ID: 1127177885

View in Genome Browser
Species Human (GRCh38)
Location 15:56381574-56381596
Sequence GCCCCCTGCCCAATATCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 5, 3: 12, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127177880_1127177885 22 Left 1127177880 15:56381529-56381551 CCAGTCTTTCTTGAGAAGGCTTT 0: 3
1: 40
2: 188
3: 382
4: 604
Right 1127177885 15:56381574-56381596 GCCCCCTGCCCAATATCACTAGG 0: 1
1: 0
2: 5
3: 12
4: 125
1127177883_1127177885 -1 Left 1127177883 15:56381552-56381574 CCAGTTATTTAAAGGCACTTGGG 0: 1
1: 0
2: 8
3: 135
4: 469
Right 1127177885 15:56381574-56381596 GCCCCCTGCCCAATATCACTAGG 0: 1
1: 0
2: 5
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127177885 Original CRISPR GCCCCCTGCCCAATATCACT AGG Intronic
902743173 1:18454635-18454657 GCCTCTTGCCCAAGATCAATGGG + Intergenic
903672662 1:25045867-25045889 GCCCCCTGCCCACGACCACAAGG + Intergenic
903832207 1:26182223-26182245 GCCCCCTGCCCAGAACCACAGGG - Intronic
904889581 1:33769398-33769420 GACCCCTGCTCAAAATCAATGGG - Intronic
907638813 1:56164436-56164458 GCCCTTTGCCCAATTTCATTTGG + Intergenic
911230286 1:95353907-95353929 GCACCCTGCCCAGAATCTCTGGG - Intergenic
912172642 1:107119053-107119075 GCCCCCTGCCCCTTATCCATGGG - Intergenic
913195356 1:116451939-116451961 GCCTCCTGCCTAAGATCCCTTGG - Intergenic
915553944 1:156650986-156651008 GCCCCAAGCCCAAGATCACAAGG + Intronic
918472068 1:184885005-184885027 GCCTCCTACCCAACATCACAGGG + Intronic
919834841 1:201566386-201566408 GCACCCTGAGCAATATCACTAGG - Intergenic
922311836 1:224400914-224400936 GCCCCCTTCCCAGTATCTGTTGG - Intronic
922576595 1:226665009-226665031 GGCCTCTGCCCTATATCACCTGG - Intronic
923090278 1:230735520-230735542 CCCCCCTGCCCAACCCCACTTGG + Intergenic
924585276 1:245356089-245356111 GCCCCCTGCGCAGAGTCACTTGG - Intronic
1063568335 10:7192288-7192310 TCCCTCTGTCCAATATCACATGG + Intronic
1063973411 10:11397081-11397103 ACCCCCTGCCCAAAGTCACACGG + Intergenic
1068033841 10:51735824-51735846 GCCCCCTGCCCCATATCCATGGG - Intronic
1068545020 10:58335264-58335286 GCCCCCTGCCCACGCTGACTCGG + Intronic
1073397234 10:103228178-103228200 GCCCCCTCCACAACACCACTTGG - Intergenic
1073826982 10:107335920-107335942 GCTCCAAGTCCAATATCACTGGG + Intergenic
1074116627 10:110461204-110461226 GCCACCTGCCCAAGATGCCTGGG - Intergenic
1074149000 10:110741714-110741736 GCCCCCTGCCCCCCATCACCTGG + Intronic
1075996385 10:126879491-126879513 GCCCCCAGCTCACGATCACTTGG + Intergenic
1076889071 10:133275214-133275236 GGCCCCTCCCCAGTTTCACTTGG - Intronic
1077926517 11:6686919-6686941 GCCCCCAGTCCAAAATAACTAGG - Intergenic
1078107347 11:8366545-8366567 GCCACTTGCCCAAGGTCACTTGG - Intergenic
