ID: 1127211398

View in Genome Browser
Species Human (GRCh38)
Location 15:56778386-56778408
Sequence GCAAACCTTCAGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 22, 2: 54, 3: 119, 4: 435}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127211398_1127211402 10 Left 1127211398 15:56778386-56778408 CCTTCCACCCTCTGAAGGTTTGC 0: 1
1: 22
2: 54
3: 119
4: 435
Right 1127211402 15:56778419-56778441 CTGACAATCAACAGATTAACAGG 0: 1
1: 4
2: 29
3: 96
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127211398 Original CRISPR GCAAACCTTCAGAGGGTGGA AGG (reversed) Intronic
900426990 1:2585433-2585455 GCACAACTCCAGAGGGTAGAGGG + Intergenic
901308467 1:8250654-8250676 GCCATCTTTCTGAGGGTGGACGG - Intergenic
901818941 1:11813242-11813264 GCAGACCTTTAGAGAGTGAAAGG + Intronic
903577387 1:24347295-24347317 GCACAGCTTAAGAGGGTGCATGG + Intronic
904484354 1:30814976-30814998 GGAAACCATCAGAGGGTGCTAGG - Intergenic
905286756 1:36885654-36885676 GGAAGTCCTCAGAGGGTGGAAGG - Intronic
905943706 1:41884548-41884570 GCTAACCTTCTGAGGCTGGCAGG - Intronic
906059789 1:42941056-42941078 GCAAACCCTCAGAGGAAGAATGG - Intronic
906066074 1:42981041-42981063 CCGAACCCTCAGAGGGTAGAGGG + Intergenic
907469848 1:54666205-54666227 GCAGACCTTCAGAGGATGAAGGG - Intronic
907864562 1:58387235-58387257 GTGAACCTTCAGAGAGTGGAGGG - Intronic
909151614 1:72012929-72012951 GCAAACCTTCAGAAGCTAAAGGG - Intronic
909318147 1:74248941-74248963 GCAAACCTTCAGAGAGGCAAAGG + Intronic
910807833 1:91206222-91206244 GTGAAACTTCAGAGGGTGAAGGG + Intergenic
911700001 1:100941716-100941738 GCAAAGCTACACAAGGTGGATGG - Intronic
912177014 1:107171724-107171746 GCAGGTTTTCAGAGGGTGGATGG - Intronic
912304700 1:108555557-108555579 GCAAAGCTTCAGAAGGCAGAGGG - Intergenic
912365462 1:109129950-109129972 TAGAACCTTCAGAGGGTGCATGG - Intronic
912524508 1:110271171-110271193 TTAAACCTTCAGAGGTGGGAAGG + Intronic
913668681 1:121074268-121074290 GCAAACTTTCAGAGGATAGAAGG - Intergenic
914020425 1:143861711-143861733 GCAAACTTTCAGAGGATAGAAGG - Intergenic
914658925 1:149769623-149769645 GCAAACTTTCAGAGGATAGAAGG - Intergenic
916008785 1:160685733-160685755 GCAAACCTTCAGAAGGTGAAGGG - Intronic
916679952 1:167094822-167094844 CCAAACTTTCAGAGGTTGGCAGG + Exonic
916793556 1:168145558-168145580 GAAAAGCTTCCCAGGGTGGAGGG + Intergenic
916986679 1:170199403-170199425 GCAAACCTTTAGAGAGTGAAGGG - Intergenic
917073341 1:171177088-171177110 GCAAATCTTCAGAGAGCAGAGGG - Intergenic
917569021 1:176244573-176244595 GTGAACCTTCAGAGAGTAGAGGG - Intergenic
920163346 1:204016979-204017001 GCGAAACTTCAGAGGGCAGAGGG - Intergenic
922239646 1:223747304-223747326 GCGGACCTTCAGAGGGTGGAGGG - Intronic
922891238 1:229063166-229063188 GCAAACCTTCAGAGAGCGAAGGG - Intergenic
922978981 1:229809136-229809158 GAGAACCTTCAAAGGGTGAAGGG - Intergenic
923020910 1:230163036-230163058 GTGAACCTTCAGAGGGTGATGGG + Intronic
923527013 1:234780409-234780431 GCAAACCTTCAGAGGAAGAAGGG + Intergenic
923968987 1:239178091-239178113 GCAAACATTCAGAGGGTGAAGGG + Intergenic
924024716 1:239820102-239820124 GCGAACCTTCTGAGGGTAAAGGG - Intronic
924107133 1:240660105-240660127 GCAAACCTTCTGATGTGGGAAGG - Intergenic
