ID: 1127194673

View in Genome Browser
Species Human (GRCh38)
Location 15:56570782-56570804
Sequence CAGCAGTTAAAAAGGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127194669_1127194673 30 Left 1127194669 15:56570729-56570751 CCAAAAGTGAGCAGTAGCTATTG No data
Right 1127194673 15:56570782-56570804 CAGCAGTTAAAAAGGACAAAGGG No data
1127194670_1127194673 -3 Left 1127194670 15:56570762-56570784 CCAAACAAACTTTAAAGCAACAG No data
Right 1127194673 15:56570782-56570804 CAGCAGTTAAAAAGGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127194673 Original CRISPR CAGCAGTTAAAAAGGACAAA GGG Intergenic
No off target data available for this crispr