ID: 1127197024

View in Genome Browser
Species Human (GRCh38)
Location 15:56598521-56598543
Sequence CTGTGAAAGAACATTCATCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127197022_1127197024 4 Left 1127197022 15:56598494-56598516 CCAAATTTAGACTTTGGTTTCAA No data
Right 1127197024 15:56598521-56598543 CTGTGAAAGAACATTCATCTCGG No data
1127197019_1127197024 28 Left 1127197019 15:56598470-56598492 CCCTAATAGGTAAGCAAAATTTT No data
Right 1127197024 15:56598521-56598543 CTGTGAAAGAACATTCATCTCGG No data
1127197020_1127197024 27 Left 1127197020 15:56598471-56598493 CCTAATAGGTAAGCAAAATTTTT No data
Right 1127197024 15:56598521-56598543 CTGTGAAAGAACATTCATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127197024 Original CRISPR CTGTGAAAGAACATTCATCT CGG Intergenic
No off target data available for this crispr