1063768650 10:9172304-9172326 GGGACCTTTCAGAGGGTGGAGGG - Intergenic
1063804650 10:9624388-9624410 GGAAACCTTCAGAGAGTAAAGGG + Intergenic
1064468613 10:15612266-15612288 TCAAAGCTTTTGAGGGTGGAGGG - Intronic
1064692224 10:17929931-17929953 GCAAACCTTCAGAGGATAACAGG + Intergenic
1064745983 10:18478536-18478558 GCAAACTTTCACAGGGTGAAGGG - Intronic
1064952500 10:20869659-20869681 GCATAGCTTCAGTGGTTGGATGG - Intronic
1064980242 10:21159375-21159397 GAAAACCTTCAAACGGTGTAGGG - Intronic
1065830572 10:29610349-29610371 GCAAACCTTGGGAGTCTGGAAGG - Intronic
1066147289 10:32574467-32574489 CCAAACCTTCAGAGAGTGGATGG + Exonic
1066190972 10:33055960-33055982 GAGAACCTTCAGAGGGTGGAAGG - Intergenic
1066714962 10:38276913-38276935 ACAATCCTTTAGAGGGTGAAGGG - Intergenic
1066762300 10:38767066-38767088 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1066783118 10:38973786-38973808 ACAATCCTTTAGAGGGTGAAGGG + Intergenic
1066959291 10:42205404-42205426 GTTAATCTTCAGAGGGTGAAAGG - Intergenic
1068128861 10:52872611-52872633 GCAAACCTTCAGAGGGCAAAGGG - Intergenic
1068527132 10:58143199-58143221 GCAAACCTTCAGAGGGCCAAGGG + Intergenic
1068779698 10:60906227-60906249 GCAAACCTTCTGAGAGTGAATGG - Intronic
1069134790 10:64750982-64751004 CTAAGCCTTCAGAGGGTGAAGGG - Intergenic
1069997041 10:72348745-72348767 GCAAACCCTGAGAGGGTGCTTGG + Intronic
1070105957 10:73431690-73431712 GGAGACATTAAGAGGGTGGATGG - Intronic
1070531034 10:77337758-77337780 GCCTAACTTCAGAGGGTGCAGGG - Intronic
1071218229 10:83432594-83432616 GCAAACCTTCAGAGGGTGACAGG + Intergenic
1071602558 10:86965690-86965712 GTGAACCTTCAGAGGGTAAAGGG - Intronic
1071960075 10:90801616-90801638 GCAAAACTTCAGAGGGTCAAGGG + Intronic
1072780698 10:98249353-98249375 GCAGAAGGTCAGAGGGTGGAAGG + Intronic
1072900126 10:99399839-99399861 GCAAACTTTCAGAGGGCAAAGGG + Intronic
1072951230 10:99848389-99848411 GCAGAACTTCAGTGTGTGGAAGG - Intronic
1073876338 10:107926440-107926462 GGGGACTTTCAGAGGGTGGACGG + Intergenic
1074763483 10:116684362-116684384 CCAAACCATCACAGGGTGGAAGG + Intronic
1075111458 10:119589062-119589084 TAAAACATACAGAGGGTGGAGGG + Intronic
1075864881 10:125709223-125709245 GCAAACCTTCAGAGGGTGAAAGG + Intergenic
1075942997 10:126407300-126407322 GCCAGGCTTGAGAGGGTGGAGGG + Intergenic
1076267209 10:129118284-129118306 GCAAACCCTTGGTGGGTGGATGG - Intergenic
1077087253 11:759970-759992 GCAAACCTCCAGTGAGGGGAAGG + Intronic
1077703904 11:4466158-4466180 GCAAACCTTTGGAGGGTGCCTGG - Intergenic
1078554644 11:12312538-12312560 GCAACCTTTCAGAGGGTGAGGGG - Intronic
1078817510 11:14840906-14840928 GCTAACCTTCCCAGAGTGGAAGG + Intronic
1078834882 11:15017640-15017662 GCATTGCTTCAGAGGGTGCAAGG + Intronic
1078951334 11:16137890-16137912 GCACATCTTCACAGGGTGGCAGG - Intronic
1079168891 11:18073206-18073228 GAAAGCCTTCTGAGGGAGGAGGG - Intronic
1079382537 11:19950700-19950722 GTGAACCTTCAGAGGGTAAAGGG - Intronic
1079676404 11:23232315-23232337 ACAAACCTTCAAAGGGCAGAGGG - Intergenic
1080269806 11:30439193-30439215 GCAAACTTTTAGAGGTTTGAAGG - Intronic
1080307338 11:30850901-30850923 GCAAACCTTCAGAAGGCCAAGGG - Intronic
