ID: 1127173563

View in Genome Browser
Species Human (GRCh38)
Location 15:56328860-56328882
Sequence GTCTGTCCTTCTCTTCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 18, 3: 124, 4: 383}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127173563_1127173571 18 Left 1127173563 15:56328860-56328882 CCACCCTGAAGAGAAGGACAGAC 0: 1
1: 0
2: 18
3: 124
4: 383
Right 1127173571 15:56328901-56328923 CCTGCTGATTGTAGAGTCCTAGG 0: 10
1: 74
2: 265
3: 469
4: 938
1127173563_1127173572 19 Left 1127173563 15:56328860-56328882 CCACCCTGAAGAGAAGGACAGAC 0: 1
1: 0
2: 18
3: 124
4: 383
Right 1127173572 15:56328902-56328924 CTGCTGATTGTAGAGTCCTAGGG 0: 7
1: 72
2: 238
3: 374
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127173563 Original CRISPR GTCTGTCCTTCTCTTCAGGG TGG (reversed) Intronic
900098013 1:948228-948250 CTCTCTCCTGCTCTTCAGGACGG - Exonic
901078199 1:6568798-6568820 CTCTTTCCTTCTCTTCTGGAAGG + Intronic
901719640 1:11186305-11186327 GTCTCTCCTTCTATCCAGAGAGG - Intronic
903332629 1:22603787-22603809 GTCTGTCCTTGGCTTTAGGCAGG - Intergenic
904608858 1:31714455-31714477 GTCTGTCCTAGACTTCAGGGTGG - Intergenic
905264705 1:36743676-36743698 GTCTGTTCTTCTCTTGGGGAAGG - Intergenic
906352820 1:45078740-45078762 CTGTGTCCTTCTCTTCAGGATGG + Intronic
906399791 1:45496473-45496495 GTCTATCCTGTTCTGCAGGGAGG - Exonic
909270405 1:73617057-73617079 CTGTGTCCTTCCCTTCAGGGAGG + Intergenic
909615777 1:77606417-77606439 TTGTGTCCTTCCCTTCAGGGCGG - Intronic
910170514 1:84372112-84372134 ATCAGTCCTTCACCTCAGGGAGG + Intronic
910384544 1:86666488-86666510 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
910470341 1:87546526-87546548 TTTTGTCCTTCTCTTTAGGGAGG + Intergenic
910515303 1:88053993-88054015 TTGTGTCCATCCCTTCAGGGTGG + Intergenic
911239306 1:95448467-95448489 TTGTGTGCTTCCCTTCAGGGTGG + Intergenic
911632734 1:100200618-100200640 GTCTGTCATTCCCTGCTGGGAGG - Intronic
912117039 1:106419404-106419426 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
912633186 1:111267097-111267119 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
912871663 1:113312019-113312041 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
913334368 1:117695475-117695497 GTCTGCCCTAATCTTCATGGAGG + Intergenic
913706998 1:121434936-121434958 TCGTGTCCTTCCCTTCAGGGTGG - Intergenic
913978497 1:143487244-143487266 GCCTGTTCTTCTCTCCAAGGAGG - Intergenic
914072909 1:144312892-144312914 GCCTGTCCTTCTCTCCAAGGAGG - Intergenic
914106245 1:144653468-144653490 GCCTGTCCTTCTCTCCAAGGAGG + Intergenic
915752918 1:158228638-158228660 GTTTGTCCTTACCTTCAGAGTGG - Intergenic
916360646 1:163963350-163963372 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
917226335 1:172788045-172788067 CTGTGTCCTTCTCTTCAGAGTGG + Intergenic
917373005 1:174316720-174316742 CTGTGTCCTTCCCTTTAGGGTGG + Intronic
918018664 1:180663710-180663732 TTGTGTTCTTCTCTTAAGGGTGG + Intronic
919003209 1:191860911-191860933 CTGTGTCCTTCCCTTCAAGGTGG - Intergenic
919067843 1:192715113-192715135 TCATGTCCTTCCCTTCAGGGTGG - Intergenic
919455978 1:197819490-197819512 TTCTGTTCTTCCCTTAAGGGTGG - Intergenic
920230223 1:204465316-204465338 GTCTGCTCTTCTCTTAAAGGTGG - Exonic
921398249 1:214692057-214692079 GTCTGTCCTTCCCTTCAGTATGG + Intergenic
922666614 1:227474609-227474631 GTCTGTCATCCTCTGCTGGGAGG - Intergenic
923886535 1:238164135-238164157 CTGTGTCCTTCTTTTTAGGGTGG + Intergenic
1063197333 10:3755902-3755924 GCCTGTCCTGCTCTTCAGATAGG + Intergenic
1063324854 10:5087932-5087954 GTCTTTCTATCTTTTCAGGGAGG + Intronic
1064095809 10:12423900-12423922 GTCTCTGCTGCTCTTCAGCGGGG + Intronic
1064180327 10:13109146-13109168 GGCTGTCCTCCTTTTCAGTGAGG - Exonic
1064961044 10:20965343-20965365 GTCTGCCCTTCTAGACAGGGTGG + Intronic
1064987428 10:21225453-21225475 TTATGTTCTTCTCTTGAGGGTGG + Intergenic
1066649637 10:37642426-37642448 TTATGTCCTTCCCTTCAAGGTGG + Intergenic
1067032528 10:42887975-42887997 TTGTGTCCTTCCCTTCAGGATGG + Intergenic
1067340907 10:45402690-45402712 GAGTGTCCTTATCTTGAGGGAGG - Intronic
1068217352 10:53999777-53999799 CTGTGTCTTTCCCTTCAGGGTGG - Intronic
1068411309 10:56659791-56659813 CTTTGTCCTTCTCTTCAGGGTGG + Intergenic
1068478695 10:57562381-57562403 CTGTGTCCTTCCCTTCAGGATGG + Intergenic
1068836365 10:61558870-61558892 CTCTGACCTTTTCTTCAGGTTGG - Intergenic
1069248884 10:66244323-66244345 TTATGTCCTTCCCTTCCGGGTGG - Intronic
1069343572 10:67440418-67440440 TTATGTCCTTCCCTTCAGAGTGG - Intronic
1069903266 10:71718076-71718098 GTCTTTCCTTTTCATGAGGGTGG + Intronic
1069941790 10:71961720-71961742 CTCTTTCCTTCTCTTCTGGAAGG + Intergenic
1071215197 10:83393216-83393238 CTTTGTCTTTCTCTTCAGGGTGG + Intergenic
1071896654 10:90075573-90075595 TTATGTCCTTCCCTTCAGGGTGG + Intergenic
1072781604 10:98255516-98255538 GCCTGTGCTCCCCTTCAGGGAGG - Intronic
1073572458 10:104592071-104592093 AACTGTTCTTCTCTTCAGGTGGG - Intergenic
