ID: 1127159655

View in Genome Browser
Species Human (GRCh38)
Location 15:56168661-56168683
Sequence CCCTACCTGCAAGTGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127159655_1127159659 1 Left 1127159655 15:56168661-56168683 CCTAGTTCCACTTGCAGGTAGGG 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1127159659 15:56168685-56168707 TAGCCATGTTGACATTACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 83
1127159655_1127159662 22 Left 1127159655 15:56168661-56168683 CCTAGTTCCACTTGCAGGTAGGG 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1127159662 15:56168706-56168728 GGAGGTTGAAGTTCCTAAAGTGG 0: 1
1: 0
2: 0
3: 12
4: 112
1127159655_1127159661 4 Left 1127159655 15:56168661-56168683 CCTAGTTCCACTTGCAGGTAGGG 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1127159661 15:56168688-56168710 CCATGTTGACATTACTCTGGAGG 0: 1
1: 0
2: 0
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127159655 Original CRISPR CCCTACCTGCAAGTGGAACT AGG (reversed) Intronic
901780420 1:11590587-11590609 CCCTGGCTGCAAGGGGAGCTGGG - Intergenic
902161393 1:14533379-14533401 CCCTGCCTGCATGTGGGATTTGG - Intergenic
905382525 1:37573257-37573279 ACCTAGCTGCAACTGCAACTTGG + Intronic
908333310 1:63093720-63093742 CCCTACCTCCAAGAGGAAAATGG - Intergenic
908642408 1:66240061-66240083 CCCTCCCTGCAGGTGGTATTTGG + Intronic
912884225 1:113452171-113452193 CCCTTCCTGAAAGGGGAAATTGG - Intronic
918610483 1:186484638-186484660 CCAGACCTGCAACTGGAAGTTGG + Intergenic
920075633 1:203334499-203334521 CCCTACCAGCAAGTGAGACTGGG - Intergenic
923531657 1:234816953-234816975 CCCTCCCTGAAAGGGGGACTTGG + Intergenic
1067069674 10:43122408-43122430 CCCCACCCACAAGTGGAGCTTGG + Intronic
1068916606 10:62439434-62439456 CCCTAGCTGCAAGAGAATCTGGG - Intronic
1069808918 10:71144179-71144201 CTCTACCTGCAAGAGGGACTGGG + Intergenic
1071489284 10:86125016-86125038 CCCTCCCTGCAAGTGAGACATGG + Intronic
1071773670 10:88759880-88759902 CCCAACCTGCAAGTGCATCATGG + Intergenic
1074884329 10:117683003-117683025 CTCTAGCTGCAAGTTGAAATTGG - Intergenic
1075453823 10:122571801-122571823 CCCAATCACCAAGTGGAACTGGG + Intronic
1078427250 11:11261871-11261893 CCCTACCTGCATCTGCAGCTGGG - Intergenic
1080934292 11:36845819-36845841 CCCAACCTGCAAATGAAGCTGGG - Intergenic
1083460860 11:62810752-62810774 CCCTGCATGCCAGTGGATCTGGG - Intronic
1084005852 11:66323136-66323158 GCCTACTTGCAAGTGGAAGGAGG + Intergenic
1084019912 11:66411186-66411208 CCCTACCTGAAACTGGGGCTTGG + Intergenic
1084379357 11:68801271-68801293 CCCATCCTGCCAGTGGAACAGGG + Intronic
1085126689 11:74006911-74006933 ACCTACCTGCAGGCGGACCTTGG + Exonic
1085468300 11:76739023-76739045 CCCTGCCTGCAACTGGGACCTGG - Intergenic
1086933184 11:92715903-92715925 GCCTACCTGCCAGTGGAAGTAGG + Intronic
1087153570 11:94879991-94880013 CCCTACCTTCAAGTTGCTCTAGG + Intergenic
1088568252 11:111196085-111196107 ACCTTCCTGGAAGTGAAACTGGG + Intergenic
1090475338 11:127015085-127015107 ACCTACCTGCAAGGGTAGCTGGG - Intergenic
1094690817 12:32767192-32767214 CCCTACCTGCAAGGGGATCTAGG - Intergenic
