ID: 1127147426

View in Genome Browser
Species Human (GRCh38)
Location 15:56038942-56038964
Sequence CAGTGTTGGGGGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127147426_1127147437 5 Left 1127147426 15:56038942-56038964 CCTCCCACCTTCCCCCAACACTG No data
Right 1127147437 15:56038970-56038992 TACAATTCATCATGAGATTTTGG 0: 12
1: 1247
2: 9984
3: 12480
4: 9174
1127147426_1127147438 8 Left 1127147426 15:56038942-56038964 CCTCCCACCTTCCCCCAACACTG No data
Right 1127147438 15:56038973-56038995 AATTCATCATGAGATTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127147426 Original CRISPR CAGTGTTGGGGGAAGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr