ID: 1127175550

View in Genome Browser
Species Human (GRCh38)
Location 15:56351534-56351556
Sequence CAGTATCTGCATATTGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127175547_1127175550 4 Left 1127175547 15:56351507-56351529 CCAAGAGCTCGAGTGCAGCCAGT 0: 1
1: 0
2: 0
3: 21
4: 222
Right 1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG 0: 1
1: 0
2: 2
3: 11
4: 201
1127175546_1127175550 5 Left 1127175546 15:56351506-56351528 CCCAAGAGCTCGAGTGCAGCCAG 0: 1
1: 0
2: 5
3: 66
4: 1251
Right 1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG 0: 1
1: 0
2: 2
3: 11
4: 201
1127175545_1127175550 8 Left 1127175545 15:56351503-56351525 CCACCCAAGAGCTCGAGTGCAGC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG 0: 1
1: 0
2: 2
3: 11
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127175550 Original CRISPR CAGTATCTGCATATTGTGTA AGG Intronic
901050058 1:6421468-6421490 CAGCATCTGCATCTTGGGGAGGG + Intronic
903317201 1:22517456-22517478 CAGTCTCTACATACTGTGAAAGG - Exonic
905044660 1:34986205-34986227 ACTTATCTGCATATTGTCTATGG + Intronic
906061397 1:42951372-42951394 TAGGATGTACATATTGTGTAAGG + Intronic
906166263 1:43688717-43688739 CAGTATCTTGATGATGTGTAGGG - Intronic
907593476 1:55698402-55698424 CATCATTTGCATATTGTCTATGG - Intergenic
908183233 1:61626747-61626769 CAGTTTCTGGAAATTGGGTAAGG - Intergenic
913078715 1:115361983-115362005 CAGTTTCTGCATAGTGTCGATGG - Intergenic
915570111 1:156740749-156740771 CAGCATCTCCAGATTGTGAAGGG - Intronic
916552738 1:165864419-165864441 AGGTATCAGTATATTGTGTATGG + Intronic
917117621 1:171618366-171618388 CAGTCTCTGCAAAATGTCTAAGG - Intergenic
917406168 1:174710734-174710756 CAGTATCTTCATAGTGTTGATGG - Intronic
918612618 1:186510479-186510501 CAGTTTCTCCATAGTGTCTATGG + Intergenic
920700272 1:208212806-208212828 CAGTAGCTGCGTGTAGTGTAGGG - Intronic
921452152 1:215321980-215322002 GAGTATCTGCATAATATGTAGGG - Intergenic
922846981 1:228694233-228694255 CTGTATCTGCATATTATGTCTGG - Intergenic
923047257 1:230364442-230364464 CAGTTTCTGCATGTTTTCTAAGG - Intronic
923347723 1:233072309-233072331 TAATATTTGCATATGGTGTAAGG + Intronic
1062971157 10:1650550-1650572 CAGTATCTGCCACTTTTGTATGG - Intronic
1063675801 10:8140013-8140035 AAGAATCTGCATTTTGAGTAAGG + Intergenic
1064197985 10:13260907-13260929 CAGTATATTCACATTGTGTTGGG + Intergenic
1064510582 10:16086109-16086131 CTGTTTTTGCATATGGTGTAAGG - Intergenic
1064851250 10:19711214-19711236 CACTATCTGTTTATTGTGTTGGG + Intronic
1066233418 10:33460996-33461018 CAGTAACTGCATATGGTGAGAGG + Intergenic
1066307492 10:34160755-34160777 CAATAACTGCATACTGTGAACGG - Intronic
1068640182 10:59395860-59395882 TAGCATCTGCATATAGTATAAGG + Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1076592405 10:131593325-131593347 TAATTTCTGCATATGGTGTAAGG + Intergenic
1076592722 10:131598025-131598047 TAATTTCTGCATATGGTGTAAGG + Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1080729820 11:34937865-34937887 CTTTATCTGCAAATTCTGTATGG - Intronic
1081363500 11:42207391-42207413 CAGTTTCTTCATATTGTCAATGG - Intergenic
1081498387 11:43639408-43639430 CAGTATCTGCTTGTTGTGCTGGG + Intronic
1081780297 11:45705965-45705987 CAGTAGCTGCCTATTGTTTAAGG - Intergenic