1080307580 11:30853432-30853454 CCAAACCTTCAGAGGGAAAAAGG - Intronic
1080409881 11:32013659-32013681 GTAAATCTTCAGAGGGTCGGGGG - Intronic
1080425504 11:32150504-32150526 CCAAACCTTCAGAGGGTGAAGGG + Intergenic
1082036386 11:47648577-47648599 GCAAAACTTCAGAGGGCAAAGGG + Intergenic
1082846730 11:57732199-57732221 GCAAAACTTTAGAAGGTGGAGGG + Intronic
1083168674 11:60908648-60908670 GCAAATCTTTAGAGGGCAGAGGG - Intergenic
1083286419 11:61662053-61662075 GCAAACCTTCAGTGGGTGAAGGG + Intergenic
1084392150 11:68884460-68884482 GCAAATCTTCAGAGGGTGGAAGG - Intergenic
1085495266 11:76963195-76963217 GGAAACTTGCAGAGGGAGGAGGG + Intronic
1085868763 11:80325846-80325868 GCAGACCTTCAGAGGTTAGGAGG + Intergenic
1086294292 11:85347700-85347722 GCAAAACTTCAGAGGGCAAAGGG + Intronic
1086508716 11:87532116-87532138 GCAAACCTTCAGATGGTGAAGGG + Intergenic
1086722064 11:90133443-90133465 GCAAAACTTCAGAGGGTGAAGGG - Intronic
1086841986 11:91697669-91697691 GGAAATCTTAAGGGGGTGGAAGG + Intergenic
1086963987 11:93008954-93008976 GCATGCCTTGTGAGGGTGGAGGG - Intergenic
1087544389 11:99565837-99565859 GCCAACCTTCAGAGGGCAGAAGG + Intronic
1087770877 11:102208414-102208436 GCGAACCTTTAGAGGGTAGAGGG + Intronic
1088102165 11:106167594-106167616 GCAATCCTTCAGAGGGTGAAGGG - Intergenic
1088123082 11:106392936-106392958 GTGAACTTTCAGAGGGTAGAAGG - Intergenic
1088282592 11:108150652-108150674 GCAAACCTTCAGAGGGCCAAGGG + Intergenic
1089691216 11:120187796-120187818 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
1090664100 11:128903607-128903629 GCAGACCTTCAGAGAGTGACGGG + Intronic
1090718927 11:129455101-129455123 GGAGGCTTTCAGAGGGTGGAGGG + Intergenic
1091100153 11:132864330-132864352 GCAAACCTTCAGAAGGTGAAGGG + Intronic
1091159422 11:133406291-133406313 CCAAACCTGCAGAGATTGGAGGG + Intronic
1091363007 11:134993144-134993166 GCAAGCCTTCAGAGGGTGAAGGG + Intergenic
1093372325 12:18379776-18379798 GCAAACCTCAAGAGGGTCTATGG - Intronic
1094018485 12:25889083-25889105 GCGAAACTTCAGAGGGTAAAGGG - Intergenic
1095662447 12:44753263-44753285 GCTTACCCTCTGAGGGTGGATGG - Intronic
1095675076 12:44907100-44907122 GCAAACCTTCACATGGTGGCAGG - Intronic
1095783199 12:46083524-46083546 GTGAAACTTCAGAGGGTGAAGGG - Intergenic
1096456148 12:51788694-51788716 GGCAACCTTCAAAGGCTGGATGG + Exonic
1096565968 12:52479521-52479543 GCACATCTTCACAGGGCGGAAGG - Intergenic
1096649934 12:53057478-53057500 GCGAGCCTTCTAAGGGTGGATGG + Intronic
1096998978 12:55859779-55859801 GTGAACCTTCAGAGGCTAGAGGG - Intergenic
1097263934 12:57735495-57735517 GGAAAGCTGCAGAGGGAGGAGGG - Intronic
1097441025 12:59609020-59609042 GCAAACCTTCAGAGGGTAAAGGG - Intronic
1097494567 12:60314470-60314492 GCAAACCTTCAGAGGACCAAGGG + Intergenic
1097597667 12:61654145-61654167 GCAAACATTCAGAGGGCGAAGGG - Intergenic
1097599012 12:61669144-61669166 GCAAACCTTCAGAGGGCTAAGGG - Intergenic
1097870292 12:64596321-64596343 GCAAACCTTCAGAGGGACAAGGG + Intergenic
1097890535 12:64773158-64773180 CCAAACCAACTGAGGGTGGAAGG + Intergenic
1098435538 12:70464729-70464751 GTGAACCTTCAGAAGATGGAGGG - Intergenic
1098662982 12:73122391-73122413 GTAAACTTTAAGAGGGTGAAGGG - Intergenic
