ID: 1127173432

View in Genome Browser
Species Human (GRCh38)
Location 15:56328077-56328099
Sequence CCTTACAAGCAGAAGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127173432_1127173439 -4 Left 1127173432 15:56328077-56328099 CCCGCTTCCTTCTGCTTGTAAGG 0: 1
1: 0
2: 0
3: 20
4: 263
Right 1127173439 15:56328096-56328118 AAGGAGAGGGGAAAGTAAAGAGG 0: 2
1: 23
2: 257
3: 675
4: 2129
1127173432_1127173440 15 Left 1127173432 15:56328077-56328099 CCCGCTTCCTTCTGCTTGTAAGG 0: 1
1: 0
2: 0
3: 20
4: 263
Right 1127173440 15:56328115-56328137 GAGGACTTTGTCTTGCATCATGG 0: 1
1: 167
2: 459
3: 601
4: 696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127173432 Original CRISPR CCTTACAAGCAGAAGGAAGC GGG (reversed) Intronic
900583396 1:3420475-3420497 CCGCGCAAGCAGGAGGAAGCAGG + Intronic
900956743 1:5890781-5890803 CCTTCCAAGCAGACAGACGCTGG + Intronic
903916880 1:26771310-26771332 CCTTACCAGGAGAGGGAGGCTGG - Exonic
905008088 1:34727300-34727322 ACCTAGATGCAGAAGGAAGCTGG - Intronic
905205172 1:36339313-36339335 CCTTGCATGCAGGAGGCAGCGGG - Intergenic
905456602 1:38092427-38092449 CCTGTCAAGGAGAAGGAAGAAGG - Intergenic
905855399 1:41308246-41308268 CCTTACAAGGGAAAGGAAGGAGG - Intergenic
906431293 1:45757825-45757847 CCTTGCTAACAGAAGAAAGCAGG - Intergenic
906703030 1:47873468-47873490 CTTTACAAGCAAAAGTCAGCAGG + Intronic
907144704 1:52221580-52221602 CCTTGCTAACAGAAGAAAGCAGG - Intronic
908414178 1:63896690-63896712 GCTTATAAGCAGAGGGGAGCAGG + Intronic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
910258628 1:85275352-85275374 ACTCACCAGCAGAAGGAAACTGG - Intronic
910872894 1:91851208-91851230 CCTTCCAAGGAGTAGGCAGCAGG - Intronic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
915604443 1:156941793-156941815 GCTTAAAAGCAGCAGGAAACAGG + Intronic
916786956 1:168093269-168093291 CCTTACAAGCAGAAGGTATTTGG + Intronic
919294573 1:195679674-195679696 CCTTACAAGAGGAAGGAAGAAGG + Intergenic
919421981 1:197380958-197380980 CCTTAGAAGCAGTAGGAAAAGGG + Intronic
921896087 1:220402742-220402764 CCTTACAAGCAGAAGAGATTGGG - Intergenic
923400521 1:233612000-233612022 CTGTCCAAGCAGAAGGAATCAGG + Intergenic
923556888 1:235008110-235008132 CCTTACAAGGAAGAGGCAGCAGG - Intergenic
1063223713 10:3994498-3994520 CCTTACCTGTAGAAGGAAGGAGG + Intergenic
1063229673 10:4052141-4052163 CCTTACCAGCTGGAGGAAGGTGG - Intergenic
1063535472 10:6878319-6878341 CCTTACCAACAGAAGGAATAAGG + Intergenic
1064614771 10:17141454-17141476 CCTTAAAAGCAGCTGGAGGCTGG - Intergenic
1064741018 10:18434795-18434817 AATTACAAGAATAAGGAAGCAGG + Intronic
1065070675 10:22021056-22021078 CCTTGGAAGCAAAAGGAAGAAGG + Intergenic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1067717005 10:48697620-48697642 CCTTAGAAACAGAAAGAAGGCGG - Intronic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1072305050 10:94099284-94099306 ACTTAATATCAGAAGGAAGCAGG - Intronic
