGG - Intronic
1167890756 19:52537262-52537284 ATAAATAGCAGGAGAGTAGAGGG + Intronic
1168660477 19:58161862-58161884 TTTAGAAGCTGGAAAATGGAAGG - Intergenic
926358746 2:12065442-12065464 ATTAGTTGGAGGAGAGTGGAGGG + Intergenic
929091598 2:38222888-38222910 ATAAGGAGCAGCAAAGTGGGAGG + Intergenic
929339438 2:40796175-40796197 ATTAGTATCAGGAAAGGTGTTGG - Intergenic
929414630 2:41734903-41734925 ATTGAAAGCAGGACAGTGGAGGG + Intergenic
930261247 2:49149082-49149104 ATTAGTAGCAGAAATATGAAAGG + Intronic
930341178 2:50116923-50116945 ATTAATACCAGGAAGGTGCAGGG - Intronic
930533201 2:52615461-52615483 ATGGGAAGCAGGAAAGGGGATGG - Intergenic
930797584 2:55409289-55409311 ATAAGTAGTGGGAGAGTGGAAGG - Intronic
931438107 2:62266507-62266529 TTTAGAGGAAGGAAAGTGGAGGG + Intergenic
931693957 2:64858519-64858541 ATTTCTAGCAGGAAAGTGCCAGG - Intergenic
933734684 2:85486522-85486544 ATTAGTAAAATGAAATTGGAAGG + Intergenic
933886468 2:86722324-86722346 ATTTCTAGGAGGACAGTGGAGGG + Intronic
933923712 2:87074381-87074403 ATTTCTAGGAGGACAGTGGAGGG - Intergenic
934182180 2:89635346-89635368 ATTAGTATCAAGAATGAGGAAGG + Intergenic
934292479 2:91709554-91709576 ATTAGTATCAAGAATGAGGAAGG + Intergenic
935770481 2:106414861-106414883 ATTAGGAGCAGCAAAGTACAGGG + Intronic
935909607 2:107881075-107881097 ATTAGGAGCAGCAAAGTACAGGG - Intronic
935967726 2:108497932-108497954 ATTAGGAGCAGCAAAGTACAGGG - Intronic
936131387 2:109846202-109846224 ATTAGGAGCAGCAAAGTACAGGG - Intronic
936213310 2:110525283-110525305 ATTAGGAGCAGCAAAGTACAGGG + Intronic
936422449 2:112379837-112379859 ATTAGGAGCAGCAAAGTACAGGG + Intronic
938813851 2:134879389-134879411 ATTAGTAGGAGGAAGTAGGAAGG - Intronic
939364759 2:141217261-141217283 ACTAGGAGCAAGAAAGTGGAGGG - Intronic
939496681 2:142934517-142934539 ATAGGGAGCAGAAAAGTGGAGGG + Intronic
940655369 2:156481461-156481483 ATTAAAAGCTGGAAAGGGGAGGG - Intronic
940783221 2:157955294-157955316 ATTCGAAGCAGAAAAGTGGAAGG + Intronic
941333908 2:164216056-164216078 ATCAGTAGCAGGAAAGAGACAGG + Intergenic
942005177 2:171691487-171691509 ATAAGTAGTAGAAAAGTTGAAGG + Intronic
943793429 2:191962127-191962149 ATTTGTAGCAAGAATGTTGAAGG - Intronic
944508552 2:200441282-200441304 ATCAGTAGCAGGGAAGGGCAAGG - Intronic
945026956 2:205628973-205628995 ATTAGGAGCAGTAAAGCGCAGGG + Intergenic
945807088 2:214502838-214502860 ACTGGAAGCAGGAAAATGGAAGG - Intronic
946076737 2:217079765-217079787 ATGAGTAGGAGTAGAGTGGATGG + Intergenic
947285552 2:228510708-228510730 ATGAGTAGCTGCAAAGTGAATGG + Intergenic
948166328 2:235865514-235865536 ATTACTCGCCGGAAAGGGGAGGG + Intronic
1168984475 20:2036390-2036412 ATGAGTAGTAGGTAAGTGGGTGG + Intergenic
1170242447 20:14183175-14183197 ATCAGAAGGAGGAGAGTGGAAGG - Intronic