1073678910 10:105680389-105680411 CTGTGTCCTTTCCTTCAGGGTGG - Intergenic
1073823315 10:107290989-107291011 CTGTGTCCTTCTCTTCAGGAGGG + Intergenic
1074024948 10:109624791-109624813 GTCTTTGCTTATTTTCAGGGAGG - Intergenic
1074038121 10:109761506-109761528 TTGTGTCCTTCCCTTCAGGGAGG + Intergenic
1074226830 10:111493288-111493310 GTAGGTCCTTCCTTTCAGGGTGG + Intergenic
1074368295 10:112877881-112877903 GTATGTCCTCCTCTTCAAAGAGG - Intergenic
1074803637 10:117026811-117026833 CTCTGTCCTTTCCTTCAGGATGG - Intronic
1077417842 11:2433118-2433140 GCCTGTCCTTCTACTCTGGGAGG + Intergenic
1077427513 11:2490353-2490375 TTTTGTCCTTCACTTTAGGGTGG - Intronic
1077473786 11:2776968-2776990 CTGTGTCCTTCTCTCCAGGCTGG + Exonic
1078331414 11:10425516-10425538 GTCTGTCCATCCCTGCTGGGAGG + Intronic
1079183588 11:18215579-18215601 CTGTGTCCTTCCCTTCAGGGTGG - Intronic
1079961335 11:26927860-26927882 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
1080128661 11:28767168-28767190 TTGTGTCCTTCCCTTCAGTGTGG - Intergenic
1082122670 11:48396268-48396290 CTGTGTCCTTCTTTTCAGGGTGG + Intergenic
1082251965 11:49992404-49992426 CTGTGTCCTTCTTTTCAGGGTGG - Intergenic
1082556374 11:54567544-54567566 CTGTGTCCTTCTTTTCAGGGTGG + Intergenic
1082876250 11:57992121-57992143 GTCTGTCCATCCCTGCTGGGAGG + Intergenic
1083512695 11:63226711-63226733 TTGTGTCCTTCCTTTCAGGGTGG + Intronic
1084557050 11:69881538-69881560 GTCTTCCCATCTCATCAGGGTGG - Intergenic
1084938664 11:72600823-72600845 ATCTGTCCTTATCTTCAGTGGGG - Intronic
1084959325 11:72708023-72708045 GCATGCCCTGCTCTTCAGGGTGG + Intronic
1085008109 11:73114001-73114023 CTCTGTCCTTCCCTTTAGGGTGG + Intronic
1085178532 11:74511699-74511721 TTGTGTCCTCCCCTTCAGGGTGG - Intronic
1085708411 11:78807615-78807637 GTCTATCTTTCTCTTTAGGGAGG + Intronic
1086068839 11:82776434-82776456 CTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1086992164 11:93315259-93315281 TTCTGTCCTCCTCTTCAGTCTGG + Intergenic
1087031937 11:93715064-93715086 TTATGTCCTTGCCTTCAGGGTGG + Intronic
1087150677 11:94856753-94856775 GTCTGTTGTTCTGTTGAGGGTGG - Intronic
1087720898 11:101664675-101664697 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
1087877022 11:103370399-103370421 CTGTGTCCTTCCCTTCAGGTTGG - Intronic
1087950738 11:104218309-104218331 TTATGTTCTTCCCTTCAGGGTGG + Intergenic
1088181906 11:107121965-107121987 TTGTGCCCTTCCCTTCAGGGTGG - Intergenic
1088411436 11:109539148-109539170 TTGTGTCCTTCCTTTCAGGGTGG + Intergenic
1088413834 11:109567518-109567540 TGCTGGCCTTCTCTGCAGGGAGG - Intergenic
1088570014 11:111213657-111213679 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
1089620821 11:119721242-119721264 CTGTGTCCTCCTCTTCAGGCAGG + Intronic
1092477006 12:8828172-8828194 TTGTGTCCTCCCCTTCAGGGTGG + Intronic
1093123947 12:15306522-15306544 CTGTGTCCTTCCCTTCAGTGTGG + Intronic
1093259428 12:16917448-16917470 TTTTGTCCTTCCATTCAGGGTGG + Intergenic
1093617291 12:21241594-21241616 CTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1095169777 12:39020302-39020324 TTATGTTCTTCCCTTCAGGGTGG - Intergenic
1095874293 12:47063718-47063740 CTGTGTCCCTCTCTTCAGAGAGG + Intergenic
1097425966 12:59445477-59445499 TTGTGTCCTTCCATTCAGGGTGG + Intergenic
1097473162 12:60021215-60021237 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1098207834 12:68132167-68132189 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1098491952 12:71092588-71092610 CTGTGTCCTCCACTTCAGGGTGG + Intronic
1099279086 12:80620240-80620262 GTCTTTCCTTCTGTACATGGAGG - Exonic
1100360716 12:93877397-93877419 CTGTGACCTTCCCTTCAGGGTGG + Intronic
1100819613 12:98419106-98419128 TCCTGCCCTTCTCTTTAGGGTGG + Intergenic
1100904991 12:99286978-99287000 TTATGCCCTTCCCTTCAGGGTGG - Intronic
1100909098 12:99338095-99338117 TTGTGTACTTCCCTTCAGGGAGG + Intronic
1100923883 12:99521949-99521971 CTGTGTCCTTCCCTTTAGGGCGG + Intronic
1101226750 12:102694963-102694985 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1102318034 12:111905547-111905569 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1102902503 12:116649156-116649178 GTCTTGCCTTGTCCTCAGGGTGG - Intergenic
1103594177 12:122013601-122013623 GTCTGTCTCTCTCTTCACTGGGG - Intergenic
1105220831 13:18324151-18324173 GCCTGTCCTTCTCTCCAAGGAGG + Intergenic
1105336309 13:19473275-19473297 CTGTGTCCTTCCCTTCAGGATGG + Intronic
1106074861 13:26449152-26449174 TTGTGTCCTTCCCTTCAGGATGG - Intergenic
1106349903 13:28920623-28920645 TTGTGTCCCTTTCTTCAGGGTGG + Intronic
1106963986 13:35037912-35037934 CTGTGTCCTTCTCTTCAGGGTGG + Intronic
1107093655 13:36511853-36511875 GTCTGTTCTTGTATTCAGAGGGG + Intergenic
1107524127 13:41213603-41213625 TTGTGTCCGTCTCTTCAGGATGG + Intergenic
1108922617 13:55694051-55694073 CTGTGTCCTTCCCTTCATGGTGG - Intergenic
1108973319 13:56403419-56403441 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