1073190814 10:101649641-101649663 CCTGACAAGGAGAAAGAAGCTGG - Intronic
1073265768 10:102227604-102227626 CCTGGCAAGCAGAAGGCAGAGGG - Exonic
1074235791 10:111583177-111583199 CCTTGCTAGCTGAAGGAAACTGG + Intergenic
1074453374 10:113577318-113577340 CCTTCCATGCAGAAGGGTGCAGG - Intronic
1075103009 10:119519216-119519238 TCTTACAAGGTGAGGGAAGCGGG - Intronic
1075189629 10:120294968-120294990 CCTTCTAACCAGAAGGAATCAGG - Intergenic
1075348246 10:121700556-121700578 CCTATCAATCAGCAGGAAGCAGG - Intergenic
1075955112 10:126516938-126516960 CCTTACAAGAGGGAGGAAGAAGG - Intronic
1076076941 10:127541076-127541098 CCATACATGCAGAAAGATGCAGG + Intergenic
1078007022 11:7539824-7539846 CCCCAAAAGCAGAAGCAAGCTGG + Intronic
1080649388 11:34210086-34210108 TCTTCCAAGCTGACGGAAGCTGG + Intronic
1081851251 11:46276702-46276724 CCTTTCACACAGAGGGAAGCTGG + Intergenic
1082919936 11:58482049-58482071 ACTTATAAGAAGTAGGAAGCTGG + Intergenic
1083792109 11:64992558-64992580 CCTTATAAGAAGAGGGAAGGAGG + Intronic
1084385409 11:68840747-68840769 CCTGACAAACCGAAAGAAGCCGG + Intronic
1084938957 11:72602176-72602198 CCTTACAAGCACAAGAAGACAGG + Intronic
1087820790 11:102709733-102709755 CATTACAGGCAGAAAGAAGGAGG + Intergenic
1089127237 11:116185177-116185199 CCTATCAGGCAGAAGCAAGCTGG - Intergenic
1089473709 11:118741507-118741529 TCTCAAAAGCAGAATGAAGCTGG + Intergenic
1090187430 11:124747443-124747465 CCATACCAGCAGAAAGAAGAAGG + Intergenic
1090681080 11:129057851-129057873 CCTTACAAGAAGAAGGGATTAGG + Intronic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1091767075 12:3128427-3128449 CCTTACACACAAAAGGAGGCTGG + Intronic
1094270305 12:28607202-28607224 TCTTGCAAGCAAAAGGAAGTTGG - Intergenic
1094720612 12:33059306-33059328 TCTTCCCAGCAAAAGGAAGCAGG + Intergenic
1095328064 12:40922335-40922357 CCTGACAAACAGAAAGATGCTGG + Exonic
1095494733 12:42772499-42772521 CCTTACAAGAAGGAGGCAGAGGG - Intergenic
1095772081 12:45971147-45971169 CATTAAATGAAGAAGGAAGCAGG - Intronic
1096388426 12:51210995-51211017 CCTGACAAGGAGATGGCAGCAGG - Intronic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1099734913 12:86555069-86555091 CCTTAAAAGGAAAAGGAGGCAGG - Intronic
1102344802 12:112152741-112152763 CCTTCCAAGCAACAGGGAGCTGG + Exonic
1102663042 12:114546273-114546295 CCTTACAAGAAGAGGAAATCTGG + Intergenic
1102665010 12:114564357-114564379 CCTTACAAGAAGAGGAAATCTGG - Intergenic
1102790704 12:115643023-115643045 CCTTACAGACACAATGAAGCTGG + Intergenic
1103728882 12:123013039-123013061 ACTGCCAAGCAGGAGGAAGCTGG + Intronic
1106452324 13:29894377-29894399 CCTTACATGCAGAAAGTGGCTGG - Intergenic
1107152401 13:37127406-37127428 GCTCACAAGCAGAAGGAACTTGG - Intergenic
1109038807 13:57303505-57303527 CCTTACAAACAGATGGGTGCTGG + Intergenic
1110693055 13:78454708-78454730 CATTTCATGCAGAAGGAAGTTGG + Intergenic
