ID: 1127209691

View in Genome Browser
Species Human (GRCh38)
Location 15:56760411-56760433
Sequence GGGAGCTCAAACATGCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127209688_1127209691 6 Left 1127209688 15:56760382-56760404 CCAGAGCATTTTTAGGTAAGCTG 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1127209691 15:56760411-56760433 GGGAGCTCAAACATGCTTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127209691 Original CRISPR GGGAGCTCAAACATGCTTGA AGG Intronic
900754865 1:4426354-4426376 AGGATCTCACACATGCTAGAAGG + Intergenic
906798887 1:48719170-48719192 GGGAGATCAAACGTGTTTGGGGG - Intronic
907581199 1:55574321-55574343 AGGAGCTCACTCATGTTTGAGGG + Intergenic
912016953 1:105050840-105050862 GGGAACTCATACATTGTTGATGG + Intergenic
917841531 1:178983890-178983912 GGGAGCTCATACACTGTTGATGG + Intergenic
920350139 1:205332479-205332501 GTGAGATCAAACATGAGTGAGGG - Intergenic
924141126 1:241024474-241024496 GGAAGCACAAACATCTTTGAAGG + Intronic
1065994592 10:31045694-31045716 GGGAGCTCAGACACTGTTGATGG - Intergenic
1066003769 10:31128645-31128667 AGGAGCTCAAGCTTGCTTCATGG - Intergenic
1072550407 10:96473003-96473025 CAGAGCTCAAACTGGCTTGAAGG + Intronic
1074603213 10:114935674-114935696 GGGAGCTAAACCATTCATGAGGG + Intergenic
1074603230 10:114935747-114935769 GGGAGCTAAACCATTCATGAGGG + Intergenic
1075289585 10:121216863-121216885 GGGTGATCCAACATGCGTGAGGG + Intergenic
1077994601 11:7442430-7442452 GGGACTCCAAACATGCCTGAAGG - Intronic
1078329773 11:10409646-10409668 GGGAGCTCTCACATGCCTGTTGG - Intronic
1078424269 11:11236528-11236550 GGGAGCTCAGGCTGGCTTGAAGG - Intergenic
1079241007 11:18721963-18721985 CGGAGCTCAAACATCCCTGCGGG - Exonic
1080278499 11:30529900-30529922 GGGAGAACAAAAATGCTTCAAGG - Intronic
1080888390 11:36387500-36387522 GGGAGTTCAAACATGGCTGAGGG + Intronic
1084608712 11:70187213-70187235 GGGTGCTCACACGTGCTTGCTGG + Intronic
1084683812 11:70682057-70682079 GGCAGCCCAAACCTGCTGGAGGG + Intronic
1087026364 11:93653705-93653727 GGGAGATGGAACATGCTGGAGGG + Intergenic
1090091122 11:123698951-123698973 GGGAGCTCCAACAAGAATGATGG + Intergenic
1094108042 12:26833516-26833538 GGGAACTCGAAGAAGCTTGATGG + Intergenic
1094230007 12:28092216-28092238 GAGAGCTGACACATGCTTGTGGG + Intergenic
1096026801 12:48372750-48372772 GGGAACTCATACATCGTTGATGG + Intergenic
1108228568 13:48316160-48316182 GGGAGCTCTCACGTGCTTGCTGG + Intronic
1111681791 13:91451453-91451475 GGGAGGTTAAAAATGCATGAGGG + Intronic
1112624972 13:101093712-101093734 GGGAGCTGGAACACACTTGAAGG - Intronic
1112918562 13:104581267-104581289 GGGAGGTCAGATATGCATGAGGG - Intergenic
1113346533 13:109483305-109483327 GGGAGCTCACACATGCACAAGGG + Intergenic
1116227030 14:42165627-42165649 GGGAGCTCCAGTATCCTTGAAGG - Intergenic
1116586075 14:46706491-46706513 GGGAGATCAAAAATGCTCCATGG - Intergenic
1116602086 14:46938642-46938664 GGGAACTCAAACATTGTTGGTGG + Intronic
1119026227 14:71155104-71155126 GGAGGCTCAAATGTGCTTGAAGG - Intergenic
