ID: 1127209992

View in Genome Browser
Species Human (GRCh38)
Location 15:56764303-56764325
Sequence AACATCTATGAGTGTATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127209992_1127209994 17 Left 1127209992 15:56764303-56764325 CCTGCTATACACTCATAGATGTT 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1127209994 15:56764343-56764365 TATTGTTGTTGTTTTGGTTTTGG 0: 1
1: 13
2: 83
3: 783
4: 2741
1127209992_1127209996 27 Left 1127209992 15:56764303-56764325 CCTGCTATACACTCATAGATGTT 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1127209996 15:56764353-56764375 GTTTTGGTTTTGGTTTTTGGTGG 0: 2
1: 7
2: 57
3: 441
4: 2305
1127209992_1127209993 11 Left 1127209992 15:56764303-56764325 CCTGCTATACACTCATAGATGTT 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1127209993 15:56764337-56764359 TGTTGTTATTGTTGTTGTTTTGG 0: 4
1: 183
2: 419
3: 1074
4: 3719
1127209992_1127209995 24 Left 1127209992 15:56764303-56764325 CCTGCTATACACTCATAGATGTT 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1127209995 15:56764350-56764372 GTTGTTTTGGTTTTGGTTTTTGG 0: 2
1: 14
2: 72
3: 653
4: 2610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127209992 Original CRISPR AACATCTATGAGTGTATAGC AGG (reversed) Intronic
900732108 1:4268857-4268879 AGCATTTATGAGTGTCCAGCAGG - Intergenic
911405930 1:97439661-97439683 AACATCAATGAAGGTAAAGCTGG - Intronic
912561937 1:110557183-110557205 AACATTTATGTGTTTATAGATGG - Intergenic
915824893 1:159064953-159064975 AGTATATATGAGTGGATAGCTGG + Intronic
916453767 1:164949139-164949161 AAGATCTATGAGGGTAGACCTGG + Intergenic
918461617 1:184782873-184782895 AACATCTATGTTTGTGGAGCAGG - Intergenic
918807931 1:189073947-189073969 ATCATCTATGGGTGTATTCCTGG + Intergenic
921865512 1:220083805-220083827 TTCATCTATGAGTGTTTTGCAGG + Intronic
1066636411 10:37506331-37506353 AAAATCTATGAGTTTATAAATGG - Intergenic
1067316413 10:45169494-45169516 TACATCTATGATTGTCAAGCAGG - Intergenic
1069076845 10:64046069-64046091 AACATATATGAATATATACCAGG - Intergenic
1083216689 11:61224867-61224889 TACATCTAGATGTGTATAGCAGG - Intronic
1083219571 11:61243693-61243715 TACATCTAGATGTGTATAGCAGG - Intronic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1091209672 11:133845442-133845464 ATCATCTTTGAATGTATACCAGG + Exonic
1094664521 12:32505934-32505956 AACATCTAGGGATGTATAACAGG - Intronic
1095234371 12:39778836-39778858 AACATCTATAGGGGTATAGGAGG + Intronic
1095409515 12:41907086-41907108 ACCATCTGTGAGAGTATGGCAGG - Intergenic
1096456096 12:51788380-51788402 AACTTTTATGAGTGAATGGCAGG - Intronic
1097832623 12:64241514-64241536 AAAATCTATGAATGCATAGTTGG + Intergenic
1100923314 12:99515035-99515057 AACTTTTGTGGGTGTATAGCAGG + Intronic
1101012385 12:100464380-100464402 TACATCTATGATTGTAGATCTGG - Intergenic
1102756284 12:115343579-115343601 AACATGTATAAGTGTACAGAAGG + Intergenic
1102895847 12:116598052-116598074 AAGTTCTATGAGTGTATATGTGG + Intergenic
1106373752 13:29163595-29163617 AACATCTATGAATGGTTAGGTGG + Intronic
1108475802 13:50816333-50816355 GAAGTATATGAGTGTATAGCAGG - Intronic