1111997399 13:95178453-95178475 GCTAAGAAGGAGAAGGAAGCTGG + Intronic
1112932634 13:104761162-104761184 GGTTAGAAGCAGAAGGAAGGTGG + Intergenic
1113527897 13:110995377-110995399 CCCTACAAGCAGAAGAGAGTGGG + Intergenic
1114167439 14:20234608-20234630 CCCTACAAGCAGAAGAGAGTTGG - Intergenic
1118491268 14:66263137-66263159 CATTCCAAGCAGAAGGATCCTGG - Intergenic
1118911610 14:70066484-70066506 TCTTAAAGGCAGAAGGAAGGGGG - Intronic
1121422390 14:93824779-93824801 CCTGACAAGCAGATGGAAGTGGG - Intergenic
1121668736 14:95692031-95692053 CCTTGCAGGCAGAAGGCAGTAGG + Exonic
1122759815 14:104014872-104014894 CCTTGTAAGCAGAAAGAATCAGG - Intronic
1124002128 15:25768372-25768394 ACTTGCAAGTAGAAGGAATCAGG - Intronic
1125168762 15:36741744-36741766 CCTTACAAGAAGAAGAAACTTGG - Intronic
1125461277 15:39909058-39909080 CCTTTGTAGCAGAAGGTAGCAGG - Intronic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1127219911 15:56868530-56868552 CCATTCAAGCACAAGGAAGAAGG - Intronic
1127335499 15:57979723-57979745 CCTTACTACCAGGAGGAGGCTGG - Intronic
1127344738 15:58083149-58083171 CCTTATAAGAAGAAGAAATCTGG - Intronic
1132329385 15:101001136-101001158 CTTTACATGCACAAGGATGCTGG + Intronic
1133267338 16:4593119-4593141 CCTTCCCAGCAGGAGGAAGGAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134626987 16:15729269-15729291 CCCCACAAGCAGATGGAACCAGG + Intronic
1135776745 16:25263168-25263190 CCTGACAAGCAGCTGGGAGCAGG - Intergenic
1136756044 16:32684944-32684966 AATCACAAGCAGAAGGAAACTGG + Intergenic
1136812069 16:33185428-33185450 AATCACAAGCAGAAGGAAACTGG - Intergenic
1136818545 16:33295508-33295530 AATCACAAGCAGAAGGAAACTGG - Intronic
1136825109 16:33352041-33352063 AATCACAAGCAGAAGGAAACTGG - Intergenic
1136830175 16:33450812-33450834 AATCACAAGCAGAAGGAAACTGG - Intergenic
1137015791 16:35373189-35373211 AATCACAAGCAGAAGGAAACTGG + Intergenic
1137024856 16:35463143-35463165 AATCACAAGCAGAAGGAAACTGG - Intergenic
1137876299 16:51999605-51999627 CATTTCAAGGAGAAGGAAGGGGG - Intergenic
1138273316 16:55711840-55711862 CCTTTCAGGCAGGAGGAAGGGGG + Intergenic
1138284114 16:55794769-55794791 CCTTATCAGCAAGAGGAAGCCGG + Intergenic
1138284888 16:55802218-55802240 CCTTATCAGCAAGAGGAAGCCGG - Intergenic
1141477578 16:84284078-84284100 TCTTTCAAGCAGCAGGAAGTCGG - Intergenic
1141643053 16:85352629-85352651 CCTTAGAAGGATAAGGAAGGGGG + Intergenic
1202990647 16_KI270728v1_random:8398-8420 AATCACAAGCAGAAGGAAACTGG - Intergenic
1203058184 16_KI270728v1_random:945297-945319 AATCACAAGCAGAAGGAAACTGG + Intergenic
1145880327 17:28348230-28348252 CCCTACAGTCAGAAAGAAGCTGG + Exonic
1147437093 17:40423223-40423245 CTTTCCCAGCAGAAGGAGGCTGG + Intergenic
1150752395 17:67877268-67877290 CCACAGAAACAGAAGGAAGCAGG - Intronic
1150951884 17:69812273-69812295 CATGACTAGCAAAAGGAAGCCGG + Intergenic
1151439867 17:74121345-74121367 ACATACAAGCAGAAGGAAGTAGG - Intergenic