1079827328 11:25213785-25213807 GTCCCCACCCAAATATCACTTGG + Intergenic
1084774169 11:71364607-71364629 CCCCCCTGCCCCATAACAATGGG + Intergenic
1087328033 11:96746986-96747008 GCCCCCTGCCTAATTGAACTAGG - Intergenic
1088192434 11:107240811-107240833 GCCTCCTTCCAAATATCTCTGGG + Intergenic
1089166174 11:116478242-116478264 GACTCATGCCCAATCTCACTGGG + Intergenic
1089522331 11:119073464-119073486 ACACCCTGGCCAATATGACTTGG - Intronic
1089653716 11:119932191-119932213 GCCCCTTGCCTCATATCCCTGGG - Intergenic
1089680192 11:120115140-120115162 GTCCCCTGCCCATTAGCCCTGGG + Intronic
1090188985 11:124756252-124756274 GCCCGCTGTCCAATACCAGTGGG - Exonic
1090193213 11:124791593-124791615 GCCCGCTGCCCAATATCAGTGGG + Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1094839719 12:34337860-34337882 GCCCCCTGCCGCATATCTTTGGG + Intergenic
1101991057 12:109485477-109485499 GCAGCTTGCCCAATATCACATGG + Intronic
1102508167 12:113397164-113397186 TCTCCCTGCCCAAGATCACCAGG - Exonic
1102508409 12:113398457-113398479 AGCCACTGCCCTATATCACTGGG - Intronic
1107838529 13:44432744-44432766 GCCCCCTGCCCAGTAGGAATTGG - Intronic
1111903559 13:94229640-94229662 TCCCCCTGCTCAATAACACAAGG + Intronic
1116020301 14:39452798-39452820 GCCCTCAGCCCAAAATCACAGGG - Intergenic
1126497812 15:49311945-49311967 GCCCCCGGCCCAATCTCTCAGGG - Intronic
1127177885 15:56381574-56381596 GCCCCCTGCCCAATATCACTAGG + Intronic
1131470244 15:92690249-92690271 GCCTCCTGCCCAATGGAACTTGG + Intronic
1133326344 16:4944609-4944631 GCCACCTGCCCAAGGTCACACGG - Intronic
1134588602 16:15434290-15434312 GCCCCATGCCAAGCATCACTAGG + Exonic
1135425007 16:22328093-22328115 GCCCCCTTCCCCATAACTCTTGG - Intronic
1138489171 16:57366220-57366242 GCCCCCTGCCCCATCTCACAGGG - Intergenic
1138837263 16:60453341-60453363 GCCTCAGCCCCAATATCACTAGG - Intergenic
1139580733 16:67872345-67872367 GCCCTGTGCCCAATGTCACCAGG - Exonic
1140776466 16:78253463-78253485 GTACCCTGCTCAAGATCACTGGG + Intronic
1141552671 16:84816660-84816682 GCCCTCTGCCCACTCTCTCTTGG - Intergenic
1141993196 16:87621812-87621834 GCCCCCTTTCCAACAGCACTTGG - Intronic
1142251132 16:88992572-88992594 GCCCCCTGCCCAGTATCTCTCGG - Intergenic
1143584723 17:7845393-7845415 GCCCCCTGCCCCAGCTCTCTGGG - Exonic
1146906789 17:36623033-36623055 ACCCCGTGCCCCATATCAGTAGG - Intergenic
1147252771 17:39163312-39163334 GACCCCTGCCCAGACTCACTGGG - Intronic
1148786052 17:50146764-50146786 GCCCACTGCCCAAGGTCACATGG + Intronic
1148865430 17:50625918-50625940 GCCCCCTGCCCACCACCACCAGG - Intronic
1151264680 17:72945682-72945704 TCCCCCTGCTCAAGAACACTAGG - Intronic
1151307560 17:73273040-73273062 TCCCCCTGCCCACACTCACTGGG - Intergenic
1155120811 18:22816812-22816834 GGCCCCCACCCAAGATCACTGGG + Intronic