1109100632 13:58180436-58180458 TTCTCTCCTTCCCTTCAGGGTGG + Intergenic
1109522668 13:63533647-63533669 CTGTGTCTTTCTCTTCAGCGTGG + Intergenic
1112053722 13:95670794-95670816 TTCTGTCTTTCTCTTCAGGATGG + Intergenic
1112493159 13:99884959-99884981 TTGTGTCCTTCTATTCAGGTAGG + Intronic
1112940534 13:104855668-104855690 TTGTGTCCTTCACTTTAGGGTGG - Intergenic
1114072585 14:19126571-19126593 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1114089671 14:19273401-19273423 CTGTGTCCTTCTCTTCAGGGTGG - Intergenic
1115821078 14:37212645-37212667 CTATGTCCTTCCCTTCAGGGTGG - Intronic
1116021553 14:39468449-39468471 TTGTGTCCTTTCCTTCAGGGCGG + Intergenic
1116835027 14:49762100-49762122 TTTTGTCCTTCTCTTCACAGTGG + Intergenic
1117300345 14:54419637-54419659 CTCTGTCCTTCTTACCAGGGGGG + Intronic
1118113827 14:62751907-62751929 GTCTGTCCTTCTCTTGAGGTAGG + Intronic
1118241082 14:64059742-64059764 TTGTGTCCTTCCCTTAAGGGTGG + Intronic
1118862663 14:69676835-69676857 TTCGGTTCTTCTCTTCAGGCAGG - Intronic
1120394937 14:83956787-83956809 GTTTGTCCTTCCCTTGAGGTAGG - Intergenic
1120426258 14:84351529-84351551 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1121088506 14:91164908-91164930 CTGTGTCCTTCCCTGCAGGGTGG + Intronic
1121088666 14:91166312-91166334 CTGTGTCCTTCCCTGCAGGGTGG + Intronic
1121759684 14:96434659-96434681 CTGTTTCCTTCCCTTCAGGGTGG + Intronic
1122782872 14:104150966-104150988 GTCTGTCCTGCTCTCTGGGGAGG - Intronic
1123679328 15:22747151-22747173 GTCTGTTCTTGACTTCAGAGGGG - Intergenic
1124081305 15:26500871-26500893 CTGTGTCCTTCCCTTCAGAGTGG + Intergenic
1125044409 15:35230087-35230109 CTGTGTCCTTTTCTTCAGGGTGG + Intronic
1125272371 15:37953141-37953163 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1126015749 15:44348588-44348610 TTGTGTCCTTCCTTTCAGGGTGG - Intronic
1126053235 15:44706821-44706843 TTATGTCCCTCTCTTTAGGGTGG + Intronic
1126517543 15:49553495-49553517 CTGTGTCCTTCCCTTCAGGGTGG + Intronic
1126852695 15:52806568-52806590 ATCTGGCCTTCTCTAGAGGGAGG - Intergenic
1127173563 15:56328860-56328882 GTCTGTCCTTCTCTTCAGGGTGG - Intronic
1128900970 15:71422756-71422778 TTGTGTCCTTCCCTTTAGGGTGG + Intronic
1129501146 15:76038687-76038709 TTGTGTCCTTCCCTTCAGGGCGG - Intronic
1129642483 15:77394205-77394227 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
1130441072 15:83955084-83955106 TTATGTTCTTCCCTTCAGGGAGG + Intronic
1130564032 15:84979967-84979989 GGCCGTACTTCTCTGCAGGGCGG + Intergenic
1131323438 15:91420356-91420378 CTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1132230551 15:100180883-100180905 GCTTGTCCTTCCCTTCAGGGCGG + Intronic
1132510821 16:340500-340522 GGCTCTGCTTCCCTTCAGGGTGG - Intronic
1134510839 16:14845656-14845678 TCCTGTCCTTCTCTTCATGATGG + Intronic
1134698480 16:16244143-16244165 TCCTGTCCTTCTCTTCATGATGG + Intronic
1134973354 16:18550535-18550557 TCCTGTCCTTCTCTTCATGATGG - Intronic
1140920798 16:79535923-79535945 CTCTGTCCTTGACTTCATGGCGG - Intergenic
1142164179 16:88576954-88576976 GCCTGTCTTTCTCTGCAGAGTGG + Intronic
1142574708 17:898902-898924 GTCCTTCCTTCTTTGCAGGGAGG - Intronic
1143888201 17:10082264-10082286 TTCTTTCCTTCTCTTCCTGGAGG - Intronic
1146133113 17:30295277-30295299 CTCTGTCCTCATCATCAGGGTGG + Intergenic
1146216684 17:30982111-30982133 TTGTGTCCTTCCCTTCATGGTGG + Intronic
1148124091 17:45228095-45228117 GTCTGTTCCTGTTTTCAGGGTGG + Intronic
1148984432 17:51609458-51609480 TTCTGTCCTGAGCTTCAGGGAGG + Intergenic
1149157284 17:53647321-53647343 CTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1149184311 17:53979308-53979330 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1149906322 17:60529377-60529399 GTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1150208122 17:63424579-63424601 CTCTGTCCTCCATTTCAGGGTGG - Exonic
1150220376 17:63492627-63492649 TTCTGTCATTCTCATCGGGGAGG - Intronic
1150550446 17:66204684-66204706 TTGTGTCCCTCCCTTCAGGGTGG - Intergenic
1151817600 17:76478952-76478974 GCCTGTCCATCTCCTCCGGGTGG + Exonic
1152857762 17:82675902-82675924 GTGGGTCCTTCTCACCAGGGGGG + Intronic
1153183192 18:2459156-2459178 TTATATCCTTCCCTTCAGGGTGG + Intergenic
1154491211 18:14923582-14923604 TTCTGTCCTTCCCTTCAGGGTGG - Intergenic
1155597373 18:27503069-27503091 TTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1156094329 18:33510834-33510856 TTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1156685208 18:39636950-39636972 GTCTGTTCTGCTTGTCAGGGAGG - Intergenic
1157079404 18:44506503-44506525 CTCTGTCATTCTCTTCAGTTGGG - Intergenic
1157276855 18:46316679-46316701 GTCTGTGCTTCTCCCCAGAGGGG - Intergenic
1158873282 18:61709538-61709560 GTTTGTCCTTCTCTTGAGGCAGG - Intergenic
1158948930 18:62474276-62474298 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1159260284 18:66004808-66004830 TTGTGTTCTTCTCTTCAGGGCGG - Intergenic
1159395193 18:67846847-67846869 GTCTGTGCTCCTGTTCAGGCAGG - Intergenic