1082182792 11:49140721-49140743 CAGTTTCTTCATATTGTTGATGG - Intergenic
1084822820 11:71705252-71705274 CATTTGCTGCATATTGTCTATGG + Intergenic
1085821642 11:79800159-79800181 CAGGATCTGCATATGGTGTGAGG + Intergenic
1087305960 11:96489017-96489039 CAGTTTCTTCATATTGTCAATGG - Intronic
1088103678 11:106182086-106182108 CAGTTTCTTCATAGTGTCTATGG - Intergenic
1090368806 11:126231372-126231394 CAATAACTGCATTTTGTTTAGGG + Intronic
1090399415 11:126439513-126439535 CAGTATCTGCATTTTTTTAAAGG - Intronic
1093714716 12:22368002-22368024 CAGTTTCTTCATAGTGTCTATGG - Intronic
1093850872 12:24036405-24036427 CAGTATCTAATTATTTTGTAAGG - Intergenic
1094077075 12:26489215-26489237 CATTAGCTGCATAGAGTGTAAGG + Intronic
1094522213 12:31203923-31203945 CAGTATCTGTATTTAGGGTATGG + Intergenic
1095370884 12:41466145-41466167 GATTCTCTGCCTATTGTGTAGGG + Intronic
1095437020 12:42200922-42200944 CATTATCTTCATTTTGCGTATGG - Intronic
1097035340 12:56120167-56120189 CAGTATCTGAATAGTCTGGAAGG - Intronic
1098680659 12:73349433-73349455 CAGTTTCTTCATAGTGTCTATGG + Intergenic
1099523707 12:83694727-83694749 CAGTTTCTTCATAGTGTCTATGG - Intergenic
1100794925 12:98171801-98171823 CTGTATCTTCACATGGTGTAAGG - Intergenic
1104232278 12:126897091-126897113 AAATATCTGTATATTGTGTGAGG + Intergenic
1104315390 12:127695118-127695140 CATTATATGCATATTTTATATGG - Intergenic
1108600077 13:51984980-51985002 CAGTTTCTTCATAGTGTCTATGG - Intronic
1109598664 13:64593533-64593555 TAATTTTTGCATATTGTGTAAGG + Intergenic
1109935518 13:69278305-69278327 CAGCATCCTCATATGGTGTAAGG - Intergenic
1110485590 13:76038008-76038030 CCTTATCTGAATATTGTCTATGG - Intergenic
1110890497 13:80691702-80691724 CAGTATCTTCATAATGTTGATGG - Intergenic
1114319295 14:21533804-21533826 CAGCATTTGCATGTTGTATATGG + Intronic
1115008876 14:28520519-28520541 TAGTTTTTGCATATGGTGTAAGG + Intergenic
1116572270 14:46533485-46533507 CAGTTTCTTCATAGTGTCTATGG + Intergenic
1117031105 14:51671443-51671465 CAGAAAATGCATATTATGTATGG + Intronic
1117057782 14:51930755-51930777 CAGTATCTGCTTCTTGTGAGGGG + Intronic
1117966396 14:61210979-61211001 CTGTCTCTGCATCTTGTGTTGGG + Intronic
1122522016 14:102351291-102351313 CTGTAACTGCATGATGTGTATGG + Intronic
1125553203 15:40563408-40563430 CAGTATCTGCCTTTTGTGTATGG - Intronic
1126723968 15:51612131-51612153 TAGTATCTTCATTTTGTGTCTGG - Intronic
1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG + Intronic
1129688438 15:77699497-77699519 TAGTATGTGCTTATTGTGTGTGG - Intronic
1129688454 15:77699713-77699735 TAGTATGTGCTTATTGTGTGTGG - Intronic
1132262189 15:100435416-100435438 CAGTTTCTGTTTTTTGTGTATGG - Intronic
1133594709 16:7280395-7280417 CAGTATCTGCACAATGTCCAAGG + Intronic
1134871692 16:17657729-17657751 CAGGCCCTGCATATTGTGCATGG + Intergenic
1136472450 16:30490311-30490333 AACTATCGGCTTATTGTGTAAGG - Intronic
1138619686 16:58201110-58201132 CAAATTCTGCATATTGTGTCAGG - Intergenic
1140165466 16:72545600-72545622 CAGTTTCTTCATAGTGTCTATGG - Intergenic
1145008389 17:19351396-19351418 CAGTTTCTGAATATTTTGTTTGG + Intronic
1148522895 17:48298976-48298998 CAGAAACTGGATTTTGTGTATGG + Intronic
1149153916 17:53603446-53603468 CAGTCTGTGCCTATTATGTAGGG + Intergenic