1098984784 12:77000494-77000516 CCCTAGCTGCAAGGGAATCTAGG - Intergenic
1100518301 12:95349581-95349603 CCCTAGCTGCAGGAGAAACTGGG + Intergenic
1101698923 12:107153239-107153261 CCCTAGCTGCAAGGGAAGCTGGG + Intergenic
1102872104 12:116421934-116421956 CCCTAGCTGCAAGGGAAGCTGGG + Intergenic
1103254856 12:119532240-119532262 CCATAACTTCAAGTGGAAGTTGG - Intronic
1103465918 12:121141889-121141911 TCCTAGCTGCAAGGGAAACTGGG - Intronic
1104623708 12:130337309-130337331 CCCTACTAGCTCGTGGAACTGGG - Intergenic
1104923157 12:132301537-132301559 CCCTACCTCCGGGTGGAATTGGG - Intronic
1106131219 13:26941071-26941093 CCCTTCCAGCAACTGGAAGTGGG - Intergenic
1107848189 13:44541088-44541110 CCTTACCTGTTAGTGGAACGAGG + Intronic
1109686256 13:65823670-65823692 CCCTTGCTGCAAGTATAACTAGG - Intergenic
1110553854 13:76836578-76836600 TCCTAGCTGGAAGGGGAACTAGG - Intergenic
1113002727 13:105661201-105661223 CTCGACCTGCAAATAGAACTTGG + Intergenic
1113492256 13:110701362-110701384 CCCTTCCTGAAAGTGGTTCTTGG - Intronic
1114555253 14:23558516-23558538 CCCTGCCTGCCTGTGGAAGTGGG - Intronic
1116127404 14:40805988-40806010 CTCTACATGTCAGTGGAACTTGG + Intergenic
1118346588 14:64945627-64945649 GCCTCCCTGCAGGTGGCACTAGG + Intronic
1119627870 14:76197398-76197420 CCCAACCTGAAAATGGAACAAGG - Intronic
1119887305 14:78153692-78153714 CCATACCTGCAAGTACAAATTGG - Intergenic
1119976139 14:79026047-79026069 CCCTAGCTGCAAGGGAAGCTAGG + Intronic
1121263099 14:92580853-92580875 ACCTAACTGCAAGGGAAACTGGG + Intronic
1124818835 15:33022699-33022721 CCCTGCCTGCCAGAGGAACTGGG - Intronic
1127159655 15:56168661-56168683 CCCTACCTGCAAGTGGAACTAGG - Intronic
1129830993 15:78670098-78670120 CACTTACAGCAAGTGGAACTTGG + Intronic
1130656863 15:85797827-85797849 TCCTACCTGCAAGAGCAGCTGGG + Intergenic
1132070299 15:98770770-98770792 CCCTGCCGGCAAGTAGAACCAGG - Intronic
1132350845 15:101138910-101138932 CCCTGCCTGCCTGTGGGACTAGG - Intergenic
1133130969 16:3675936-3675958 CCCTACGTGCAGGTAGAACCAGG + Intronic
1134263674 16:12674506-12674528 CCCTTACTGGAGGTGGAACTAGG - Intronic
1134857240 16:17530488-17530510 CCCTAGCTGCAAGGGAAGCTGGG - Intergenic
1137450594 16:48570254-48570276 CTCCACCTGGAAGTGGAAATGGG - Intronic
1141730550 16:85820151-85820173 CGCTACATGCAACTGAAACTGGG - Intergenic
1142635053 17:1251892-1251914 CCCTACCTTCCAGGGGAATTAGG + Intergenic
1144745196 17:17609298-17609320 ACCTACCTGCAAGGGGCCCTGGG - Intergenic
1147430311 17:40366824-40366846 CCCTTCCTGAAAGTGGACCTGGG - Intergenic
1150559454 17:66282111-66282133 CTCTACTTCCAAGTGGTACTTGG - Intergenic
1153716737 18:7857610-7857632 CCCTTCCTGCAAATGGAGCATGG + Intronic
1159701829 18:71638844-71638866 CCCAACCTGCCTGTGGCACTTGG + Intergenic
1161027435 19:2043041-2043063 CCCCTCCTGCAGGTGGCACTAGG + Intronic
1162958803 19:14114246-14114268 CCCTGCCTGCAGGGGGAGCTAGG + Intronic
1163324121 19:16592263-16592285 CCCCTCCTGCAGATGGAACTTGG - Intronic
1164098844 19:22036263-22036285 CTCTACCTGCAAGGAGCACTGGG - Intergenic
1164118726 19:22246487-22246509 CTCTACCTGCAAGGAGCACTGGG - Intergenic
1165832095 19:38735404-38735426 CCCTACCTGCCCCTGGAGCTGGG - Exonic