1173195083 20:40907661-40907683 AGGAGTTGCAAGAAAGTGGATGG - Intergenic
1174028786 20:47603652-47603674 ATGAGGAGCTGGAAAGGGGATGG + Intronic
1174316543 20:49707140-49707162 TTTAGTAGAAAGAAAGTGGTTGG - Intronic
1174341573 20:49900344-49900366 TTCAGGAGTAGGAAAGTGGATGG + Intergenic
1174791993 20:53487503-53487525 GTTTGTAACAGGAAAGTGGGGGG + Exonic
1176674435 21:9764812-9764834 ATTAGTATCAGTAAAGTGATTGG + Intergenic
1176730291 21:10487893-10487915 ATTAGTATCAAGAATGAGGAAGG - Intergenic
1177080725 21:16635476-16635498 CTTAGTTTCAGGAAATTGGAAGG - Intergenic
1177303018 21:19274464-19274486 ATTAGAAGCAGTAAAGTACATGG + Intergenic
1177587081 21:23110932-23110954 ATTAGTAATTAGAAAGTGGAGGG + Intergenic
1178923887 21:36759457-36759479 ATGAGTAGCAGGAGTGTGGAAGG + Intronic
1182546358 22:31078963-31078985 CCTAGTGGCAGCAAAGTGGAGGG + Intronic
949684208 3:6549505-6549527 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
949836436 3:8275176-8275198 ATGACTAGCAGGAGAGTAGAGGG + Intergenic
951173946 3:19577252-19577274 AATAGAAACAGGAAAGAGGAAGG - Intergenic
952169931 3:30795875-30795897 AGTAACAGCAGGAAAGAGGAGGG + Intronic
952246343 3:31596981-31597003 AGTAGGAGAAGGAAAGAGGATGG - Intronic
953203356 3:40797843-40797865 CTGAGTAGCAGGAGGGTGGATGG + Intergenic
954559223 3:51542324-51542346 ATTAATAGTAGGAATGTGGCTGG + Intronic
954993983 3:54865413-54865435 ATCAGTAGCGGGAAGGTGGGGGG - Intronic
955030918 3:55216981-55217003 ATAAGAAGCTGGAAAGTGTAGGG - Intergenic
956468160 3:69539464-69539486 CTTAGTGGCAGAAAAGTGAATGG - Intronic
959023619 3:101215576-101215598 ATTAGAAGCAGGCAATTGGAAGG - Intergenic
959339966 3:105116985-105117007 ATTACTAACAAGAAACTGGATGG + Intergenic
959694186 3:109231873-109231895 ATGGGGAGCTGGAAAGTGGATGG - Intergenic
960586352 3:119323921-119323943 ATTCCCAGCAGGAAAGGGGAAGG - Intronic
961030710 3:123601124-123601146 AGCAGGAGGAGGAAAGTGGAAGG + Intergenic
961779367 3:129312805-129312827 AATATTATCAGCAAAGTGGATGG + Intergenic
961799577 3:129436109-129436131 ATTACTGGCTGGAAAGAGGATGG + Intronic
963036215 3:141031452-141031474 AATAGTATCTGGCAAGTGGATGG + Intergenic
964458002 3:156889909-156889931 ATTAGTAGCAAGTAAGTGTCAGG + Intronic
964708859 3:159649838-159649860 AATAGTAGGACCAAAGTGGAGGG + Intronic
967208915 3:187149562-187149584 ATAAATAGAAGGAAAGTAGAGGG - Intronic
968598763 4:1499354-1499376 ATTGGTGGCAGGTAGGTGGAAGG + Intergenic
970466238 4:16325807-16325829 ATCAGAAGCTGGAAAGTGCATGG + Intergenic
971554214 4:27992323-27992345 ATTAATAACAGAAAAGGGGAGGG - Intergenic
971776546 4:30973603-30973625 AATAGCAGCAGGGAAGTGGCTGG + Intronic
971783176 4:31065448-31065470 CTTAGCAACAGGTAAGTGGAGGG - Intronic
972513131 4:39788249-39788271 TTTAGAAGATGGAAAGTGGACGG + Intergenic