1108750688 13:53445386-53445408 AACCTCTATGGGTTTTTAGCAGG - Intergenic
1109604131 13:64669978-64670000 GACATCTATCAGTAGATAGCTGG + Intergenic
1116193356 14:41688297-41688319 AACAACTAAGAGAGTATAGTTGG + Intronic
1123102253 14:105812236-105812258 GATATCTATGAGTGTATATTGGG + Intergenic
1127209992 15:56764303-56764325 AACATCTATGAGTGTATAGCAGG - Intronic
1133524000 16:6586533-6586555 AACATCTATGTATATATAGCTGG + Intronic
1135049780 16:19183546-19183568 AATATCGATGAGTGGAGAGCTGG - Exonic
1137413478 16:48249547-48249569 AACATCTATGAAATTATAGATGG - Intronic
1139084150 16:63563474-63563496 AATAACTATGAGTGTATAGAAGG - Intergenic
1152314045 17:79569731-79569753 AACATCTAAGAGTGTTTGGATGG + Intergenic
1153510708 18:5848816-5848838 AACATCAATGTGTGTATGCCAGG + Intergenic
1159036836 18:63285695-63285717 CTCATCTCTGAGTGTGTAGCGGG + Intronic
1159837929 18:73363030-73363052 TACATCTTTGAGTATATATCAGG + Intergenic
1160432420 18:78820904-78820926 ACCATCTATGACTGAAGAGCTGG + Intergenic
1162152647 19:8656757-8656779 AACACCTGTGTGTGTGTAGCAGG + Intergenic
1162840725 19:13354665-13354687 AACATTTTTGTGTGTGTAGCAGG - Intronic
1162859241 19:13493100-13493122 AATATAGATGAGTGTATAGAAGG - Intronic
1166322263 19:42025716-42025738 ACCATCTCTGACTGAATAGCTGG + Intronic
925436129 2:3838809-3838831 AACTTCTAGAAGTGGATAGCTGG - Intronic
926337868 2:11877723-11877745 AACATTTTTGAGTATATAACTGG + Intergenic
927257794 2:21055479-21055501 AACTTCTATGAGATTAAAGCTGG + Intergenic
932342292 2:70973226-70973248 AACATATATGATTGTATTGTTGG - Intronic
932840212 2:75074838-75074860 AACATCTATGTGTGTAGCGTGGG + Intronic
933933537 2:87180075-87180097 AACTTCTAAGAGGGCATAGCAGG - Intergenic
934865881 2:97810492-97810514 AACATCTATGAGGGCAAAGGTGG + Intronic
935940743 2:108236467-108236489 AACTTCTATCACTGAATAGCAGG - Intergenic
936359574 2:111785369-111785391 AACTTCTAAGAGGGCATAGCAGG + Exonic
940842434 2:158599377-158599399 AACCTCCATGAGGGTATGGCAGG - Intronic
941739055 2:169013534-169013556 ATCATCTATGGGTGAAGAGCAGG + Intronic
944792047 2:203141021-203141043 AACATCTATGTGTATAAAGGTGG - Intronic
1169562080 20:6812524-6812546 AACATCTATGAGGGGAGAGGAGG - Intergenic
1174498219 20:50964877-50964899 ACAATCTATGACTGTATAACTGG - Intergenic
1183061725 22:35340305-35340327 AAGCTCTATGGGTATATAGCAGG + Intronic
1184829264 22:46973600-46973622 AACATTTATGAGTATTTTGCTGG + Intronic
949179080 3:1104631-1104653 AACATATATGATTTTATAACTGG - Intronic
952024781 3:29066371-29066393 AACATCTATGTATGTATACTAGG - Intergenic
953465355 3:43114946-43114968 AACACCTGTGCGAGTATAGCTGG + Intergenic
954856015 3:53643930-53643952 AACATCCATGAGTGCATGTCAGG - Intronic
959842240 3:110990886-110990908 AAAAATTATGAGTGTATAGTTGG - Intergenic
960309375 3:116101940-116101962 ACCACCTATGAGTTTATAGAGGG + Intronic
960309605 3:116105061-116105083 AAAATCTTTTAGAGTATAGCTGG - Intronic
967344131 3:188434823-188434845 AACATCTTGGAATTTATAGCTGG + Intronic
970228787 4:13887371-13887393 AATATATATGAATGTATAACTGG + Intergenic
971866119 4:32174921-32174943 AATATGGATGAGTGTATAACAGG - Intergenic