1166655097 19:44605337-44605359 CCCTACCTTCAGGTGGAAGTGGG - Intergenic
1168249774 19:55135110-55135132 CCCTACCTGCAAGGGAGATTGGG - Intronic
1168371404 19:55837436-55837458 TCCTACCTACAGGTGTAACTTGG + Intronic
925056126 2:858709-858731 CCCTGCCTGCACCTGGATCTGGG - Intergenic
926777269 2:16434917-16434939 CCCAACCTGCAACTGGGGCTTGG + Intergenic
927827514 2:26318951-26318973 CCCAACCTGTAAGTGAGACTGGG - Exonic
928084030 2:28334530-28334552 CCCTCCCTGAAAGTGGTACTGGG + Intronic
930025768 2:47028306-47028328 CCCCACCTGCAAGTGGTAACAGG - Intronic
930302532 2:49634979-49635001 CTCCACCTTCAAGTAGAACTTGG + Intergenic
930725892 2:54681008-54681030 CCCTTGCTGCAAGTGCAGCTGGG + Intergenic
931937289 2:67213633-67213655 CCCTACCTGCGAGTTCAGCTTGG + Intergenic
938931948 2:136094554-136094576 CCATTCCTGCAAGTTGGACTTGG + Intergenic
941574476 2:167213791-167213813 ATCTACCCGCAAGTGGAACAAGG + Intronic
944489707 2:200245664-200245686 ATCTACCTGCAAGAGGAACTAGG + Intergenic
944540854 2:200752131-200752153 ACCTAACTGCAAGGGGAGCTGGG + Intergenic
947293141 2:228599526-228599548 CCCTTCCTGCAAGGGAAGCTGGG + Intergenic
948202076 2:236136508-236136530 CCCTGCCTTCCAGGGGAACTGGG - Intergenic
949031049 2:241797703-241797725 CCCTCCCGGGACGTGGAACTGGG - Intronic
1168855654 20:1005849-1005871 ACCTACCTGCAAGGGTGACTGGG + Intergenic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1171164294 20:22957012-22957034 CCCTACCTTCAGGTAGCACTGGG + Intergenic
1172657908 20:36548217-36548239 CTCTGCATGCAAGTGGAACAGGG + Intronic
1175249084 20:57598107-57598129 CCTGACCTGCAGGTGGAGCTGGG + Intergenic
1175655321 20:60764952-60764974 CCTTCCCTGAAAGTGGACCTTGG + Intergenic
1179563806 21:42234197-42234219 CCCTACCTGCCAGCGGTCCTGGG - Intronic
1180966172 22:19789025-19789047 CCCCACCTGCAGCTGGAACCAGG + Intronic
1181804676 22:25367575-25367597 GCCAGCCCGCAAGTGGAACTAGG + Intronic
1183984320 22:41561283-41561305 CCCTATCTGTAAGCTGAACTGGG - Intronic
951225076 3:20111441-20111463 CCCTGCCAGCTAGTGAAACTTGG - Intronic
951945885 3:28135236-28135258 GCATAACTTCAAGTGGAACTAGG + Intergenic
952080509 3:29752297-29752319 CCTTCCCTGCCAGTGGAGCTTGG + Intronic
953117962 3:40011258-40011280 ACCTAGCTGCAAGTGGTGCTGGG + Intronic
955726114 3:61934731-61934753 CCCTAGCTGCAAGGGAAGCTGGG + Intronic
958935754 3:100253737-100253759 CCCTACCTGTGAGTTGAATTCGG + Intergenic
961056791 3:123795672-123795694 CCCCACCTGCACTTGGAACCTGG - Intronic
963254525 3:143131552-143131574 TCCTACCTACAAGGGAAACTGGG - Intergenic
964678618 3:159312530-159312552 ATCTAACTGCAAGGGGAACTGGG + Intronic
968284716 3:197501748-197501770 CCCTAGCTGCAAGGGAATCTGGG + Intergenic
972792809 4:42389229-42389251 TGTTACCTGCAAGTGCAACTGGG + Intergenic
973727181 4:53788393-53788415 CCCTACCTGTAAGGCCAACTGGG + Intronic
975063233 4:70030513-70030535 TTCCACCTACAAGTGGAACTAGG + Intronic
981251825 4:142612067-142612089 CCATACCTGCATGTGCAAATAGG - Intronic
982718576 4:158836128-158836150 CCCTACCTTCCAGTGAGACTAGG + Intronic
986998209 5:13631735-13631757 CCCTACCTTCAAGTAGACCCTGG - Intergenic
990380009 5:55213755-55213777 CCCTACCTGCAAGGGGGGCAGGG - Intergenic