1151452984 17:74210766-74210788 CAGTCTTTGAATATTCTGTAAGG + Intergenic
1203161322 17_GL000205v2_random:53841-53863 CATTTTCTGCATTTTGTTTAAGG + Intergenic
1156188166 18:34688220-34688242 CAGTTTCTTCATAGTGTGGATGG + Intronic
1156647826 18:39187877-39187899 CATTATGTTCATATTGTGAAAGG - Intergenic
1159920882 18:74226568-74226590 CAGTATCTGGATATGGTATGAGG + Intergenic
1166422681 19:42651070-42651092 CTGTATCTGCACATGGTGGAGGG - Intronic
925605932 2:5659785-5659807 TAGTTTTTGTATATTGTGTAAGG - Intergenic
926587735 2:14707024-14707046 CAGAATCAGCATATTTTATATGG - Intergenic
926669791 2:15565546-15565568 TAGAATCTGTATGTTGTGTATGG + Intergenic
928246978 2:29638854-29638876 CATTCTCTGCATTTTGTATATGG - Intronic
929062696 2:37939960-37939982 CAGTTTCTTCATAGTGTGGATGG + Intronic
929475773 2:42246575-42246597 CAGTTTCTGAATGTTGTTTAGGG + Intronic
931705057 2:64940266-64940288 GAGTGACTGCTTATTGTGTATGG + Intergenic
931826824 2:66008924-66008946 CAATATCTTCAGATTGTATAGGG + Intergenic
932914089 2:75836040-75836062 CAGTTTCTTCATAGTGTCTATGG - Intergenic
935315326 2:101827751-101827773 CAGTATCTTCATATTGAACATGG + Intronic
935326048 2:101937725-101937747 CAGTTTCTTCATAGTGTCTATGG - Intergenic
935550326 2:104446117-104446139 CAGTATCTGCACAGTTTGAAAGG + Intergenic
935961694 2:108431424-108431446 CAGTTTCTTCATAGTGTGGATGG - Intergenic
936508189 2:113124742-113124764 CAGGCTCTGCACATTGTGTGGGG + Intronic
937762586 2:125623485-125623507 CAGTTTCTTCATAGTGTTTATGG - Intergenic
938952098 2:136264830-136264852 CAGTTTCTTCATAGTGTCTATGG + Intergenic
939637418 2:144599273-144599295 CATGATCTGCATATCATGTATGG + Intergenic
940350494 2:152680691-152680713 CAATATCTGTATATTTTGAATGG + Intronic
940370770 2:152897936-152897958 CAGTTTCTTCATAGTGTCTATGG - Intergenic
940824706 2:158397692-158397714 CAGTTTCTTCATAGTGTCTATGG - Intronic
942351016 2:175052952-175052974 CAGTATCTCCACACTGTGGAGGG - Intergenic
943060121 2:183034173-183034195 CAGTATCTGCTTATTTAGTGGGG - Intronic
947003011 2:225478876-225478898 CATGATCTGAATATTGTGCAAGG + Intronic
947139328 2:227007149-227007171 CAGCATTTGCTTAATGTGTAAGG + Exonic
947361688 2:229351792-229351814 CAGAATCTGCATATGGTGGAAGG + Intergenic
948157742 2:235797923-235797945 CACTATTTGCATATTGTCTTTGG - Intronic
1171124435 20:22589197-22589219 TGGTTTCTGCATATTGTTTAGGG + Intergenic
1172792129 20:37512958-37512980 CAGTAATTCCATATTGTTTATGG - Intronic
1173714493 20:45190512-45190534 CAGAATTAGCATATTGTGGAGGG - Intergenic
1180900804 22:19370623-19370645 AAGTATCTGCATTTTCTGTAAGG + Intronic
949428991 3:3952612-3952634 CAGTATATGTATAATTTGTATGG + Intronic
950587615 3:13906210-13906232 TAATTTCTGCATATGGTGTAAGG - Intergenic
951628896 3:24697544-24697566 CAGTATCTTCATAGTGTCGATGG + Intergenic
952586801 3:34903014-34903036 GAGTATCTTCATATAGTGGAAGG - Intergenic
954507937 3:51095238-51095260 CAGTTTCTTCATAGTGTGGATGG + Intronic
956300139 3:67763514-67763536 CAGTATCTTCATAATGTCGATGG + Intergenic
958586457 3:96093286-96093308 CAGTTTCTTCATATTGTTGATGG - Intergenic
959735193 3:109649958-109649980 CAGTTTCTTCATAGTGTCTATGG - Intergenic
960772953 3:121215281-121215303 CAGTTTCTTCATAGTGTCTATGG + Intronic