1155314532 18:24558395-24558417 GCCCCCAGCCGAATTTCTCTGGG + Intergenic
1156056226 18:33007530-33007552 ACCCTCTGCCCAAGAGCACTGGG + Intronic
1160595641 18:79972260-79972282 GTACCCTGCCCAAGGTCACTTGG + Exonic
1161968015 19:7559537-7559559 GCCCCCTGATCAATTTCAATTGG - Intronic
1162376718 19:10309500-10309522 GCCCCCTCCCTAATTTCACCCGG + Exonic
1162376967 19:10310525-10310547 TCACCCTGCCCAAGATCACCAGG - Exonic
1163729710 19:18941703-18941725 GCCCCCTCCCCAACCTCACTGGG - Intergenic
1164512129 19:28906029-28906051 TCCCCCAGACCAATATCATTAGG + Intergenic
1166647469 19:44542905-44542927 CCCCCCTGCCCAGTACCACTGGG - Intergenic
1166836627 19:45671211-45671233 GCCCACTGCGCAGTAGCACTTGG + Intronic
1167584703 19:50367640-50367662 ACCCCATGCCTACTATCACTGGG + Intronic
927803339 2:26121571-26121593 CCCCCCCGCCCAATATTTCTAGG - Intronic
929803162 2:45121657-45121679 GTCCCCTTCCCAACATCTCTTGG + Intergenic
936461981 2:112721017-112721039 GCCTCCTGCACACTATCAGTGGG - Intergenic
936979423 2:118250499-118250521 GACTCCTGGCCAAGATCACTGGG - Intergenic
940658757 2:156520345-156520367 GCCTCCTGTCCAATATCACTAGG + Intronic
946772984 2:223108457-223108479 GCTCCCTGTGCAATCTCACTGGG + Intronic
1168926914 20:1589063-1589085 GCCCCCTGCTGAGTAGCACTTGG - Intronic
1170612976 20:17929285-17929307 GCCCTCTGCCTAAAATCACTAGG - Intergenic
1171339245 20:24414218-24414240 GACCCCTGCACAATCTCAGTAGG - Intergenic
1172758131 20:37301851-37301873 GCCCCTTGCCCACTTTCACCTGG - Intronic
1179524222 21:41965359-41965381 GCCCCCTGCCCACTATCCAGTGG - Intergenic
1182481271 22:30610540-30610562 GCACCTTGCCCAATCTCACTTGG - Intronic
1182566893 22:31206768-31206790 GCCCCCTTCCCACCATCCCTCGG + Exonic
1184498962 22:44860480-44860502 ACCCCCTGCCATATGTCACTGGG + Intronic
1184860538 22:47171153-47171175 GCCCACTGCCCAAGACCACCTGG + Intronic
951025970 3:17830278-17830300 TCCCACTCCTCAATATCACTAGG - Intronic
952256800 3:31702636-31702658 GCCCCGTGGCCAATAGGACTGGG - Intronic
957249564 3:77756539-77756561 GGCCCCTGACTCATATCACTGGG + Intergenic
959432348 3:106270556-106270578 GCCCCCAGGCCAATATAAATAGG - Intergenic
961071346 3:123930875-123930897 ACCCCCTGCCCAGAATCACATGG + Intronic
961740290 3:129029102-129029124 TCCCCCTGACCAACACCACTCGG + Intronic
961834970 3:129650238-129650260 AACCCCAGCCCAAGATCACTGGG + Exonic
966799038 3:183745147-183745169 GGCCCCTGCCCACTATTCCTAGG + Intronic
968904970 4:3446832-3446854 GACCCCTGCCCCTAATCACTGGG - Intronic
969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG + Intronic
970716928 4:18937282-18937304 GACCCCTGCCTAATCTCAGTAGG + Intergenic
971342107 4:25780265-25780287 GCCCACTGCCCTCTCTCACTTGG + Intronic