1152733139 17:81983338-81983360 TCCTGCAAGCAGAAGGGAGCAGG - Intronic
1154029025 18:10734287-10734309 TTTTAAAAGCAGAAGGAACCTGG + Intronic
1156268513 18:35509940-35509962 GCTCACAAGAAGAATGAAGCTGG + Intergenic
1157245097 18:46046636-46046658 GCTTATAAGAAGAAGAAAGCAGG + Intronic
1157546127 18:48547687-48547709 CCCTTCCAGCAGAAGCAAGCAGG - Intronic
1157607146 18:48933071-48933093 TCTTACAATCAGCAAGAAGCGGG + Intronic
1158696521 18:59708845-59708867 CCCTATAAGAAGAAGGAAGGTGG - Intergenic
1158962518 18:62598125-62598147 CCTCAAAAGGAAAAGGAAGCGGG - Intergenic
1159180083 18:64891973-64891995 CCTTACAAGAGGAAGGCAGGGGG + Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159861071 18:73650172-73650194 CCTTCCAAGCATTAGCAAGCAGG + Intergenic
1159874765 18:73798318-73798340 TCCTAAAAGCAGTAGGAAGCTGG - Intergenic
1159954187 18:74507800-74507822 CCTGACAAGGAGAGGGAGGCCGG - Intronic
1160269420 18:77370934-77370956 CCTTACTATCAGAATAAAGCAGG + Intergenic
1160816397 19:1037871-1037893 CCTTACTACCAGGAGGAGGCCGG + Exonic
1162173895 19:8815109-8815131 CATTACAAGAAAAATGAAGCTGG + Intronic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1163108502 19:15142034-15142056 CTTTACAAGCAGCAGGAAAATGG - Intergenic
1163128807 19:15259192-15259214 GCTGCCAAGCAGCAGGAAGCAGG + Intronic
1163241338 19:16065722-16065744 CATGACAAAGAGAAGGAAGCTGG + Intergenic
1164178632 19:22800448-22800470 CGCTACAAGCAGAAGAAAGTGGG - Intergenic
1166744396 19:45133742-45133764 CCTTTAAGGCAGCAGGAAGCAGG - Intronic
1167928207 19:52840625-52840647 CCTTACAAGCATAATGAATGTGG - Exonic
1168588925 19:57616734-57616756 CCTCACAAGAGGAGGGAAGCTGG - Intronic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
925112808 2:1351100-1351122 TTATACAAGCAGAAGAAAGCAGG + Intronic
925467373 2:4119349-4119371 CCCTACAAGCAGAAGAGAGTGGG - Intergenic
926537151 2:14127518-14127540 ACTTACAAGCAGAAGGCAAAGGG + Intergenic
928697217 2:33861528-33861550 CCTCACAACCAGAAAGAAGTAGG - Intergenic
928907556 2:36383334-36383356 CCTTCCAAGGACTAGGAAGCAGG - Intronic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
930112874 2:47694190-47694212 CCTGATAAGCAGAAGGAGCCAGG + Intergenic
931573814 2:63698615-63698637 CCTAGGAAGCAGAAGTAAGCAGG + Intronic
934281348 2:91615716-91615738 CCTAACAAACTGAAGGAACCTGG - Intergenic
936515953 2:113181754-113181776 GCTTACAAGGACAAAGAAGCAGG + Intronic
937080901 2:119139008-119139030 CCTTATAAGAAGGAGGCAGCGGG - Intergenic
938244673 2:129767339-129767361 CCTTACAATGAGAAGCGAGCAGG + Intergenic
938332305 2:130456430-130456452 CCTCACCCACAGAAGGAAGCAGG - Intergenic
938357502 2:130664238-130664260 CCTCACCCACAGAAGGAAGCAGG + Intergenic
938433936 2:131271025-131271047 CCTCACCCACAGAAGGAAGCAGG + Intronic
939795900 2:146643625-146643647 CCTTAGAAGCAGAAGAAAGTGGG + Intergenic
940662765 2:156568107-156568129 CCTTAAACTCAGAAGGAAGAAGG + Intronic