1159575836 18:70175933-70175955 GCCTTTCCTTCTCTTCAGCTAGG - Intronic
1160836005 19:1124701-1124723 GGCAGTCCTTCTCCCCAGGGTGG - Intronic
1162692940 19:12449028-12449050 TTGTTTCCTTCCCTTCAGGGTGG + Intronic
1162731904 19:12723354-12723376 GTTTTTCCTTCTCTTGAGAGAGG + Exonic
1166643520 19:44514032-44514054 GTCTGTGCCTCTATTCTGGGAGG - Intronic
1166757351 19:45201541-45201563 TTGTGTCCTTCCCTTCAGGATGG + Intronic
1167748262 19:51365491-51365513 GTCTGTCCTTCCCATCAGCCTGG - Intronic
1168605784 19:57759039-57759061 TTATGTCCTTCCCTTCAGAGTGG - Intergenic
925698866 2:6613128-6613150 TTATGTCCTTCCCTTCAGGATGG + Intergenic
927309710 2:21616989-21617011 CTGTGTCCTTCACTTCAGGGTGG + Intergenic
927594652 2:24385980-24386002 CTGTGTCCTTCCCTTCAGGACGG + Intergenic
927895760 2:26780725-26780747 GCCACCCCTTCTCTTCAGGGTGG - Exonic
927919906 2:26964213-26964235 ATCTGTGCTTCTCTTCATAGTGG - Intergenic
928472302 2:31586332-31586354 CTGTGCCCTTCCCTTCAGGGTGG - Intergenic
928679873 2:33690705-33690727 GCCTGTCCTTATGTTCAGGATGG + Intergenic
928715458 2:34055465-34055487 TTGTGTCCTTCCCTTTAGGGTGG + Intergenic
928783659 2:34854982-34855004 CTATGTCCTTCCCTTCATGGTGG - Intergenic
928802984 2:35116257-35116279 CTGTGTCCTTTTCTTTAGGGTGG - Intergenic
928862390 2:35874701-35874723 CTATATCCTTCCCTTCAGGGTGG + Intergenic
929040276 2:37737920-37737942 GTTTTTCCTTTTATTCAGGGAGG + Intronic
929281646 2:40086992-40087014 TTGTGTCCTTCCCTTCATGGTGG + Intergenic
929303793 2:40336243-40336265 GCCTGTCCTTCACTTGAAGGTGG + Intronic
930159300 2:48137955-48137977 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
930288777 2:49467560-49467582 TTGTGTCCTTCGCTTCAGGGTGG + Intergenic
931572346 2:63681612-63681634 CTGTGTCCTTCCCTTCAAGGTGG - Intronic
931637346 2:64352362-64352384 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
932491974 2:72128137-72128159 CTGGGTCCTTCTCTTCTGGGTGG + Intergenic
933162938 2:79045600-79045622 CTGTGTCCTTCACTTCAGGATGG - Intergenic
933740666 2:85531474-85531496 GGCTGTCCTTCTTTTCACAGAGG + Intergenic
934183224 2:89648325-89648347 GCCTGTCCTTCTCTCCAAGGAGG - Intergenic
934293504 2:91722495-91722517 GCCTGTCCTTCTCTCCAAGGAGG - Intergenic
934748177 2:96773468-96773490 GGCTGCCCTGCTGTTCAGGGTGG + Intronic
934969844 2:98754488-98754510 GTCTGTCCTTCCCTTGAGGCAGG - Intergenic
935478528 2:103556585-103556607 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
936901262 2:117484542-117484564 TTGTGTCCTTCTCTTCAAGGTGG + Intergenic
936925424 2:117731519-117731541 CTGTGTCCTTCCCTTTAGGGTGG - Intergenic
937428330 2:121817877-121817899 GTTAGCCCTTCTCTCCAGGGTGG + Intergenic
937552205 2:123108040-123108062 CTATGTCCTACTCTTCAAGGTGG + Intergenic
937739553 2:125333876-125333898 CTCTGTCTTCCTTTTCAGGGTGG - Intergenic
938486824 2:131720044-131720066 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
939244731 2:139609415-139609437 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
941745881 2:169087044-169087066 TTGTGTCCTTCCCTTCGGGGTGG + Intronic
942764726 2:179441370-179441392 GGCTGTTCTTCTCTTCCCGGTGG - Intergenic
943118875 2:183709790-183709812 GTCTTTCTTTCCCTTTAGGGTGG + Intergenic
943237163 2:185337597-185337619 ATGTGTCCTTCCCTTCATGGTGG + Intergenic
943427810 2:187758740-187758762 TTGTATCCTTCCCTTCAGGGTGG + Intergenic
944760459 2:202808532-202808554 TTGTGTCGTTCTCTTCAGGGTGG - Intronic
944854995 2:203759270-203759292 TTGTGTCTTTTTCTTCAGGGAGG + Intergenic
945461643 2:210116332-210116354 TTGTGTCCTTCCCTTAAGGGTGG - Intronic
945739682 2:213644923-213644945 CTGTGTCCTTTTCTTCAGGGTGG + Intronic
945948780 2:216019411-216019433 GTGTCTGTTTCTCTTCAGGGAGG - Intronic
946180015 2:217943308-217943330 GTCTGACCTTGGCTGCAGGGAGG - Intronic
946335019 2:219030525-219030547 GTGTGTCCTTCTCCTCAGCTGGG - Intronic
946353318 2:219169488-219169510 CTCTGCCCCTCTCTCCAGGGAGG + Intronic
946690196 2:222303674-222303696 GTGTGTCCTGCTCTTGGGGGAGG + Intronic
947847249 2:233254550-233254572 CTCCAGCCTTCTCTTCAGGGAGG + Intronic
948559079 2:238838561-238838583 GGCTGACCCTCTCTCCAGGGAGG - Intergenic
1169617886 20:7470897-7470919 CTGTGTCCTTCACTTCAAGGCGG + Intergenic
1169628692 20:7600824-7600846 TTGTGTCCTTCCCTTTAGGGTGG - Intergenic
1169654297 20:7905656-7905678 GTCAGCCATTCTCTTCAGAGAGG + Intronic
1170311555 20:14997678-14997700 TTCTGTCTTTCCCTTCAGGGTGG - Intronic
1172067753 20:32233685-32233707 GTGAGCCCTTCTCTTGAGGGAGG - Intronic
1172225499 20:33302692-33302714 GAATGCCCTTCCCTTCAGGGAGG - Intronic
1172889248 20:38252495-38252517 CTCTGTCTTTCTCTTCTGTGCGG - Intronic
1172907661 20:38380947-38380969 GCCAGTCCTTCTCTACAGGTTGG - Intergenic
1173134707 20:40429161-40429183 GTCTCTCCTTCTCTTGGTGGTGG + Intergenic
1173824868 20:46041675-46041697 TTCTGTCCTTGGCATCAGGGAGG + Intronic
1174486187 20:50862706-50862728 GGCTGTGCTTCTCTGTAGGGAGG + Intronic
1176117169 20:63438111-63438133 GTCTGTCCGTATTTTCAAGGTGG + Intronic