962718074 3:138145238-138145260 CACTATCTGCATATTTTCTTTGG - Intergenic
963976526 3:151485864-151485886 CAGTTTCTTCATAGTGTGGATGG - Intergenic
965030425 3:163358572-163358594 CAGTACCTGAATATTCTGTAAGG - Intergenic
968012788 3:195297381-195297403 AAGCATCTGCAGAATGTGTAAGG - Intronic
968424489 4:513152-513174 CAGTCTCTGGAAATTGTCTAGGG - Intronic
971988924 4:33865998-33866020 CAGTTTCTTCATATTGTCAATGG - Intergenic
972757202 4:42059574-42059596 CAATATATATATATTGTGTATGG - Intronic
975060213 4:69987847-69987869 AAATATGTGCATATTATGTATGG + Intergenic
976433983 4:84995748-84995770 CAGTGTTTCCATATTGTGTAGGG + Intergenic
978139288 4:105299115-105299137 CAGTTTCTTCATATTGTCAATGG - Intergenic
978979555 4:114925977-114925999 CAGTTGCTGCATATTTTATAGGG + Intronic
979837168 4:125385346-125385368 CAATATCTGAATTTTGTGTGAGG - Intronic
979981524 4:127262063-127262085 GAGTGTCTGTATATTGTGTGAGG + Intergenic
980260140 4:130437995-130438017 TAGTTTTTGCATATGGTGTAAGG + Intergenic
981097468 4:140796649-140796671 TAGTACATGCATATTGTCTAGGG - Intergenic
981656114 4:147114011-147114033 CAGTTTCTTCATAGTGTCTACGG - Intergenic
983105451 4:163681131-163681153 CAGTATCTCCATATTTTAAAGGG + Intronic
984167887 4:176324570-176324592 GAATATCTGCATATTGTAGAAGG - Intronic
985725898 5:1515590-1515612 CAGTATCTGTAGATAGTGCAGGG - Intronic
987039124 5:14045493-14045515 CAGTATTTGTATTTTGTGAATGG - Intergenic
987236190 5:15944253-15944275 CAATATCTGCCTATTGTTAAAGG - Intergenic
987479270 5:18432405-18432427 CAGTTTCTTCATAGTGTCTATGG - Intergenic
988136476 5:27177776-27177798 CAGTATATGCATGTTAAGTAAGG + Intergenic
988824905 5:34926464-34926486 GAGAAACTGCCTATTGTGTAAGG + Intergenic
989272468 5:39549288-39549310 AAGTATCTGCATATTGGGGAAGG - Intergenic
989427905 5:41317008-41317030 CAGTCCCTGGCTATTGTGTATGG - Intronic
993163185 5:84316173-84316195 CAGTTTCTTCATAGTGTCTATGG - Intronic
993802700 5:92363456-92363478 CACTTTCTCCATATTCTGTATGG + Intergenic
993969992 5:94407583-94407605 CAGTATGTGCATTTTGTGTCCGG - Intronic
994015250 5:94957329-94957351 CAGTTTCTTCATATTGTCAATGG - Intronic
994137747 5:96307530-96307552 CAGTTTCTTCATAGTGTCTATGG + Intergenic
995283526 5:110361237-110361259 CTGTTTCTGCATATGGTGAAAGG - Intronic
996022269 5:118604422-118604444 CAGGATATGAATTTTGTGTAAGG - Intergenic
996417232 5:123223288-123223310 CAGTGTCTGCAGGTTCTGTACGG + Intergenic
997125003 5:131217181-131217203 CATTATTTTCATATTGTCTATGG + Intergenic
998452166 5:142243319-142243341 CTGTATCTGCATATTATTTTGGG + Intergenic
1002955148 6:1855145-1855167 CAATCTCTGCATATGGTGTCAGG + Intronic
1006586252 6:35115844-35115866 TAGTATTTGTATATGGTGTAAGG - Intergenic
1008930064 6:56930090-56930112 CAGGATCTGGTAATTGTGTATGG + Intronic
1009979396 6:70709294-70709316 CAATATGGGCATATTGTTTATGG - Intronic
1011312157 6:85991392-85991414 CAGTATCAGCATTTTATTTAAGG - Intergenic
1011952745 6:92987284-92987306 CATTTTCTGCAGTTTGTGTAAGG + Intergenic
1014027016 6:116660553-116660575 AAGTATCTGAATATTGTATTTGG - Intronic
1014321569 6:119936245-119936267 CAATACCTGCCTTTTGTGTATGG + Intergenic
1016828360 6:148408834-148408856 TAATATTTGCATATGGTGTAAGG + Intronic
1018110238 6:160529901-160529923 CAGTTTCTTCATAGTGTGGATGG - Intergenic
