ID: 1127188079

View in Genome Browser
Species Human (GRCh38)
Location 15:56500851-56500873
Sequence GTTCAGCAGCATCGTGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127188073_1127188079 30 Left 1127188073 15:56500798-56500820 CCCTGGAAACTTCTTTGTAACTC No data
Right 1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG No data
1127188078_1127188079 -7 Left 1127188078 15:56500835-56500857 CCAAGTCACAGAGGTTGTTCAGC No data
Right 1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG No data
1127188074_1127188079 29 Left 1127188074 15:56500799-56500821 CCTGGAAACTTCTTTGTAACTCA No data
Right 1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG No data
1127188076_1127188079 5 Left 1127188076 15:56500823-56500845 CCAAAGGAGATGCCAAGTCACAG No data
Right 1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127188079 Original CRISPR GTTCAGCAGCATCGTGCTGT AGG Intergenic
No off target data available for this crispr