1177592301 21:23185925-23185947 TTTTTTCCTTCCCTTCAGGGTGG - Intergenic
1177813962 21:25955698-25955720 GTCTGTCCTTCTGTTCTGCGCGG + Exonic
1178007317 21:28235584-28235606 TTATGTTCTTCCCTTCAGGGCGG - Intergenic
1179657995 21:42857315-42857337 GTCAGTCGGTCTCTTCTGGGTGG - Intronic
1180491033 22:15848946-15848968 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1180563245 22:16639363-16639385 CTGTGTCCTTCCCTTCAGGATGG - Intergenic
1181627737 22:24133077-24133099 GTCTCTCCTTCCCCTCAGGGTGG + Intronic
1182674767 22:32030345-32030367 GTGTGCCGTTCTCTTCAAGGGGG + Intergenic
1182774590 22:32821548-32821570 GTCTGCCCTGGTCTTCAGGCTGG + Intronic
1183125777 22:35780187-35780209 CTCTGGCCTTCTCTTTAGTGCGG + Intronic
1183531883 22:38360781-38360803 CTGTGTCCTTCCCTTCAGGATGG + Intronic
1183749982 22:39714402-39714424 GTCTGCGCTATTCTTCAGGGTGG + Intergenic
1203292549 22_KI270736v1_random:9462-9484 GTTTTTCCTTTTATTCAGGGAGG + Intergenic
949395727 3:3613092-3613114 GTCTGTCCTTCTGTTCTCTGTGG - Intergenic
949829172 3:8196385-8196407 TTGTGTCCTTCCCTTTAGGGTGG + Intergenic
950705041 3:14774337-14774359 GTCTGTCCTTGTGCTCAGGAGGG - Intergenic
951204451 3:19910529-19910551 CTGTGTCCTTCCCTTCAGGGTGG - Intronic
951279466 3:20731112-20731134 TTGTGTTCTTCCCTTCAGGGTGG + Intergenic
951436898 3:22675969-22675991 TTGTGTACTTCTCTTCAGGGTGG + Intergenic
951904381 3:27689186-27689208 CTCTGTCCTTCCCCTCAGGGTGG - Intergenic
952139750 3:30465685-30465707 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
953309437 3:41863020-41863042 GCCTGTCCTTCCCTTCAGGGCGG + Intronic
954461966 3:50632247-50632269 ATCTGTGCTCCTCTTCATGGGGG + Intronic
955074576 3:55601603-55601625 GTGTCTGCTTCTCTTCAGAGGGG - Intronic
958876766 3:99625267-99625289 CTTTGTCCTTCACTTCAGGGTGG - Intergenic
959113532 3:102149371-102149393 TTGTGTCCTTCCATTCAGGGTGG - Intronic
959189790 3:103097037-103097059 CTGTGAACTTCTCTTCAGGGCGG + Intergenic
959547360 3:107612812-107612834 TTGTGTCCTTCTGTTCAGGGTGG + Intronic
959717108 3:109444737-109444759 CTGTGTTCTTCTCTTCAGAGTGG - Intergenic
959841722 3:110984132-110984154 TTGTGTCCTTCTCTTCAGCGTGG - Intergenic
960404231 3:117239275-117239297 CTGTGTCCTTCTCTTCAGGTTGG - Intergenic
960747899 3:120909164-120909186 CTCTGTCTCTCTCTTAAGGGCGG - Intronic
961202155 3:125053890-125053912 CTCTTTCCTTCTCTTAGGGGCGG - Intronic
961690825 3:128668344-128668366 GTTTGTCCTTCCCTTGAGGCAGG - Intronic
962015234 3:131432171-131432193 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
962698931 3:137978505-137978527 TTGTATCCTTCCCTTCAGGGTGG + Intergenic
964036139 3:152199386-152199408 GTCTTTCCTTCTCTTCTGTCAGG - Intergenic
964179483 3:153865900-153865922 ATGTGTCTTTCCCTTCAGGGTGG - Intergenic
964349894 3:155791906-155791928 TTGTGTCCTTCTCTTCTGGGTGG - Intronic
964354896 3:155841069-155841091 GTCTGTCTTTCTCTTGAGACAGG - Intronic
964398356 3:156272272-156272294 TTTTGTCCTTCCTTTCAGGGTGG + Intronic
965059929 3:163772759-163772781 TTGTGTCCTTCCCTTCTGGGTGG + Intergenic
965080334 3:164024485-164024507 CTCTTTCCTTCTCTTCTGGAAGG + Intergenic
965526981 3:169731170-169731192 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
965844598 3:172946770-172946792 TTGCGTCCTTCCCTTCAGGGTGG - Intronic
966151188 3:176869092-176869114 TTGTATCCTTCCCTTCAGGGTGG - Intergenic
966312960 3:178615340-178615362 CTCTGTCCTTCCCTTCAGGATGG + Intronic
967123816 3:186407162-186407184 CTCGGCCCTTCTCTTCAGGGAGG - Intergenic
968096228 3:195932673-195932695 TTGTGTCTTTCTTTTCAGGGCGG - Intergenic
970910380 4:21268548-21268570 GTCTGACTTTGTCTTGAGGGAGG + Intronic
970915462 4:21328649-21328671 TTATTTCCTTCCCTTCAGGGCGG + Intronic
971891540 4:32529816-32529838 CTGTGTCCTTCCCTTTAGGGTGG - Intergenic
972104078 4:35461190-35461212 CTATGTCCTTCCCTTCAAGGCGG + Intergenic
972851691 4:43057832-43057854 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
973327358 4:48877387-48877409 GTGTATCCTTCCCTTCAGAGTGG + Intergenic
973919723 4:55673077-55673099 TTGTGTCCTTCCCTTCAGAGAGG + Intergenic
974267024 4:59598637-59598659 TTTTGTCCTTCCCTTCAAGGTGG - Intergenic
976016501 4:80560891-80560913 CTGTGTCCTTCCCTTTAGGGTGG - Intronic
976762751 4:88568345-88568367 TTCTGTCCTTCTCTTCATGGTGG + Intronic
977184964 4:93925469-93925491 TTCTGTCCTTCCCTTCAATGTGG - Intergenic
978008570 4:103651122-103651144 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
978082859 4:104616097-104616119 TTTTGTCCTGCCCTTCAGGGTGG + Intergenic
978116250 4:105023073-105023095 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
978584723 4:110265074-110265096 GTCTGTGTTTCAGTTCAGGGGGG + Intergenic
979073388 4:116240578-116240600 TTATGTCCTTCCCTTCAGGGAGG + Intergenic
979213205 4:118132131-118132153 TTGTGTCCTTCCCTTCAGAGCGG + Intronic
979573071 4:122252729-122252751 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