1098713804 12:73802326-73802348 GCAACTCTTCACAGGGTGGCAGG - Intergenic
1099686212 12:85892631-85892653 GCAAACCTTCAGAGGATAAAAGG - Intergenic
1099801332 12:87460447-87460469 TCAAATCTTCAGAGGGTGAAAGG - Intergenic
1099802178 12:87471305-87471327 ACAAACCTTCAGAGAATGAAAGG - Intergenic
1099856072 12:88168486-88168508 GTAGACCTTCAGAGGTAGGAGGG + Intronic
1100042714 12:90340388-90340410 GCAAACTTTCAGAGAGTGAAAGG - Intergenic
1100882635 12:99035634-99035656 GCAAACCTTTAGAGGGCCAAGGG + Intronic
1101298785 12:103456064-103456086 GGAAAGTTTCTGAGGGTGGATGG + Intronic
1102399589 12:112616928-112616950 TCAAACCTTCCCAGGGAGGAAGG - Intronic
1103954502 12:124568623-124568645 GCAAACCTGGAGGGGGTGGGAGG - Intergenic
1104240893 12:126988297-126988319 GCAAACCCACAGAGGGAAGAGGG + Intergenic
1105941688 13:25153220-25153242 GTGAACCTTCAGAGGGTGAAGGG - Intergenic
1105967147 13:25395397-25395419 GCAAACTTTCAGAGGGCGAAGGG - Intronic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1107122808 13:36813739-36813761 TCAAACCCTCAGAGGGTATAGGG + Intergenic
1107142821 13:37021493-37021515 GCAGACCTCCTGAGGGTAGAAGG + Exonic
1107322953 13:39209033-39209055 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
1107532871 13:41301248-41301270 GAGAACCTTCAAAGGGTGAAGGG - Intergenic
1107564695 13:41590026-41590048 GAGAACCTTCAGAGGGCGAAGGG + Intronic
1107748364 13:43537325-43537347 GGAAACCTTCCCAGGGTAGAAGG + Intronic
1107982867 13:45750187-45750209 ATGAACCTTCAGAGAGTGGAGGG - Intergenic
1108076557 13:46686110-46686132 GCAAACTTTCAGAGGGTGAAGGG - Intronic
1108100309 13:46947290-46947312 GCAAACATTCAGAGGGCCAAAGG - Intergenic
1108493385 13:51002476-51002498 GGAGACCTTCAGAGGGAGAACGG - Intergenic
1108810538 13:54218765-54218787 ACAAACCTTCAGAGGGTGAAGGG - Intergenic
1109287579 13:60428437-60428459 GCAAACCTTCAGAGGCAGAAGGG - Intronic
1109306765 13:60649720-60649742 GCAAACCTTCAGAGGACCAAGGG + Intergenic
1109344198 13:61095298-61095320 GCAAACCTTCAGAGTGCAAAGGG + Intergenic
1109965254 13:69684470-69684492 GCAAACTGTCAGAGCGTGAAGGG - Intergenic
1110083022 13:71341581-71341603 GCAAACTGCCAGAGTGTGGAAGG + Intergenic
1110370081 13:74729949-74729971 GAAGACCTTTTGAGGGTGGAGGG + Intergenic
1110402429 13:75108919-75108941 GGGGACTTTCAGAGGGTGGAGGG + Intergenic
1110992366 13:82058467-82058489 GGGAACCTACAGAGAGTGGATGG + Intergenic
1111307912 13:86439876-86439898 GCAAACCTTCAGAAGGCAAAGGG + Intergenic
1111737726 13:92163924-92163946 GCACATCTTCACAGGGTGGCAGG + Intronic
1112023809 13:95394469-95394491 GCAAAGCTTCCAAGGGTGAAGGG - Intergenic
1112595102 13:100800580-100800602 GCAAACCTTCAGAGGGCACAGGG - Intergenic
1112697890 13:101971066-101971088 TCGAACCTTCAGAGGATGGGTGG + Intronic
1113044972 13:106146046-106146068 GCAAACCTCCTGAGGGTGAAAGG + Intergenic
1113220695 13:108098434-108098456 GCAAGCCTTCAGAGGGAGAAGGG + Intergenic
1113341297 13:109428736-109428758 GCACTTCTTCACAGGGTGGAAGG - Intergenic
1113598944 13:111554726-111554748 GCAAACCTCCAGAGGGCAGAGGG + Intergenic
1114149934 14:20026857-20026879 TAAAGCCTTCAGAGGGAGGATGG - Intergenic
