ID: 1127148555

View in Genome Browser
Species Human (GRCh38)
Location 15:56050398-56050420
Sequence CAGCCAACTGAGATGGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127148555_1127148559 -1 Left 1127148555 15:56050398-56050420 CCGTGTTCCATCTCAGTTGGCTG No data
Right 1127148559 15:56050420-56050442 GGCCTTTGTCATCGGTGTGCAGG No data
1127148555_1127148558 -9 Left 1127148555 15:56050398-56050420 CCGTGTTCCATCTCAGTTGGCTG No data
Right 1127148558 15:56050412-56050434 AGTTGGCTGGCCTTTGTCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127148555 Original CRISPR CAGCCAACTGAGATGGAACA CGG (reversed) Intergenic
No off target data available for this crispr