980597005 4:134967185-134967207 TTGTGTCTTTCTTTTCAGGGAGG - Intergenic
980960480 4:139470117-139470139 CTGTGTCCTTCTCTTCAGGGTGG + Intronic
982918482 4:161244798-161244820 TTCTGCTCTTCTCTTCATGGAGG + Intergenic
983017307 4:162628922-162628944 TTTTGTCCTTCCCTTTAGGGTGG - Intergenic
984269755 4:177536538-177536560 GTCTGTCGATCCCTTCTGGGAGG + Intergenic
985888848 5:2700356-2700378 GTCTGTCCTTGTCCTCATGTGGG - Intergenic
986631088 5:9774998-9775020 TTCTGTCCTTCCCTTTAGGGTGG + Intergenic
986657498 5:10030144-10030166 CTGTGTCCTTCTTTTCAGGATGG + Intergenic
986885156 5:12225619-12225641 TTGGGTCCTCCTCTTCAGGGTGG + Intergenic
986899280 5:12412482-12412504 CTCTGTCCTTCTTTTCAGGGTGG + Intergenic
987368758 5:17174086-17174108 GTCTGACTGTCTCTTCATGGTGG - Intronic
987631540 5:20478681-20478703 TTGTGTCCTACCCTTCAGGGTGG - Intronic
988064727 5:26219267-26219289 TTGTGTCTTTCTCTTCAGGGTGG - Intergenic
989671642 5:43924554-43924576 TTATGTCCTTCCCTTCAGGATGG + Intergenic
989672681 5:43936746-43936768 GTGTGTCCTTTGCTTCAGGGTGG - Intergenic
989681319 5:44032621-44032643 CTGTGTCCTTCCCTTCTGGGTGG - Intergenic
989970669 5:50520962-50520984 TCGTGTCCTTCCCTTCAGGGTGG + Intergenic
990923726 5:60995751-60995773 CTGTGTCCTTCCCTTCAGAGTGG + Intronic
991209063 5:64083976-64083998 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
991397700 5:66222335-66222357 GTCTGTCGATCTCTGCTGGGAGG + Intergenic
992291459 5:75283834-75283856 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
992309641 5:75482450-75482472 CTATGTCCTTCCCTTTAGGGTGG - Intronic
992345273 5:75869584-75869606 CTTTGTCCTTCTCTTCAGGGTGG - Intergenic
992587245 5:78252806-78252828 CTGTGTCCTTCCCTTAAGGGTGG - Intronic
993583702 5:89696678-89696700 CTCTGTATTTCTTTTCAGGGTGG + Intergenic
993623392 5:90193577-90193599 GTGTGTCATTCCCTTCAGGGAGG - Intergenic
994235537 5:97358171-97358193 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
994292980 5:98051443-98051465 ATGTGTCTTTCCCTTCAGGGTGG - Intergenic
994974185 5:106780544-106780566 TTGTTTCCTTCTCTTCAGGGTGG - Intergenic
995096444 5:108240635-108240657 TTGTATCCTTCCCTTCAGGGTGG - Intronic
995697720 5:114899152-114899174 TTGTCTCCTTCCCTTCAGGGTGG + Intergenic
995770686 5:115665795-115665817 TTATGTCCTTCCCTTCAGTGGGG - Intergenic
996116332 5:119624201-119624223 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
996161702 5:120174268-120174290 CTATGTCCTTCCCTTCATGGAGG - Intergenic
996927619 5:128846577-128846599 TTGTGTCCTTCCCTTCAGGATGG - Intronic
997186328 5:131885107-131885129 TTATGTCCTTCCCTGCAGGGTGG - Intronic
997488902 5:134256088-134256110 CTCTGCCCTTCTCTCCAGGCTGG + Intergenic
997832740 5:137164995-137165017 CTGTGTCCTTCCCTTTAGGGTGG - Intronic
1002301992 5:178262564-178262586 GCCTGTCCTTCCCTTCATTGTGG - Intronic
1003890633 6:10560899-10560921 GGTTGTCCTTCTCTTCTGTGTGG + Intronic
1003952242 6:11127203-11127225 TTCTGTCCTTCCCATTAGGGTGG + Intronic
1004137017 6:12977299-12977321 GTCCCTCCTTATCTGCAGGGAGG - Intronic
1004459581 6:15823187-15823209 GGCTGTCCTTATTATCAGGGTGG - Intergenic
1006462856 6:34173598-34173620 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1006936695 6:37723596-37723618 GTCTGTCCTTCCAATCAGAGCGG - Intergenic
1007800716 6:44389924-44389946 GGCTGTCCTTCTCTTCAAAAAGG - Intronic
1008215170 6:48779054-48779076 CAGTGTTCTTCTCTTCAGGGTGG - Intergenic
1008314781 6:50026323-50026345 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1008940600 6:57041419-57041441 TTGTTTCCTTCCCTTCAGGGTGG - Intergenic
1009301700 6:62031810-62031832 CTGTGTCCTTCCCTTCTGGGTGG - Intronic
1009373452 6:62938149-62938171 TTCTGTCTTTCCCTTCAGGATGG + Intergenic
1010328144 6:74588503-74588525 CTGTGTCCTTCCCTTCAGGGCGG - Intergenic
1010483496 6:76382149-76382171 CTATGTCCTTCCCTTCAGAGTGG + Intergenic
1011033282 6:82945041-82945063 TTGTGTTCTTCCCTTCAGGGTGG - Intronic
1011245119 6:85314394-85314416 GTCTGTCCATCCCTACTGGGAGG + Intergenic
1011271168 6:85580928-85580950 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1012714355 6:102649447-102649469 CTGTGTCCTTCTCTTTAGTGTGG - Intergenic
1012940556 6:105410240-105410262 TTGTGTCCTTCCCTTCAGGATGG - Intergenic
1013235611 6:108195465-108195487 GGCTGACCTTCCCTTCTGGGAGG + Intergenic
1013687533 6:112602110-112602132 TTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1014583120 6:123162363-123162385 CTATGTCCTTTCCTTCAGGGCGG - Intergenic
1014840723 6:126217816-126217838 TTGTGTCCTTCCTTTCAGGGCGG + Intergenic
1014865175 6:126520824-126520846 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1015030390 6:128587208-128587230 CTGTGTCCTTTTCTTCAGGGTGG - Intergenic
1015959526 6:138632297-138632319 CTGTGTCCTTGCCTTCAGGGTGG - Intronic
1016136806 6:140554488-140554510 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1016231002 6:141803933-141803955 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1016251642 6:142049618-142049640 GTGTGTCCTTTCCTTCTGGGTGG - Intergenic