977083816 4:92568874-92568896 ATTATTTGCAGGAAAATGGATGG - Intronic
977703907 4:100051028-100051050 ATCAGTAGCATGAAAATAGATGG - Intergenic
978111114 4:104964628-104964650 ATGAAAAGCAGGAAAGAGGAAGG - Intergenic
978894726 4:113873145-113873167 AAAAGTAGGAGGAAAGAGGAAGG - Intergenic
978921183 4:114184338-114184360 ATTAGCAGCATGAAAATGAATGG + Intergenic
979157958 4:117421879-117421901 ATCTGTGGCAGGAAAGAGGAAGG + Intergenic
980696238 4:136360067-136360089 ATTAGTATCAGGAAAGGAAATGG + Intergenic
981868296 4:149454855-149454877 AATAGTAGCAGGGTAGGGGATGG + Intergenic
981891811 4:149747033-149747055 CTTAGTAGAGGAAAAGTGGAAGG - Intergenic
983328806 4:166296739-166296761 ATTAGTAAAAGGAAAGAGGATGG - Intergenic
983358173 4:166691903-166691925 ATTAGCAACTGAAAAGTGGAAGG + Intergenic
983599855 4:169515133-169515155 ATCAGTAGCAGGAAGGTGACAGG - Intronic
983702609 4:170616090-170616112 ATAAGAACCAGGAAAGGGGATGG - Intergenic
984231045 4:177099387-177099409 ATTTTTAGCAAGAATGTGGAAGG + Intergenic
984455231 4:179958010-179958032 AGTACTAGCAGGACATTGGAAGG - Intergenic
985088084 4:186334877-186334899 ATTATTAACAGGAAATAGGAAGG - Intergenic
985400867 4:189592661-189592683 ATTAGTATCAGTAAAGTGATTGG - Intergenic
986197188 5:5548580-5548602 CTCAGTGGCAGGAAAGTGAATGG + Intergenic
986230637 5:5861872-5861894 AGAAGCATCAGGAAAGTGGAGGG - Intergenic
987029390 5:13961760-13961782 ATTAGTAGGAGGAATGGGGGAGG - Intergenic
987826730 5:23039602-23039624 CTTTATATCAGGAAAGTGGAAGG + Intergenic
988848942 5:35159466-35159488 ATTTGTATCAGTAGAGTGGAGGG - Intronic
989525142 5:42444834-42444856 ATTTGTAGCTGGAAAGGGGAAGG - Intronic
989553525 5:42764037-42764059 ATTAGTAATAGGGAAGTGGTGGG - Intronic
990553011 5:56902983-56903005 ATAAGTAGAAGAGAAGTGGAAGG - Intergenic
991353774 5:65747176-65747198 GTTCGTAGGAGGGAAGTGGAGGG + Intronic
992160091 5:73992667-73992689 ATAAGGAGCTGGAAAGAGGATGG + Intergenic
994186439 5:96820320-96820342 ATTAGTAGCAAGAATATGCAGGG + Intronic
994658313 5:102621671-102621693 ATTACTAGCACTAAGGTGGAGGG + Intergenic
995726117 5:115181925-115181947 ATTACAAGCAGGAAGGAGGAAGG + Intergenic
996606243 5:125327015-125327037 ATAATTAGCAGGAGTGTGGAAGG - Intergenic
997212243 5:132083855-132083877 ATTAGGAGCAGGGAAGTACAAGG - Intergenic
997337511 5:133118640-133118662 ATTAGTACCAGGGAAGTGAAAGG + Intergenic
998944280 5:147320815-147320837 ATTGCTAGCTGGAGAGTGGAAGG + Intronic
999353765 5:150904554-150904576 ATTAGTAACAGGGAAGTGAGAGG - Intronic
999517933 5:152319763-152319785 GTAAGCAGCAGGAAAGAGGAAGG + Intergenic
999986016 5:157006176-157006198 ATTAGCTGAAGGAAAGTGAAGGG + Intergenic
1001322450 5:170693804-170693826 ATTAGCAAGAAGAAAGTGGAGGG + Intronic