976813385 4:89120641-89120663 AAAATCTATCAGGGTATGGCAGG + Intergenic
978137614 4:105281515-105281537 AACAACTGTGAGTGTATTGGGGG - Intergenic
978162566 4:105566567-105566589 AATATCTAAGAGAGTATAACTGG - Intronic
978394255 4:108261590-108261612 AACATCTATCAGAGTGTGGCAGG + Intergenic
980437054 4:132790670-132790692 AATATATATGAGTTTATTGCTGG - Intergenic
980482643 4:133407855-133407877 AACATCTATAAGTGTTCACCAGG - Intergenic
980699716 4:136409205-136409227 AACATTTACAAGTGTATATCTGG - Intergenic
983243486 4:165260548-165260570 CACATATATGTGTGTGTAGCAGG - Intronic
983778754 4:171642342-171642364 AACCTCTATGAGTTTATAATTGG + Intergenic
987173593 5:15284507-15284529 AACATCCATGAGGTCATAGCAGG + Intergenic
987177016 5:15323009-15323031 AAGATCTCTGAGTGGAAAGCAGG - Intergenic
988814290 5:34817473-34817495 AACACCTATGAGTGGATGGCTGG - Intronic
990023101 5:51152853-51152875 AACATCTAAGAGTTTATTGATGG - Intergenic
990043734 5:51402905-51402927 AATTTCTAAGAGTGTAAAGCAGG - Intergenic
990170907 5:53048643-53048665 AACATCTATGAGGGAAGGGCAGG - Exonic
996588617 5:125120079-125120101 AACACCAATTTGTGTATAGCAGG + Intergenic
1000089144 5:157915052-157915074 AACATCTAAGGTTGCATAGCTGG - Intergenic
1005643063 6:27815248-27815270 GACATCTTTGAGCGTATCGCCGG + Exonic
1006212316 6:32406949-32406971 AACATCTAAGAGTGTAAGTCTGG - Intronic
1010524373 6:76882273-76882295 AACATAGATGAGTGTAAAGGAGG - Intergenic
1010771121 6:79832282-79832304 AACATTTATCAGTTTATTGCAGG + Intergenic
1011478193 6:87768131-87768153 AACATGTATGAGTGGAGAGCAGG + Intergenic
1020281023 7:6650061-6650083 AACAACTATGATTTTGTAGCGGG - Intronic
1020842769 7:13241071-13241093 AACATTTATGTGTTTGTAGCAGG + Intergenic
1022829633 7:34052739-34052761 ATCAGCTATGAGTCAATAGCTGG + Intronic
1035555895 8:566813-566835 GTCATCTATGTGTGTATTGCTGG - Intergenic
1037123669 8:15319368-15319390 AGCATGTAAGAGTGTACAGCAGG - Intergenic
1039086394 8:33784286-33784308 AAAATGTATGTGTGTATAGAGGG - Intergenic
1040807533 8:51409841-51409863 AACATCTTTTAGTGTCTGGCTGG - Intronic
1042653731 8:71071528-71071550 AACATCTATCAGTGAATAAATGG - Intergenic
1045993085 8:108332913-108332935 ACCATCTCTGAGTGTATGGTGGG - Intronic
1046361611 8:113166206-113166228 AAAATATATGAGTTTATGGCTGG + Intronic
1046994554 8:120502977-120502999 AACATATATGAATGTAAAACAGG - Intronic
1051107221 9:13593965-13593987 AACCTCCATGAATGTATACCAGG + Intergenic
1058083693 9:100726179-100726201 AACATATATGACTGTTTAACTGG + Intergenic
1059836903 9:118164853-118164875 AACATATATGAATGTATACATGG + Intergenic
1061654163 9:132075795-132075817 AACACCTATCTGTGTAGAGCTGG + Intronic
1188353508 X:29161115-29161137 AAGCTCTATGAGTATACAGCAGG + Intronic
1188562721 X:31487932-31487954 AACATTTTTGAGTGTATAAGGGG + Intronic
1189053815 X:37676928-37676950 AACTTCTATGTGTTTACAGCAGG - Exonic
1196861142 X:120027943-120027965 TACATATATGAGTGTATTCCTGG - Intergenic
1199194464 X:145011020-145011042 AATATCTATAAGAGTATAACTGG + Intergenic
1200713224 Y:6508313-6508335 AATATCTATCAGTGAATACCTGG + Intergenic
1201020698 Y:9653728-9653750 AATATCTATCAGTGAATACCTGG - Intergenic