ID: 1127148555 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:56050398-56050420 |
| Sequence | CAGCCAACTGAGATGGAACA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1127148555_1127148559 | -1 | Left | 1127148555 | 15:56050398-56050420 | CCGTGTTCCATCTCAGTTGGCTG | No data | ||
| Right | 1127148559 | 15:56050420-56050442 | GGCCTTTGTCATCGGTGTGCAGG | No data | ||||
| 1127148555_1127148558 | -9 | Left | 1127148555 | 15:56050398-56050420 | CCGTGTTCCATCTCAGTTGGCTG | No data | ||
| Right | 1127148558 | 15:56050412-56050434 | AGTTGGCTGGCCTTTGTCATCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1127148555 | Original CRISPR | CAGCCAACTGAGATGGAACA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||