1114233502 14:20804123-20804145 GCAAACCTTTGGAGGGTGAAAGG + Intergenic
1114810487 14:25893143-25893165 ATAAACCTTCAGAGGATGAAGGG + Intergenic
1116585579 14:46698564-46698586 GCAAATCTTGAGAGGCTGAAGGG + Intergenic
1117050097 14:51851104-51851126 CCAAATCTAGAGAGGGTGGAAGG + Intronic
1117308492 14:54499102-54499124 GCAAAACTTCAGAGGGCAAAGGG + Intergenic
1118530185 14:66695606-66695628 GATAACCTTCAGTGGGTGAATGG + Intronic
1118605285 14:67498382-67498404 GCAAACCTTCAGAAGGCAAAGGG + Intronic
1118917300 14:70118324-70118346 GCAAGGTGTCAGAGGGTGGATGG - Intronic
1119752520 14:77089895-77089917 GCAAACTTTCAGAGGTCGAAGGG - Intergenic
1119922360 14:78458068-78458090 GCAAATCTTCAGAGAAAGGAGGG + Intronic
1120008144 14:79383191-79383213 GCAAACCTGCATGGGGTGTAGGG + Intronic
1120208564 14:81612178-81612200 GCAAATCTTCAGAGGGTCAAGGG - Intergenic
1120543748 14:85783999-85784021 GGGACCCTTCAGAGGGTAGAGGG - Intergenic
1121278589 14:92684801-92684823 GGAAACTTTCTGAGGCTGGAGGG + Intronic
1122801906 14:104235221-104235243 GCACCTCTTCACAGGGTGGAAGG - Intergenic
1202847838 14_GL000009v2_random:197692-197714 TCACACCTTCAGAGGGTAGAGGG - Intergenic
1202917314 14_GL000194v1_random:188231-188253 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1202933634 14_KI270725v1_random:63319-63341 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1123977861 15:25569948-25569970 GCAAGCCTTCAGAGGGCCAAAGG + Intergenic
1124143033 15:27094219-27094241 TCAAGCCTTCAGAGGCTGCAGGG + Intronic
1125834990 15:42741242-42741264 GAAAACCCTCAGAGGGTGTTGGG - Exonic
1127211398 15:56778386-56778408 GCAAACCTTCAGAGGGTGGAAGG - Intronic
1127440140 15:58998402-58998424 GTAATCTTTCAGAGTGTGGAGGG - Intronic
1127505797 15:59596587-59596609 GCAAACCTTTAGTAGGTGGAAGG - Intronic
1128209525 15:65885564-65885586 GCAAACCTTCAGAGGGCAATAGG - Intronic
1129234090 15:74213581-74213603 GCCAACCTTCAGAGGGTGGTGGG + Intergenic
1129524065 15:76203055-76203077 GCTGACCTACAGAGGGTGCAGGG - Intronic
1130054555 15:80511364-80511386 GGGGACTTTCAGAGGGTGGAGGG + Intronic
1131951902 15:97690278-97690300 GCAAACCTTCGGAGGGAAAAGGG + Intergenic
1134369477 16:13609677-13609699 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1134443278 16:14312025-14312047 GCAAACTTTTAGCGGGTGAAGGG - Intergenic
1134756023 16:16668165-16668187 ACACCCTTTCAGAGGGTGGAGGG + Intergenic
1134990045 16:18690999-18691021 ACACCCTTTCAGAGGGTGGAGGG - Intergenic
1135171627 16:20189176-20189198 GAAAATGTTCTGAGGGTGGATGG + Intergenic
1135768007 16:25194679-25194701 GCAAACCTTCAGAGGGCAAAGGG - Intergenic
1135846858 16:25926793-25926815 GCAAACCATCAGTGGCTGGAAGG - Intronic
1136378056 16:29877001-29877023 GCAAAGCCTCCGAGGCTGGAAGG - Intronic
1136776360 16:32873919-32873941 GCAAACCTTCAGGAGGGGGTGGG - Intergenic
1136894255 16:33987593-33987615 GCAAACCTTCAGGAGGGGGTGGG + Intergenic
1137364308 16:47847499-47847521 GCAGAACTTCAGAGGGTCAAGGG + Intergenic
1137602428 16:49765291-49765313 GAAAACTTTCCGAAGGTGGATGG + Intronic
1138472173 16:57246342-57246364 GCATAGATTCAGAGGCTGGAAGG + Intronic
1139259711 16:65579811-65579833 GAAAACATTCACAGGGTGGTTGG + Intergenic