1001588181 5:172847441-172847463 GATAGTAGCAGAATAGTGGAAGG - Intronic
1003215904 6:4111542-4111564 ATGAGTAGGGTGAAAGTGGAAGG - Intronic
1004131398 6:12923536-12923558 ATTGGTATTAGGAAAATGGAGGG - Intronic
1006651411 6:35554840-35554862 TTTAGAAGCTGGAAAGGGGATGG + Intergenic
1007219020 6:40263978-40264000 ATTATTACCAGGAAAGTCTATGG - Intergenic
1007385834 6:41519685-41519707 AATAAAAGCAGGAAAGGGGAGGG - Intergenic
1009671884 6:66764507-66764529 ATTAGGACCAGAAAAATGGAAGG - Intergenic
1010063603 6:71654186-71654208 AATAATAGCAGCAAAGTTGAAGG - Intergenic
1010133111 6:72519147-72519169 ATTAGAAGCAGAAAAGCAGAAGG - Intergenic
1010590041 6:77701482-77701504 ATTCATAGGAGGGAAGTGGATGG + Intronic
1011353328 6:86446890-86446912 ATGAGGAGCTGGAAAGGGGATGG + Intergenic
1011658804 6:89576506-89576528 AGGAGTAGCAGAAAAGTGAAGGG - Intronic
1015262400 6:131253122-131253144 AATAGCAGCAGGAGAGGGGAGGG - Intronic
1015747008 6:136520875-136520897 AAGAGTGGCAGGAAAGAGGATGG + Intronic
1016456894 6:144240229-144240251 GTTATTTGCAGGAACGTGGATGG - Intergenic
1017013989 6:150085136-150085158 AGGAGAAGCAGGAAAGAGGAGGG + Intergenic
1019881416 7:3864705-3864727 CTTAGTAACGGGAAAGAGGAAGG + Intronic
1020378313 7:7513439-7513461 ATCAGGAGCAGGAAAGAGGGAGG + Intronic
1020380503 7:7539731-7539753 AATAGTAGAGGGAATGTGGAAGG - Intergenic
1021139075 7:17001461-17001483 ATTAGAGGCTGGAAAGTGTAGGG - Intergenic
1021935345 7:25625340-25625362 ATTAAAAGCAGAAAATTGGAGGG - Intergenic
1024330433 7:48149300-48149322 ATGAGTAGTAGGGAAGAGGAGGG - Intergenic
1025731217 7:64109823-64109845 AGTAATAGCAGGAAAGAGGGTGG + Intronic
1026762023 7:73134000-73134022 ATGAGTAGCAGGGGTGTGGAGGG + Intergenic
1027038364 7:74942824-74942846 ATGAGTAGCAGGGGTGTGGAGGG + Intergenic
1027085199 7:75258658-75258680 ATGAGTAGCAGGGGTGTGGAGGG - Intergenic
1027224899 7:76237700-76237722 AGGAGGAGCAGGAAAGTGCAGGG - Intronic
1027706143 7:81535912-81535934 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1027987954 7:85318991-85319013 ATTGCTGGCAGGAAAGTGAAAGG - Intergenic
1029795481 7:102889984-102890006 ATTAGTATCCAGAAAGTGGGGGG + Intronic
1030302725 7:107990650-107990672 ATTAGAAGCAGAACAGTGGAAGG - Intronic
1031050190 7:116937096-116937118 ATTGGCAGCAGGAGAGTGGGAGG - Intergenic
1032444703 7:131972280-131972302 ATTTGGAGAAAGAAAGTGGATGG + Intergenic
1033910325 7:146255774-146255796 ATTTGTAGCTGGAAAGTGTAAGG + Intronic
1034599278 7:152233650-152233672 ATTAGTATCAAGAATGAGGAAGG + Intronic
1035114127 7:156508352-156508374 ATTAGTAGCATGAAAACAGATGG - Intergenic
1038190811 8:25318542-25318564 AATAGAAGAAGGGAAGTGGAGGG - Intronic
1038323834 8:26555167-26555189 ATTGTTAGCAGGAAAGTTTATGG - Intronic
1039306334 8:36267336-36267358 ATGAGGAGCTGGAAAGGGGATGG + Intergenic