940718755 2:157258497-157258519 CCTAACAAGCAGAAGACAGACGG + Exonic
941923494 2:170874032-170874054 CCTTAAAGGCAGAAGGACTCAGG + Intergenic
942750817 2:179285107-179285129 ACTTGCAAGTAGATGGAAGCTGG + Intergenic
943695679 2:190927692-190927714 CCTTAAAAGCAGAAGGGATGAGG - Intronic
944691736 2:202164754-202164776 GCCAACTAGCAGAAGGAAGCAGG - Intronic
945566694 2:211409798-211409820 CCTTAGAAGCACAAGGACACTGG + Intronic
946496703 2:220202684-220202706 CTCTTCAAGAAGAAGGAAGCTGG - Intergenic
947955307 2:234184724-234184746 CCTTACAAGAAGAAGGAAATTGG + Intergenic
948080384 2:235200682-235200704 CCTTACATGCAGAAAAAGGCAGG - Intergenic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948563125 2:238867051-238867073 CCTTCCAAGCAGAACGCACCTGG + Intronic
948601193 2:239108281-239108303 CCCTAGAAGGAGACGGAAGCTGG + Intronic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170613920 20:17934405-17934427 CCTTACAAGAAGAAGCGGGCGGG - Intergenic
1171003023 20:21433878-21433900 CCCTTCAAGCAGAAGCCAGCTGG + Intergenic
1171511598 20:25689983-25690005 CATTAAAAACAGAAGGCAGCTGG + Intronic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1173914701 20:46698338-46698360 CCTTAAAAGTAGAAGGAGGCAGG - Intergenic
1175764180 20:61581619-61581641 CCTTACAGGAGGGAGGAAGCAGG - Intronic
1177884240 21:26729973-26729995 CCTTACAAGCAAAAAGGAACTGG - Intergenic
1178115047 21:29408229-29408251 CCAAACAACCAGGAGGAAGCAGG + Intronic
1178816406 21:35933966-35933988 ACTTAGAAGGAGAAGGAAGGAGG + Intronic
1179587241 21:42381355-42381377 CTTTACAAGCTGAAAGATGCTGG - Intronic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1183661406 22:39223791-39223813 CTTTACAAACTGAAGGAAGCAGG + Exonic
1185208828 22:49555329-49555351 CCTTATAAAAAGAAGGAAACTGG + Intronic
949840483 3:8314658-8314680 CCTTACAAGAAGAGGGAATTTGG + Intergenic
950000767 3:9654599-9654621 CCTTAAAATCAGCAGGAAGTAGG - Intronic
950786697 3:15442948-15442970 CATTCCAGGCAGAAGGAATCTGG - Intronic
952205968 3:31181758-31181780 CCTTACTACCAGGAGGAGGCCGG - Intergenic
952733562 3:36665443-36665465 CCTTATAAAGAAAAGGAAGCAGG + Intergenic
953622008 3:44541619-44541641 CCTTACTAGTAGAAGGAAAAAGG + Intergenic
953687150 3:45086982-45087004 CGTTACAAGCTGAAGGTACCAGG - Intronic
954759945 3:52866743-52866765 ACTGACTAGCAGAAGGAAGTTGG + Intronic
955965436 3:64384455-64384477 CATTACAAGTGGAAGGAAACTGG + Intronic
956175651 3:66471055-66471077 CTTTACAAGCAAAAGGAATTTGG + Intronic
956811976 3:72872320-72872342 CCTTACAAGAAGAGGAAAGGAGG - Intergenic
958862202 3:99457773-99457795 CTTCTCAAGCAGAAGGAAGGGGG + Intergenic
961658314 3:128455281-128455303 CCTCAGAGGCAGCAGGAAGCAGG + Intergenic
962488080 3:135864216-135864238 CCTTGGTAGCAGAAGGAAGAGGG - Intergenic
964581579 3:158245307-158245329 CCATACAAGTACATGGAAGCTGG - Intronic