1140065792 16:71610166-71610188 GCAACCCTTCAGAGGGCGAAGGG + Intergenic
1140645662 16:77027355-77027377 GGAGCCTTTCAGAGGGTGGAGGG - Intergenic
1141888003 16:86906119-86906141 CCAAACCTTCAGAGAGTGGATGG - Intergenic
1203078775 16_KI270728v1_random:1136028-1136050 GCAAACCTTCAGGAGGGGGTGGG - Intergenic
1143535639 17:7537620-7537642 GCAAACCTTCAGAGGGCGAAGGG + Intergenic
1144391556 17:14798277-14798299 GCAAACCTTCAGAGGGTGATGGG - Intergenic
1145283076 17:21482449-21482471 TCAAACCCTCTGAGGGTAGAGGG - Intergenic
1147670023 17:42171513-42171535 GGAAACACTCTGAGGGTGGAGGG - Intronic
1147743336 17:42680906-42680928 GCAAACCTTGAGAGGTGGGCTGG - Intronic
1150509116 17:65730456-65730478 GCAAACCTTCTTAGGTGGGATGG + Intronic
1151207326 17:72517526-72517548 GCAAACGTTGATAGGGTGGTAGG + Intergenic
1151477297 17:74351412-74351434 GCAACCCTGCAGAGGTTGCAGGG + Intronic
1153158032 18:2171199-2171221 GCAACCTTTCAGAGGGGGAAGGG - Intergenic
1153321191 18:3775696-3775718 GCAAACCTTCAGAGGGTGAAGGG + Intronic
1153322312 18:3785353-3785375 GTGAACCTTCAGAGGGCGAAGGG - Intronic
1154109376 18:11552605-11552627 ACCAACCTTCAGAAGGAGGAAGG - Intergenic
1154488827 18:14903197-14903219 GCAAGCCTTCAGAGGGTGAAGGG - Intergenic
1155018725 18:21874354-21874376 GCACCCCTTCACAGGGTGGCAGG + Intergenic
1155299849 18:24419236-24419258 GCAAACTTTCAGAGGGTGAAGGG + Intergenic
1155340161 18:24805641-24805663 ACAAATCTTCAGAGGGTTAAGGG + Intergenic
1155403719 18:25465371-25465393 GAAGTCCTTCAGAGGGTGGCAGG - Intergenic
1155413382 18:25570682-25570704 GCACATCTTCACAGGGTGGCAGG + Intergenic
1155448844 18:25942584-25942606 GCAAACCTTCAGAGGGCGAAGGG - Intergenic
1155638606 18:27985106-27985128 GCAAACCTTCACACGCAGGATGG + Exonic
1156683958 18:39621911-39621933 GCAAACCTTTAGAGGGCAGAGGG + Intergenic
1156701812 18:39835046-39835068 GCGAACTTTCAGAGGGTGAAAGG + Intergenic
1156905902 18:42351741-42351763 GTGAACCTTCAGAGGATGAAAGG - Intergenic
1156907315 18:42369557-42369579 GCAAACCTTCAGAGGGCAAAAGG - Intergenic
1157680693 18:49603177-49603199 GCTAACTTTCAGAGGGTGATAGG + Intergenic
1158598998 18:58841028-58841050 GCGAGCCTTCAGAGGGTGAAAGG - Intergenic
1159010259 18:63052338-63052360 GAAGACCTTCTGAGGGTGGCTGG + Intergenic
1160471431 18:79137888-79137910 GCACACCTTTAAAGGGTGTATGG - Intronic
1162189142 19:8931064-8931086 GCAAAGACTCTGAGGGTGGAGGG + Intronic
1163454142 19:17396066-17396088 AGGAACCTTCAGAGGGTGAAGGG - Intergenic
1163731386 19:18951525-18951547 GCAAAGCTCCAGAGGTTGCAAGG - Intergenic
1164015852 19:21255442-21255464 CAAAAGCTTCAGAGGCTGGAAGG + Intronic
1164969762 19:32521644-32521666 GCACACCTTCAGAGAGGAGAAGG + Intergenic
1165361123 19:35337698-35337720 GGGAATCCTCAGAGGGTGGAGGG - Intronic
1166458801 19:42968054-42968076 GCAAACCTTCAGAGGGTGAAGGG - Intronic
1166475748 19:43123325-43123347 GCAAACCTTCAGAGGGTGAAGGG - Intronic
1202675183 1_KI270710v1_random:37835-37857 TCACACCTTCAGAGGGTAGAGGG - Intergenic
925193306 2:1902874-1902896 GCAAAACTTCAGGGGAAGGAAGG - Intronic
925322681 2:2987737-2987759 GCACCCTGTCAGAGGGTGGAAGG - Intergenic
925719762 2:6815760-6815782 GGAACCTGTCAGAGGGTGGAGGG + Intergenic
925974476 2:9132088-9132110 GCAAACATTCAGAGGGCAAAGGG - Intergenic