991054300 5:62305755-62305777 AGCTACCTGTAAGTGGAAATAGG + Intergenic
992468083 5:77027290-77027312 CCCTTGCTGCAAGTGGGGCTGGG - Intergenic
992786722 5:80177103-80177125 CCCTACCTGGAAGTGGGATGCGG + Intronic
995761557 5:115567229-115567251 CCCTAGCTGCAAGAGCAACTGGG + Intergenic
998549707 5:143065703-143065725 CCCTTCCTGCAAGTGCAGCCTGG + Intronic
1006244344 6:32717357-32717379 CACTCCCTGCAAGGGGAACAAGG - Intergenic
1012430989 6:99163366-99163388 CCCTACCTGTAAGGGAGACTGGG - Intergenic
1016110550 6:140218612-140218634 TTCTACCTGCAAGTGTCACTTGG - Intergenic
1017995390 6:159527661-159527683 CCCTACCTGCAGGTCCATCTGGG + Intergenic
1023660938 7:42470240-42470262 ACCTAGCTGCAAGTGGAGCTGGG - Intergenic
1028508975 7:91601160-91601182 TCCTACCTGAGAGTGGAACAAGG - Intergenic
1031831630 7:126634427-126634449 CCCCACAGGCAAGTGAAACTTGG + Intronic
1032478007 7:132225532-132225554 CCCCACCTGCCACTGGAAGTTGG + Intronic
1032858847 7:135858968-135858990 CCCTACTTGCACGTGGAGCATGG - Intergenic
1032884464 7:136123159-136123181 CCCTCCCTGCAAGAGGAATCAGG + Intergenic
1034105066 7:148483177-148483199 CCCTTCATGCAAGTGAATCTTGG - Intergenic
1034316973 7:150142153-150142175 CTCGACCTGCAAGTGTAGCTGGG + Intergenic
1034789892 7:153958531-153958553 CTCGACCTGCAAGTGTAGCTGGG - Intronic
1034800093 7:154051205-154051227 CCCTACCTCCATGTGGAAGGAGG + Intronic
1048144637 8:131829172-131829194 ACCTAACTTCAAGGGGAACTAGG + Intergenic
1049425384 8:142535766-142535788 CCCTACCTGCCTGTGGGACCGGG + Intronic
1049555911 8:143281972-143281994 CCCTAGCTGCACTTGGCACTCGG - Intergenic
1050367452 9:4885557-4885579 GCCTAGCTGCAAGGGGACCTGGG + Intronic
1052269846 9:26616027-26616049 CCCTACCTGCAAGGGGATATGGG + Intergenic
1053976914 9:43833891-43833913 CACTACCTGGAAGTGGACATTGG + Intergenic
1053997372 9:44188197-44188219 CACTACCTGGAAGTGGACATTGG + Intergenic
1054071152 9:45455897-45455919 CACTACCTGGAAGTGGACATTGG + Intergenic
1054832843 9:69645541-69645563 CTCTAGCTGCAAGGGAAACTGGG - Intronic
1055059364 9:72052977-72052999 TCCTACCTACAACTGAAACTGGG - Intronic
1057280611 9:93708569-93708591 ACCTCTCTGCAAGTGAAACTGGG + Intergenic
1058982810 9:110185909-110185931 CCCTCCCTGCAAGTAGACCTGGG + Intergenic
1060035282 9:120250264-120250286 CCTTAGCTGCAAGTGCATCTGGG - Intergenic
1203419429 Un_KI270383v1:1700-1722 CACTACCTGGAAGTGGACATTGG - Intergenic
1203594656 Un_KI270747v1:115335-115357 CACTACCTGGAAGTGGACATTGG + Intergenic
1203595944 Un_KI270747v1:137259-137281 CACTACCTGGAAGTGGACATTGG + Intergenic
1203597634 Un_KI270747v1:165805-165827 CACTACCTGGAAGTGGACATTGG + Intergenic
1203598869 Un_KI270747v1:186544-186566 CACTACCTGGAAGTGGACATTGG + Intergenic
1186400904 X:9258503-9258525 CCCTACCTGGAAGTGGCAAAAGG + Intergenic
1189954972 X:46268633-46268655 CTCTACCAGATAGTGGAACTTGG - Intergenic
1190323785 X:49194136-49194158 CCCTACATGCAAGTGGCTGTGGG + Intronic
1191729070 X:64314529-64314551 CCGCCCCTGCAAGTGAAACTAGG - Intronic
1195206314 X:102602834-102602856 CCCCTCCTTCAACTGGAACTAGG - Exonic
1200228307 X:154431515-154431537 CCCTACAGACAAGAGGAACTGGG - Intronic