965324947 3:167291369-167291391 CCCTACAAGCAGAAGAGAGTGGG + Intronic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968717177 4:2169048-2169070 GCTGACAATCAGAAGCAAGCAGG + Intronic
969028728 4:4194488-4194510 CCTAGCAAACTGAAGGAAGCCGG + Intronic
972231464 4:37077202-37077224 CCTTACAAGCAACAGAAAACAGG + Intergenic
979715217 4:123829603-123829625 CATTAGAAGCTGAAAGAAGCAGG + Intergenic
980057465 4:128092564-128092586 CCTTACAAGGTGAAGGAAAAGGG + Intronic
982100033 4:151958671-151958693 CCTTACAAGAAGAGGGAATTTGG - Intergenic
982762982 4:159309597-159309619 CCTTAGAAGCAGATGGGGGCAGG + Intronic
983136986 4:164096597-164096619 CCTTACAAAGAGAAGGACTCTGG - Intronic
983633698 4:169876501-169876523 CCTTAAAAGCAGAATGGGGCCGG - Intergenic
986524641 5:8660600-8660622 ACTTACAACTAGAAGGAACCAGG - Intergenic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
988427828 5:31084297-31084319 GCATACAAACAGAAGGAAGAAGG + Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992454303 5:76902120-76902142 CTCTTCAAGCAGAAGGAAGGGGG + Intronic
992821924 5:80506092-80506114 CCATACAAGCATATGGAAACTGG + Intronic
993631431 5:90290716-90290738 CATTACAAGCATAATGAAGGAGG + Intergenic
993933043 5:93966351-93966373 CCTTACAAAAAGAAAAAAGCTGG + Intronic
994274376 5:97817863-97817885 CCTGGCAAGAAGAAGGAAACAGG - Intergenic
994911984 5:105921644-105921666 CCTTACAAGCAGAAGTGAAAAGG + Intergenic
996387923 5:122928359-122928381 CCTTACATGCAGAAGGGACTTGG + Intronic
996415286 5:123203950-123203972 TCTTACATGGAAAAGGAAGCTGG - Intergenic
997823192 5:137084275-137084297 CTTAGCAAGCAGAAGGAGGCAGG - Intronic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
999886242 5:155926064-155926086 CCTCACAAGCAGATGAAAGTTGG - Intronic
1000575979 5:162975788-162975810 CCTTATAAGCAGAAGCAAGGTGG - Intergenic
1001746667 5:174098000-174098022 CCTTCCCAGCAGAAGGTGGCTGG + Intronic
1001794429 5:174490286-174490308 CCATAAATGCAGAAGGCAGCTGG + Intergenic
1002871182 6:1168586-1168608 CCTTACGAGAAGAAGGCAGGAGG + Intergenic
1004971781 6:20918501-20918523 GCTTCCAATCGGAAGGAAGCAGG - Intronic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1005182305 6:23119701-23119723 TCTTACAAGGGGAAGGAAGGGGG + Intergenic
1005575022 6:27182496-27182518 CCTTGCTAACAGAAGAAAGCAGG + Intergenic
1006804816 6:36781216-36781238 CCAGACAGGGAGAAGGAAGCTGG + Intronic
1007904394 6:45444576-45444598 CCTAACAAGCTGAGTGAAGCAGG - Intronic
1008549069 6:52610333-52610355 CCTGACAGGCAGAGGGAATCCGG + Intergenic
1011912436 6:92457889-92457911 CCCTACAGGCACAAGGCAGCTGG + Intergenic
1012678870 6:102153730-102153752 CTTCTCAAGCAGAAGGAAGGGGG - Intergenic
1013079779 6:106802039-106802061 CCTTCCCAGCAGAAGGCAGGAGG - Intergenic
1013512733 6:110859118-110859140 CCTTACTACCAGGAGGAGGCTGG + Intronic
1018993379 6:168691921-168691943 CATTCCAGGCAGAAGGAAACTGG - Intergenic
1019038441 6:169082921-169082943 CCACCCAAGCTGAAGGAAGCTGG + Intergenic