1042216470 8:66433249-66433271 ATCAGTAGGAGGAAAGGCGAGGG + Intronic
1043867538 8:85393203-85393225 ATGAGGTGCAGAAAAGTGGAAGG + Intronic
1045882210 8:107054616-107054638 ACCAGTAGCAGAAAAGTAGAAGG - Intergenic
1047113788 8:121818524-121818546 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1047857157 8:128923629-128923651 ATTGGTTGAATGAAAGTGGAAGG - Intergenic
1048065309 8:130961607-130961629 ATTACAAGAAGGGAAGTGGAAGG - Intronic
1048680101 8:136831855-136831877 ATGAGGAGCTGGAAAGGGGATGG + Intergenic
1049304217 8:141891120-141891142 AGTTGTAGCAGAAAAGTTGATGG - Intergenic
1050076289 9:1868907-1868929 ATTAGGGGCTGGAAAGAGGAGGG + Intergenic
1050421193 9:5466993-5467015 TTTAGGAGCAGGGAAGGGGAAGG + Intronic
1050655797 9:7827506-7827528 ATTGGTAGCAGGAAAAAAGAGGG + Intronic
1051983800 9:23057633-23057655 ATGAGGAGCAGGAAAGAGGATGG - Intergenic
1056131626 9:83592798-83592820 ATTAGTAGAAGTAAAGTCAAAGG + Intergenic
1059719484 9:116945641-116945663 TTTAATAGAAGGAAAGTGGAAGG - Intronic
1060429978 9:123542643-123542665 ATTAGGAGGAGGAAAGTGGAAGG + Intronic
1203583990 Un_KI270746v1:46180-46202 ATTAGTATCAAGAATGAGGAAGG + Intergenic
1203618104 Un_KI270749v1:88311-88333 ATTGGTAGCTTGAAAGGGGATGG - Intergenic
1185961786 X:4552611-4552633 ATGAGGAGCTGGAAAGCGGATGG + Intergenic
1187483631 X:19681567-19681589 TTTAGTACCAGGAAGGGGGATGG + Intronic
1187531774 X:20103581-20103603 ATTAGGATCAGGAATGAGGAAGG - Intronic
1188204289 X:27333778-27333800 ATCAATAGCAGGAATGTAGACGG + Intergenic
1188347126 X:29080541-29080563 ATCTGAAGCAGGAAAGAGGAAGG + Intronic
1188380189 X:29482120-29482142 ATGAGTAGAAGGAACATGGATGG - Intronic
1189783353 X:44537042-44537064 CTCAGTAGAAGGAAAGTGAAAGG - Intronic
1190805384 X:53831015-53831037 ATTAAAAGCTGGAAAGGGGAGGG - Intergenic
1193319869 X:80108587-80108609 ATTAATAATAGGAAAGTGGTAGG + Intergenic
1193634547 X:83932132-83932154 ATTATTTGCAGGAACATGGATGG - Intergenic
1194163376 X:90483436-90483458 ATAGGTAGCTGGAAAGGGGATGG + Intergenic
1194861887 X:99009623-99009645 ATTATTAGGAGGACAGTGAAGGG + Intergenic
1195628185 X:107025879-107025901 ATTAGTATGTGGAGAGTGGAGGG + Intergenic
1195645488 X:107226544-107226566 ATTTGTGGCAGGAAATGGGATGG + Intronic
1195852335 X:109296506-109296528 ATTCCTAGCAGGAATGAGGAGGG + Intergenic
1198774300 X:140163290-140163312 ATTAGTATCATGAAAGTGGTAGG - Intergenic
1199279763 X:145987315-145987337 TTTGGTAGAATGAAAGTGGAAGG - Intergenic
1199467387 X:148154355-148154377 ATGAGGAGCAGGCAAGTAGAAGG - Intergenic
1200509645 Y:4061161-4061183 ATAGGTAGCTGGAAAGGGGATGG + Intergenic
1201240747 Y:11954814-11954836 AATAGTAGGAGGAAAGAGGCAGG - Intergenic
1201547716 Y:15184253-15184275 ATGGGTAGCTGGAAAGGGGATGG - Intergenic