ID: 1127150866

View in Genome Browser
Species Human (GRCh38)
Location 15:56073870-56073892
Sequence CTCAGGTAGTTTTCTAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127150866_1127150868 21 Left 1127150866 15:56073870-56073892 CCATCATTAGAAAACTACCTGAG No data
Right 1127150868 15:56073914-56073936 TGAAGCTACTGTGTCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127150866 Original CRISPR CTCAGGTAGTTTTCTAATGA TGG (reversed) Intergenic
No off target data available for this crispr