1120099876 14:80432719-80432741 AGTAGCTAAAACTTGCTTGAAGG + Intergenic
1122025049 14:98869598-98869620 GGGAGCTTTAAAATGCTTGGGGG + Intergenic
1123398644 15:19962685-19962707 GGGAGGTCAAGCAGGCTGGAGGG - Intergenic
1127209691 15:56760411-56760433 GGGAGCTCAAACATGCTTGAAGG + Intronic
1127723676 15:61726839-61726861 GGGAGCTGTAACATGTTTGGGGG - Intergenic
1131050023 15:89341585-89341607 GGGAGAACAAACATCCATGAGGG + Intergenic
1131156707 15:90080249-90080271 GGGAGCTCAGACATCCTTAGAGG - Exonic
1136105847 16:28029987-28030009 GGGAGCTCCAACAACCCTGAAGG + Intronic
1136779613 16:32888027-32888049 GGGAGTTCAAGCAGGCTGGATGG + Intergenic
1136891005 16:33973491-33973513 GGGAGTTCAAGCAGGCTGGATGG - Intergenic
1141027367 16:80561009-80561031 GGGAACTCACAAATGCTTGGGGG - Intergenic
1203082030 16_KI270728v1_random:1150115-1150137 GGGAGTTCAAGCAGGCTGGATGG + Intergenic
1146681468 17:34811304-34811326 GGGTGCTGACACAAGCTTGAGGG + Intergenic
1150001387 17:61443059-61443081 GGGAGGTCAAGGATGCTTGGGGG + Intergenic
1150557550 17:66268034-66268056 GTGTGCTCATACATGCTTGAGGG + Intergenic
1150606505 17:66695923-66695945 GAGAGCTCATACAAGCTTCAAGG - Intronic
1150856305 17:68756512-68756534 GGGAGTTCAAGCATGAGTGATGG - Intergenic
1155415553 18:25595556-25595578 GGGAGCTCCAACATGGTTAATGG + Intergenic
1158440713 18:57471886-57471908 GGGAGCTCAAGAATGTCTGAGGG + Intronic
1160952998 19:1676488-1676510 CGGAGCTCAAACAAGCCAGAGGG + Intergenic
1161404133 19:4082243-4082265 CAGAGCTCAAACTGGCTTGAGGG + Intergenic
930679149 2:54237385-54237407 GGAAGCTCAAAGATGCAGGAAGG - Intronic
932408522 2:71530414-71530436 GGGAGATCAAAGATGCTGGCAGG - Intronic
937040128 2:118814495-118814517 GGGAGTTCAAACATGCTCCAAGG + Intergenic
940372444 2:152918253-152918275 GAGAGCTGAAACATGGGTGAGGG + Intergenic
941329802 2:164165723-164165745 GGGAGTTCATACTTGCTTGGAGG - Intergenic
942458288 2:176152325-176152347 GGGATTTCCAAAATGCTTGAGGG + Intronic
945578318 2:211559998-211560020 GGATGCCCAAACAGGCTTGATGG + Intronic
947518136 2:230824588-230824610 GGCAGCTCAAAGACGCCTGAAGG + Intergenic
947702978 2:232250700-232250722 AGGACATCAAACATGCTTGATGG + Intronic
948209699 2:236183702-236183724 GGAAGCTCAATCATGGTGGAAGG - Intergenic
949073884 2:242042814-242042836 GGAAGCTCAAACATCCTGGCAGG + Intergenic
1170025005 20:11879503-11879525 TGGAGCTCAATCCTGCTTGGGGG - Intergenic
1171506596 20:25641338-25641360 GGGAGATTAAAGATGCTAGAGGG + Intergenic
1179367819 21:40774409-40774431 GGGAGCTCAAACAGCCTTCCAGG + Intronic
1180195711 21:46192290-46192312 AGGAGCTCACACTTGCTTGCTGG + Intronic
1181595278 22:23910392-23910414 GGGACCTCAAACATTCTCTATGG + Intergenic
1182920687 22:34076265-34076287 GGCAGCTCAGACATCCTTGTTGG - Intergenic
951188476 3:19741685-19741707 GGCAGCTCAAACATCTTTGAGGG - Intergenic
951635098 3:24765516-24765538 TGAAGCTCAAAAATGCTTTAGGG + Intergenic
953388758 3:42522584-42522606 GGAAGCTCAAACTTGCTGGCTGG + Intronic