1016727818 6:147395837-147395859 GTCTTTCCTCCTCTTCATGGTGG - Intergenic
1017120405 6:151018718-151018740 GTCACCCTTTCTCTTCAGGGGGG - Intronic
1017276126 6:152570816-152570838 GTTTGTCTTTCTCTTTAGTGAGG - Intronic
1017387456 6:153902115-153902137 TTGTGTCCTTCCCTTCAGGGCGG - Intergenic
1017591597 6:155984035-155984057 GTCTGTCCCTTTCTTCTGGCAGG - Intergenic
1018709825 6:166490295-166490317 GTCTATCCTTTACTTCTGGGAGG + Intronic
1019021521 6:168922715-168922737 CTCTGTCTTTTCCTTCAGGGAGG + Intergenic
1019436179 7:1023406-1023428 GTCTGTCCATGTCTTCAGCCTGG - Intronic
1020222468 7:6250481-6250503 GTCTGTGCTTCTCCTGTGGGTGG - Intronic
1020574736 7:9912741-9912763 TTGTGTCCTTCCCTTCAGAGTGG + Intergenic
1020788124 7:12593868-12593890 CTCTTTCCTTCTCTTCTGGAAGG + Intronic
1021130917 7:16912720-16912742 CTGTGTCCTTCCCTCCAGGGTGG + Intergenic
1021214513 7:17900380-17900402 TTGTGTCCTTCCCTTCAAGGTGG + Intronic
1021353809 7:19628713-19628735 CTGTGTCCTTCCCTTCAGGATGG - Intergenic
1021676481 7:23085269-23085291 GTTTGTCCTTCCCTTGAGGCAGG + Intergenic
1022541945 7:31145899-31145921 TTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1022565085 7:31391505-31391527 GGAGGTCCTTCTCTTCAGCGGGG + Intergenic
1024415092 7:49096858-49096880 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1026881057 7:73907059-73907081 GTCTGTCCATCTGTCCGGGGAGG - Intergenic
1027524154 7:79245709-79245731 TCATGTCCTTCCCTTCAGGGTGG - Intronic
1027808331 7:82859181-82859203 GCCTGTCTTTCCCTTCAGGGTGG - Intronic
1028161009 7:87484324-87484346 TTGTATCCTTCCCTTCAGGGTGG - Intergenic
1029572430 7:101379092-101379114 GTCATTCCTGCTCTTCTGGGAGG + Intronic
1029645023 7:101849088-101849110 CCCTGTCCTTCTCTGAAGGGTGG + Intronic
1029797225 7:102908965-102908987 CTGTGTCCTCCTCTTCAGGGTGG + Intronic
1029836570 7:103318440-103318462 CTCTGTCCTTCCTTTCAGGCTGG + Intronic
1030222534 7:107111332-107111354 TTGTGTCCTTCCCTTCATGGTGG - Intronic
1030598958 7:111571151-111571173 CTGTGTCCTTCCCTTCAGGGAGG - Intergenic
1031612487 7:123844437-123844459 GTCTGTCCACCTCTACTGGGAGG + Intronic
1031753889 7:125613154-125613176 TTGTGTCCTTCTCTTCAGGGCGG - Intergenic
1032942426 7:136810377-136810399 CTGTGTCCTTCTTTTCAAGGCGG - Intergenic
1032972009 7:137175154-137175176 CTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1034018970 7:147619756-147619778 CTATGTCCTTCCCTTCAGGGTGG - Intronic
1034126488 7:148676109-148676131 TTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1037295719 8:17397649-17397671 ATGTGTCCTTCCCTTCAGGGTGG - Intronic
1039647380 8:39302935-39302957 CTTTGTCCTTCCCTTCAGGGTGG + Intergenic
1039819467 8:41123268-41123290 GTCTGTCCTGCTCTGCAATGTGG + Intergenic
1042357068 8:67839901-67839923 GTCAGACTGTCTCTTCAGGGTGG - Intergenic
1043340200 8:79229165-79229187 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1043760497 8:84062529-84062551 CTGTGTCTTTCGCTTCAGGGTGG + Intergenic
1044751706 8:95422781-95422803 GTCTGTCCTGCTCTTCTGCCAGG + Intergenic
1045159556 8:99523292-99523314 TTGTGTCCTTCCCTTCAGAGTGG - Intronic
1045207175 8:100055082-100055104 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1045598954 8:103692274-103692296 TTTTGTCCTTTTCTTCAGGATGG + Intronic
1045803022 8:106123407-106123429 GTCAGCCCATCTCTTCAGAGGGG + Intergenic
1046847223 8:118931215-118931237 GTCTTTCCTTCTCTTTGGGCTGG + Intronic
1050355957 9:4782626-4782648 CTATGTCCTTCACTTCAAGGTGG - Intergenic
1052094568 9:24369115-24369137 GTCTTTGCTTATCTTCTGGGGGG + Intergenic
1052299972 9:26943127-26943149 GTCTGTCGTTGACTTCTGGGTGG - Intronic
1052732977 9:32311105-32311127 TTCTGTCCTTCCCTCCAGAGTGG - Intergenic
1055302133 9:74892613-74892635 TTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1055904598 9:81278096-81278118 GTCTGTCTTCCTCTTAAGGAAGG + Intergenic
1059839173 9:118192440-118192462 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1060056414 9:120417666-120417688 GTGTTTCCTTCTCTTCAGTTTGG - Intronic
1061730973 9:132613750-132613772 GTCTGGCCTTTTTCTCAGGGAGG - Intronic
1061739345 9:132689003-132689025 GTGCATCCTTCTCTTCAGGCTGG - Exonic
1061878694 9:133557621-133557643 GTCTGTCTGTGTCTTCAGCGTGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062368263 9:136222491-136222513 GTCTTTCCTTCTCTTAACAGAGG + Intronic
1187314903 X:18183937-18183959 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1188421047 X:29991395-29991417 TTATGTTCTTCTCTTTAGGGTGG + Intergenic
1188815242 X:34705202-34705224 CTGTGTTCTTCACTTCAGGGCGG + Intergenic
1188846227 X:35076072-35076094 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
1188972221 X:36632370-36632392 TTATGTCCTTCCCTTCAGGGTGG + Intergenic
1188999015 X:36923076-36923098 TTATTTCCTTCTTTTCAGGGTGG + Intergenic
1189019676 X:37320916-37320938 CTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1189411798 X:40779370-40779392 TTCCGTCCTTCTCTTCAGAGTGG + Intergenic