1019774701 7:2905705-2905727 CCTGACCTGCAGGAGGAAGCGGG + Intergenic
1020493759 7:8822015-8822037 CCGTAAAAGCAGCTGGAAGCAGG - Intergenic
1021065805 7:16170964-16170986 CCCCACAAGAAGAGGGAAGCCGG + Intronic
1022195998 7:28067884-28067906 ACTTAGAAGCAGAAGGAGACGGG - Intronic
1024026486 7:45413949-45413971 TCTCACAAGAAGAAGGAATCAGG - Intergenic
1024081463 7:45859486-45859508 CCTGCCAACCTGAAGGAAGCTGG + Intergenic
1029969328 7:104773679-104773701 CCTTACAAAGAGAAGAAACCTGG + Intronic
1030518707 7:110569570-110569592 ACTGACAAGCAGAAAGAAGGAGG - Intergenic
1031090275 7:117346581-117346603 CCCTACAAGCTAAAGGAATCGGG - Intergenic
1032130340 7:129222802-129222824 CCTGGCAAGGAGAAGGAAGGAGG - Intergenic
1032142415 7:129344781-129344803 CCTTAAAAGGGGCAGGAAGCGGG + Intronic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1035451488 7:158979953-158979975 CCTTACAACCAGGAGGACTCCGG - Intergenic
1037336799 8:17800718-17800740 CCTTCTCAGCAGAAGCAAGCGGG - Intronic
1038203851 8:25445092-25445114 CCTTAGAAACTGAAAGAAGCTGG + Intronic
1038592664 8:28854494-28854516 TCTTTCAAGAAGAAGGAAACAGG + Intronic
1039370895 8:36982896-36982918 CCTTACAAGAAGAGGGAATTAGG + Intergenic
1039436608 8:37563856-37563878 CCACAAAAGCAGAAGGAAGAAGG + Intergenic
1039774519 8:40722479-40722501 CATTACAAGCATAATAAAGCTGG - Intronic
1042383434 8:68146221-68146243 CATATCAAGCAGAAGGAAGTCGG + Exonic
1042886171 8:73554478-73554500 CCTTCTAGGCAGAAAGAAGCTGG + Intronic
1047184985 8:122624741-122624763 CCTTACAAGAAGAAGAAAAGAGG - Intergenic
1047557878 8:125952233-125952255 CATTTCAAGCAGAAGGAAAATGG - Intergenic
1050061271 9:1712080-1712102 GGTTACAGGCAGATGGAAGCAGG + Intergenic
1051035065 9:12734538-12734560 CCTTATAAGCAAAAGGCAGCAGG + Intergenic
1051972123 9:22901608-22901630 CCTTATAAGAAGAAGAAAGAGGG + Intergenic
1052676085 9:31626571-31626593 CCTTAAGAGCAGGAAGAAGCAGG + Intergenic
1055401173 9:75925681-75925703 CATTTCAGGCAGAAGGAAGGAGG + Intronic
1060407205 9:123378732-123378754 CCTAACATGCAGATGAAAGCTGG + Exonic
1061374982 9:130218915-130218937 CCTTACAAGCACCTGGGAGCTGG + Intronic
1061559102 9:131391391-131391413 CCTCACAAGAGGAAGGAAGGAGG - Intergenic
1186925384 X:14328249-14328271 CCTTATAAGCACATGGAAGCTGG - Intergenic
1188581874 X:31723759-31723781 TTTGAAAAGCAGAAGGAAGCTGG - Intronic
1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG + Exonic
1194386463 X:93261634-93261656 GCTTACGAGCACAAGGAAGTAGG - Intergenic
1195746515 X:108124058-108124080 CCTCACAGGCAGAAGAAATCAGG - Intronic
1196752443 X:119130138-119130160 TCTTGCAGGCAGCAGGAAGCTGG - Intronic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199385672 X:147220402-147220424 CCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199399312 X:147377978-147378000 GCTTACAAGCAGAAATAAGATGG - Intergenic
1200802034 Y:7395579-7395601 CCTTGCTAACAGAAGAAAGCAGG + Intergenic