953587216 3:44213846-44213868 GGGAACTCATACATGGTTGGTGG + Intergenic
956100364 3:65761821-65761843 GGGAGCTCAGCAATCCTTGAAGG - Intronic
959332572 3:105024265-105024287 GGCAGCTCAAACAGACTTGGGGG + Intergenic
967681698 3:192371115-192371137 GGCAGCTCAAAAATGATTGCTGG + Intronic
967972256 3:195007814-195007836 GGGAGCCCATTCATGCCTGAAGG - Intergenic
972279852 4:37591293-37591315 AGGTGCTCAAAGATGTTTGAGGG - Exonic
974647395 4:64712982-64713004 GGCAGCTCAAAAGTTCTTGATGG - Intergenic
977342570 4:95777412-95777434 GGGAACTCATACACTCTTGATGG + Intergenic
979851727 4:125579752-125579774 GGGAGCTCATTCATTTTTGATGG + Intergenic
979899894 4:126202492-126202514 GGGAGTGCAAACTTCCTTGATGG - Intergenic
982264955 4:153529917-153529939 GAGACCTCACACATGCTTTAAGG + Intronic
983652918 4:170051562-170051584 GGAGGCTCAAACTTGCTTTAGGG + Intergenic
988404789 5:30810436-30810458 TGGAGCTTAAACAAGCTTGCTGG + Intergenic
988897583 5:35694429-35694451 GTGAGCACAAACATGCTTTCAGG + Intronic
988979664 5:36554023-36554045 TGGATATCAAACATGGTTGAGGG - Intergenic
989460517 5:41692604-41692626 TGGTGCTCAAACATTCATGAGGG + Intergenic
990283681 5:54278265-54278287 TGGAGCTCAACCATGCCTGATGG + Intronic
992259740 5:74957755-74957777 GGCACCTCAAACTTGCTTCAAGG + Intergenic
998425629 5:142025918-142025940 GTGTGCTAAAACATGCATGAGGG + Intergenic
1001698845 5:173692132-173692154 GGGAGCTGAGTCATGATTGAAGG + Intergenic
1003257244 6:4485256-4485278 GGGAGATGAAAGAGGCTTGAGGG - Intergenic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1009554320 6:65142693-65142715 GGGAGCTCAGACATAGCTGAAGG + Intronic
1010254663 6:73744281-73744303 GGGAACTCATTCATGCTTGTGGG + Intronic
1019186952 6:170226212-170226234 GCGAGCTCACACTTGCCTGATGG + Intergenic
1027510581 7:79074739-79074761 GGAAAGTCAAACATGCATGATGG + Intronic
1031194078 7:118590329-118590351 GGAAACTCAAACATGGTGGAAGG - Intergenic
1031532621 7:122894868-122894890 TAGAGCTCATACATGCTTTATGG - Intergenic
1032497015 7:132370102-132370124 GGGAGCTCAAACCTGCTGTCAGG - Intronic
1033120590 7:138664259-138664281 GGGAGCTCAAGGACGCTGGAGGG - Intronic
1039292523 8:36111789-36111811 GGGAGCCCCAGCATCCTTGAGGG - Intergenic
1041779278 8:61559839-61559861 TGGTCTTCAAACATGCTTGATGG - Intronic
1042846923 8:73177631-73177653 TGGAGCTCAAACCTGTTTCAGGG + Intergenic
1044751526 8:95421043-95421065 TGGGGCTCATTCATGCTTGAAGG + Intergenic
1045311488 8:101007261-101007283 GTGAGCAGAACCATGCTTGATGG - Intergenic
1047650458 8:126914593-126914615 GGGAGCTCAACCATGTCTCATGG - Intergenic
1048035742 8:130675735-130675757 TGAAGGTCAAACATGCTTGCTGG + Intergenic
1049752746 8:144293026-144293048 GGGAGGCCACACATGCTTGGTGG - Intronic
1057826377 9:98375382-98375404 CAGAGCAGAAACATGCTTGAAGG - Intronic
1187028379 X:15459438-15459460 GGGAGCTAAAAAGTGATTGAGGG + Intronic
1187366130 X:18667024-18667046 GGGAGCCCAGACAGGCTGGATGG + Intronic
1190212617 X:48460194-48460216 GGGAGCTCACACAGGGTGGAAGG - Intronic