1189414987 X:40805405-40805427 GGCTGTGTTTCCCTTCAGGGAGG - Intergenic
1189628256 X:42921980-42922002 TTGTGTCCTTCTCTTCAGGGTGG - Intergenic
1189874269 X:45419926-45419948 TTGTGTCCTTCCCTTCAGGGCGG + Intergenic
1190037894 X:47042779-47042801 TTGTGTCCTTCCTTTCAGGGTGG - Intronic
1190368209 X:49717184-49717206 TTGTGTCCTTTCCTTCAGGGTGG + Intergenic
1191974049 X:66850990-66851012 GTGTGTTCTTCCCTTCAGAGTGG + Intergenic
1192116622 X:68417836-68417858 GGCAGTTCTTCTCTTCAGGGAGG - Intronic
1192336026 X:70220506-70220528 GACTCTGCTTGTCTTCAGGGAGG - Intergenic
1192505565 X:71680087-71680109 CTTTGTCCTTCCCTTCAGGGTGG + Intergenic
1192521502 X:71805048-71805070 CTGTGTCTTTCCCTTCAGGGTGG - Intergenic
1192640791 X:72859914-72859936 TTCTGTCCTTACTTTCAGGGCGG - Intergenic
1192640920 X:72860862-72860884 TTCTGTCCTTACTTTCAGGGCGG + Intergenic
1192714693 X:73627373-73627395 CTATGTCCTTCCCTTCAGGATGG + Intronic
1192812642 X:74560534-74560556 CTATGTCCTTTCCTTCAGGGTGG - Intergenic
1192836204 X:74802138-74802160 CTGTGTCCTACCCTTCAGGGTGG - Intronic
1192891001 X:75390291-75390313 TTCTGTTCTTCCCTTCTGGGTGG - Intronic
1192908479 X:75578392-75578414 CTGTGTCCTTCCTTTCAGGGAGG + Intergenic
1192995408 X:76507322-76507344 ATGTGTCCTTCCTTTCAGGGTGG + Intergenic
1193213977 X:78840514-78840536 TTGTGTCCTTCCATTCAGGGTGG - Intergenic
1193366172 X:80636991-80637013 TTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1193455388 X:81725285-81725307 CTGTTTCCTTCCCTTCAGGGAGG - Intergenic
1193676148 X:84454653-84454675 TTGTGTCCTTTTCTTCAGGATGG - Intronic
1193683649 X:84552258-84552280 CTGTGTCCTTCCTTTCAGGGTGG + Intergenic
1193830876 X:86288452-86288474 CTGTGTCCTTCCCTTCAGAGTGG + Intronic
1193880075 X:86910917-86910939 CTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1193911912 X:87316612-87316634 TTATGTCCTTGTCTTCAGGGTGG + Intergenic
1194136681 X:90152265-90152287 CTTTGTCCTTCCCTTCAGGGAGG - Intergenic
1194290997 X:92071900-92071922 CCATGGCCTTCTCTTCAGGGTGG + Intronic
1194481035 X:94424627-94424649 CTGTGTCCTTCCCTTCGGGGCGG + Intergenic
1194495515 X:94612865-94612887 CTCTGTACTTCTCATTAGGGTGG + Intergenic
1194526563 X:94984089-94984111 TTGTGTCCTTCCCTCCAGGGTGG - Intergenic
1194568510 X:95523021-95523043 CTGTGTCCTTCCCTTCAGGATGG - Intergenic
1194857789 X:98956015-98956037 CTCTGTCTTTCCCTTCAGGGAGG + Intergenic
1194892466 X:99397706-99397728 TTATGTCCTTCACTTCATGGTGG + Intergenic
1194990793 X:100544382-100544404 ATGTGGCCTTCCCTTCAGGGTGG - Intergenic
1195595533 X:106683917-106683939 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
1195601364 X:106752134-106752156 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
1195821096 X:108946183-108946205 GTATGTCCTTCCTTTCAGGGTGG + Intergenic
1195971429 X:110477854-110477876 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1196247468 X:113416180-113416202 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
1196357212 X:114809064-114809086 CTGTGTCCTTCCCTTCAGGGTGG + Intronic
1196555295 X:117078256-117078278 GTCTGTCCTTCCCTTGAGGCGGG + Intergenic
1196590900 X:117484446-117484468 CTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1196619688 X:117807555-117807577 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1196625421 X:117871899-117871921 CTGTGCCCTTCCCTTCAGGGTGG - Intergenic
1197028260 X:121782174-121782196 CTGTTTCCTTCCCTTCAGGGTGG + Intergenic
1197139201 X:123097259-123097281 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1197361038 X:125504324-125504346 CTGTGTCCTTCCCTTCAGGGAGG + Intergenic
1197382696 X:125765215-125765237 TTGTATCCTTCTCTTCAGGGTGG + Intergenic
1197469935 X:126855227-126855249 CTGTGTCCTTCCCTTCAGGGCGG + Intergenic
1197470074 X:126856194-126856216 CTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1197600448 X:128520841-128520863 CTATGTCCTTCCCTTCAGGACGG - Intergenic
1197623463 X:128778603-128778625 TTGTGTTCTTCTCTTCAGGGTGG + Intergenic
1198788265 X:140314310-140314332 CTATGTCTTTCCCTTCAGGGTGG - Intergenic
1199148379 X:144397934-144397956 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
1199334258 X:146600151-146600173 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
1199455113 X:148019974-148019996 TTGTATCCTTCCCTTCAGGGTGG + Intronic
1200059754 X:153479020-153479042 ATCTGTCTTTCTCTTCAGGTGGG + Intronic
1200107129 X:153720727-153720749 CTGTGTCTTTCTCTTGAGGGAGG - Intronic
1200482428 Y:3722215-3722237 CTTTGTCCTTCCCTTCAGGGAGG - Intergenic
1200608506 Y:5296475-5296497 CCATGGCCTTCTCTTCAGGGTGG + Intronic
1202266192 Y:23021559-23021581 CTCTTTGCTTCTCTTCTGGGGGG + Intergenic
1202419185 Y:24655302-24655324 CTCTTTGCTTCTCTTCTGGGGGG + Intergenic
1202451601 Y:25014782-25014804 CTCTTTGCTTCTCTTCTGGGGGG - Intergenic
1202595511 Y:26535115-26535137 CTGTGTCCTTCCCTTCAGGATGG - Intergenic