974555186 4:63437183-63437205 GCCCCTTGCCCACTTTCAATGGG + Intergenic
979558268 4:122075636-122075658 GCCCCCTTCCCACCATCCCTCGG - Intergenic
982050883 4:151500491-151500513 GACCCCTGCCCCATGTCACTTGG + Intronic
985684945 5:1277125-1277147 GCCCCCTGCACAATCCCACGAGG + Intronic
988189020 5:27903061-27903083 GCCCCATGACTAATATCAATGGG + Intergenic
990040086 5:51369231-51369253 ACCCCCAGCCAAATATCACCAGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
993523624 5:88937109-88937131 GCAAACTGCCCAAGATCACTTGG + Intergenic
994316124 5:98335862-98335884 GCACCCGGCCCATTACCACTAGG - Intergenic
995765758 5:115616607-115616629 CCCCCCTGCTCATTTTCACTGGG + Intronic
1007753434 6:44083625-44083647 GCCACCTGCCCAACGTCACCCGG - Intergenic
1008329827 6:50231623-50231645 GCTCCCTGCCCTATATGAATTGG - Intergenic
1013042959 6:106454385-106454407 CCTCCCTGGCCAATATTACTGGG + Intergenic
1013585440 6:111574670-111574692 GGTCCCTGCCCAATACCACATGG + Intronic
1017270910 6:152504231-152504253 GCCCCCACCCCACTTTCACTAGG - Intronic
1018136891 6:160787738-160787760 TCCCTCTGCCCAATAAAACTTGG + Intergenic
1021126393 7:16854930-16854952 GCCCCTAACCCAATATGACTGGG - Intergenic
1027181418 7:75942388-75942410 GCTCCCTGACCAATATAACTTGG - Intronic
1027206878 7:76107441-76107463 GCAGCCTGCCCAAAATCACATGG + Intergenic
1032637668 7:133727616-133727638 GTCACCTGCTCACTATCACTAGG + Intronic
1034505507 7:151486689-151486711 GGCTCCTGCCTAATATCCCTGGG - Intronic
1040570354 8:48603348-48603370 GCCACCTTCCCAAAAGCACTGGG - Intergenic
1043111878 8:76195572-76195594 GCCCACTGCCCAATGTCTCATGG - Intergenic
1043819675 8:84847135-84847157 GCCCCCTACACAAAATCCCTTGG + Intronic
1044290866 8:90467824-90467846 GCCCCTTGTGCAATCTCACTTGG - Intergenic
1044935986 8:97293790-97293812 GCTCCCTGCCCAGGATCACCAGG + Intergenic
1048534511 8:135280403-135280425 GCCCCATGCCAAATATGAATGGG + Intergenic
1050133631 9:2439388-2439410 ACCCCCTCCCCAACATCACTGGG + Intergenic
1057976251 9:99609111-99609133 CCCCCCAGCCCCAGATCACTTGG + Intergenic
1058041543 9:100307652-100307674 CCCCTCTGCCCCAGATCACTTGG - Intronic
1058265784 9:102897612-102897634 ACCCCCTGAGCAAGATCACTTGG - Intergenic
1060749345 9:126158756-126158778 GCCCCCTGCCCAATTCAACTTGG - Intergenic
1061406250 9:130394475-130394497 CCCCCCAGCCCAACATCACCTGG + Intronic
1061844313 9:133378364-133378386 GCCCCCTGCCCCATAGCACTTGG + Intronic
1062695141 9:137871005-137871027 GCGCCCGGCCCAAAATAACTGGG + Intergenic
1187051724 X:15702844-15702866 GCGCCCCGCCCAAAAGCACTGGG + Intronic
1192466117 X:71357344-71357366 GCTCCCTGCCAAATAGCATTGGG + Intergenic
1192805669 X:74506398-74506420 GCTCCCTGCCCCATATCACTAGG - Intronic
1196799148 X:119526589-119526611 GCCCCCTGCCCAGCACCACGTGG + Intergenic