1020328617 7:6996055-6996077 CATTTGCTGCATATTGTCTATGG - Intergenic
1022271948 7:28817118-28817140 CAATATCAGGATATTGTGGATGG - Intronic
1023654965 7:42410124-42410146 CAATATCTGCTTATTGTTTGAGG + Intergenic
1024303795 7:47909182-47909204 CAGTTTAAGAATATTGTGTAGGG - Intronic
1024774526 7:52767321-52767343 CAGTATCTAAATGTTGTGTCTGG + Intergenic
1027602297 7:80254276-80254298 CTGTATCTTCATATGGTATAAGG - Intergenic
1027678914 7:81194504-81194526 CAGTATCTGCATGTTAGGCAAGG + Intronic
1031307570 7:120150798-120150820 CAGTATCTGCTTCTTTTTTAAGG - Intergenic
1033022221 7:137737642-137737664 CAGTATCTAAATAATATGTAGGG - Intronic
1037376215 8:18232738-18232760 CAGTATCTGCTTCTTTTTTAAGG - Intergenic
1037719876 8:21433407-21433429 CAGTTTCTTCATAGTGTCTATGG - Intergenic
1039148395 8:34476233-34476255 CACTATCTGCTTATTGTGGTAGG - Intergenic
1039575979 8:38624370-38624392 CAGCATCTGCGTCTTGAGTAGGG + Intergenic
1039597234 8:38801381-38801403 CAGTTTCTGCATATGGTGTAAGG + Intronic
1040917251 8:52575117-52575139 CAATATATGCATAGTGTGAATGG + Intergenic
1043080964 8:75764325-75764347 CAGTTTCTTCATAGTGTTTATGG - Intergenic
1043465679 8:80504641-80504663 CAGTATGTGCATATTCTCTTAGG - Intronic
1048876825 8:138843191-138843213 CAGCATCTGCATCTTGTGCCTGG - Intronic
1051982390 9:23037927-23037949 TATTATCTGCATAGTCTGTATGG + Intergenic
1052512864 9:29444115-29444137 CAATTTTTGCATATTGTGTGAGG - Intergenic
1052610114 9:30760462-30760484 AAATAACTGCATATAGTGTATGG - Intergenic
1055715188 9:79109776-79109798 CAGTATATGCATATAATGAAAGG + Intergenic
1056881620 9:90399129-90399151 CAGAGTCTGCATCTTGTCTATGG + Intergenic
1059586661 9:115614639-115614661 CAGTATCTGCATCTATTGAATGG + Intergenic
1060654509 9:125360495-125360517 CAGAATCTGTATATTGTCTATGG + Intronic
1185852877 X:3505600-3505622 AACTATCTTCGTATTGTGTATGG + Intergenic
1186471061 X:9822520-9822542 CAGTATCCGCATCTGGTGCAGGG + Intronic
1187551293 X:20308221-20308243 CAGTGTTTGCCTATTGTGTGGGG - Intergenic
1189080500 X:37966921-37966943 CAATTTCTGCATTTTTTGTAAGG + Intronic
1189243605 X:39544468-39544490 CAGTTTCTTCATAGTGTCTACGG - Intergenic
1191635964 X:63377099-63377121 CAGTTTCTGCATAGTGTCAATGG - Intergenic
1191825270 X:65357755-65357777 CAGTTTCTTCATAGTGTTTACGG - Intergenic
1192657466 X:73006023-73006045 CAATATCTGCATATTTTATGAGG - Intergenic
1192719655 X:73678665-73678687 TAGAATCTGTATATTTTGTAAGG - Intronic
1193594883 X:83434088-83434110 CAGTTTCTTCATAGTGTCTATGG + Intergenic
1193672678 X:84408813-84408835 CATTTTCTGGATATTGTGAATGG + Intronic
1195140329 X:101952258-101952280 CAGTTTCTTCATATTGTCTTTGG - Intergenic
1196561429 X:117153732-117153754 CAGTTTCTTCATAGTGTCTATGG - Intergenic
1197071073 X:122298660-122298682 CAGTTTCTTCATATTGTTGAGGG + Intergenic
1197157449 X:123285313-123285335 CAGTTTCTGCATAGTGTCAATGG - Intronic
1197266058 X:124373187-124373209 CAGTCTCTGAATATTTTATAAGG - Intronic
1197862573 X:130986044-130986066 CAGTATCTCCTTATTTTTTAAGG + Intergenic
1199708099 X:150448652-150448674 CAGTCTCTGCACTTAGTGTATGG + Intronic
1200544228 Y:4499027-4499049 TAATTTCTGCATATGGTGTAAGG - Intergenic
1201058435 Y:10018831-10018853 CAGCATCTGCATATAGTGAGGGG + Intergenic