ID: 1127196973

View in Genome Browser
Species Human (GRCh38)
Location 15:56597739-56597761
Sequence TATCCTAGCTCAAAGGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127196967_1127196973 22 Left 1127196967 15:56597694-56597716 CCTTAGCAGGCACATCTGACTTG No data
Right 1127196973 15:56597739-56597761 TATCCTAGCTCAAAGGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127196973 Original CRISPR TATCCTAGCTCAAAGGGGGT TGG Intergenic
No off target data available for this crispr