926846022 2:17140156-17140178 TCAAACCTTCAGATGGTAGAGGG - Intergenic
928201039 2:29247589-29247611 GCAAAGCTGTAGAGGGTGGGAGG + Intronic
928299788 2:30115032-30115054 GCAAAACTTCAGAGAATGAAAGG + Intergenic
928674945 2:33641171-33641193 GCAAAACTTCAGAGGGTGAAAGG + Intergenic
928858052 2:35823841-35823863 GCAAACCTTCAGAGGGCCCTTGG + Intergenic
929123578 2:38503096-38503118 GCAAACCTTCAGAGAGTGAAGGG + Intergenic
930113154 2:47696108-47696130 GCAAACCTTCAGAGGGTAAAGGG - Intronic
930695532 2:54407780-54407802 GCAAACCTTCAGGGAGTGAAGGG + Intergenic
930877213 2:56232578-56232600 GCACCTCTTCACAGGGTGGAAGG - Intronic
931565772 2:63614345-63614367 GCAAACCTTCAGAAGGCAAATGG + Intronic
931639649 2:64370425-64370447 CCAAACCATCAGAGGGAGTAGGG - Intergenic
931689356 2:64822215-64822237 GCAAGCCTTTAGAGGGTGAAGGG + Intergenic
932191904 2:69748029-69748051 GCAAACCTTCAGAGGGCAAAGGG - Intronic
932402556 2:71491568-71491590 GGGACCTTTCAGAGGGTGGAGGG - Intronic
932417136 2:71580263-71580285 GGAAACCTCCAGAGGGTTGGTGG + Intronic
932585519 2:73025675-73025697 GCAATGCTGCAGAGGGTGGAAGG + Intronic
932820573 2:74896246-74896268 GAAAACCTTCAGAGGGTGGAGGG + Intergenic
932821097 2:74901443-74901465 GCAAACCTTCAGAGAGTGAAGGG + Intergenic
933071547 2:77864737-77864759 TCAAACCTTCAGAGGGTGGAAGG + Intergenic
933079988 2:77973863-77973885 GCAAACTTTCAGAGGATGAAAGG + Intergenic
933389098 2:81648679-81648701 GTGAACCTTCAGAGGGTAGAAGG - Intergenic
934103882 2:88678771-88678793 GTGACCCTTCAGAGGGTGAAAGG - Intergenic
934325613 2:92011681-92011703 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
934463968 2:94242311-94242333 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
934698105 2:96415015-96415037 TCAAATCTTCAGAGAGTAGAAGG + Intergenic
935756086 2:106276981-106277003 GCAAACCTTCTGAGGGTGAAGGG - Intergenic
935761661 2:106326085-106326107 GCAAACCTTCAGAGGCCAAAGGG + Intergenic
936586985 2:113766744-113766766 GTGAACCTTCAGAGGGTAAAGGG + Intergenic
937134191 2:119538232-119538254 CCAAACCTTCAGAGGGGAAAGGG + Intergenic
937152856 2:119697778-119697800 GTGAACCTTCAGAGGGTGGAGGG - Intergenic
937467619 2:122148535-122148557 GCAAACCTTCAATGAGTGAAAGG + Intergenic
937712714 2:124996353-124996375 GCACACTTTCAAAGGGTGAAAGG - Intergenic
937833566 2:126448699-126448721 GAAAGCCTTCAGAGGGTATACGG - Intergenic
937843459 2:126551678-126551700 GCAGGACGTCAGAGGGTGGAAGG - Intergenic
937883091 2:126882945-126882967 GAAAGCCTTCAGAGGAAGGAAGG + Intergenic
938056935 2:128222842-128222864 GCAAACCTTCTGAGGGCAAAGGG - Intergenic
938236461 2:129710181-129710203 GCAAACCCTCAGAGGGCAAAGGG - Intergenic
938386887 2:130872979-130873001 GCACACCTTTAGAGGCTGCAAGG + Intronic
938768923 2:134483220-134483242 GGCAACCTTCAGGGGTTGGAGGG - Intronic
939798989 2:146683538-146683560 GCACATCTTCACATGGTGGAAGG + Intergenic
941300559 2:163795801-163795823 GTTAACCTTCAGAGGGTGAAGGG + Intergenic
942051836 2:172147362-172147384 GCAAAACTTCAGAGGGTAAAGGG - Intergenic
942623740 2:177876844-177876866 GCAAACCTTCAGAGGGTAGAAGG - Intronic
943211269 2:184969885-184969907 GCAAACCTTCAGAAGGCGAAGGG + Intergenic
943482070 2:188431143-188431165 GCAAACCTTCAGAGGGCCTCTGG + Intronic
943697432 2:190951221-190951243 GCAAGTCGTGAGAGGGTGGAGGG + Intronic
943708949 2:191067759-191067781 ATCAACCTTCAGAGGGTGAAGGG + Intronic
944835905 2:203579660-203579682 GCCAACCTTCAGAGGGCAAAGGG - Intergenic
944899418 2:204198977-204198999 ACAAACCTTTAGAGGGAGAAGGG + Intergenic
945448077 2:209961785-209961807 GCAAACCTTCAGAGAGTGAAGGG - Intronic
945451590 2:210001367-210001389 GCAAACCTTTGGAGGGTGAAGGG - Intergenic
945495131 2:210500031-210500053 GCACATCTTCACAGGGTGGCAGG + Intronic
945608962 2:211974069-211974091 GGAGCCTTTCAGAGGGTGGACGG + Intronic
945735763 2:213598262-213598284 GAGAACCTTCAGAGGGTGAAGGG + Intronic
945811711 2:214557238-214557260 GCAACTCTTCACAGGGTGGCAGG + Intronic
945906107 2:215595235-215595257 GCAAACCTTCAGAGGGTAAAGGG - Intergenic
946033726 2:216725277-216725299 TCCAACCTGCAGAGGGTGGAGGG + Intergenic
946834521 2:223759771-223759793 GGAGCCTTTCAGAGGGTGGAGGG - Intronic
946869640 2:224074220-224074242 GCACACCATCAACGGGTGGATGG + Intergenic
947505713 2:230707084-230707106 GCTAACCGTGAAAGGGTGGAAGG - Intergenic
947672456 2:231946868-231946890 GGGAACCTTCTGAGGCTGGAGGG - Intergenic
947986967 2:234456516-234456538 TCACACCTTCAGAGAGTGGAAGG - Intergenic
948242053 2:236446283-236446305 TAAAACCTTCAGAGGGGAGAGGG + Intronic
948878302 2:240841746-240841768 GGGAAACTTCAGAGGGTGAAAGG - Intergenic
1169061254 20:2662071-2662093 CTAAACCTTCAGAGGGAGCAGGG + Intronic
1170497591 20:16941225-16941247 GCAAACCTCCAGAGGGCAAAGGG + Intergenic
1170952755 20:20951670-20951692 GCAACCCTCCACAGGGTGGAGGG + Intergenic
1171192096 20:23165995-23166017 GCTCACCATCAGTGGGTGGAGGG + Intergenic
1174263337 20:49313426-49313448 GGGAGCCTTCAGAGTGTGGAGGG - Intergenic
1174896477 20:54454595-54454617 GCAAACCTTCAGAGGGTAAAGGG + Intergenic
1175275037 20:57762586-57762608 GCAAATCTCCAGAGGGAGGAAGG - Intergenic
1176595034 21:8685475-8685497 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1176636762 21:9252333-9252355 TCATACCTTCAGAGGGTAGAGGG + Intergenic
1177259474 21:18711676-18711698 GCAACTCTTCACAGGGTGGCAGG - Intergenic
1177259728 21:18713626-18713648 GCACCTCTTCAGAGGGTGGTGGG - Intergenic
1177502431 21:21975468-21975490 GCAAGCCTTCACATGGTGGCAGG + Intergenic
1177831183 21:26140838-26140860 GCCAAACTTCATAGGGTGGTTGG + Intronic
1178606643 21:34042677-34042699 GCAAACCTTCAGAGGGTGATGGG + Intergenic
1179235561 21:39542437-39542459 GGGAAACTTCAGAGGGTGAAAGG - Intergenic
1180277887 22:10662633-10662655 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1180585121 22:16881466-16881488 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1181047577 22:20222891-20222913 GCAAACCCCCACAGGGTGGGTGG + Intergenic
1182891684 22:33824352-33824374 GCATGCCTTCACATGGTGGAAGG + Intronic
1182935573 22:34218822-34218844 GTGAACCTTCAGAGAGTGAAGGG + Intergenic
1183615915 22:38945281-38945303 GCAAAACTTCAGAGGGCGAAGGG - Intergenic
1183937900 22:41274392-41274414 GCAGACCTTGAGAGGGTGTTGGG - Intronic
1183989841 22:41590253-41590275 ACAAACCTTGTGAGAGTGGATGG - Intergenic
1184133150 22:42529879-42529901 GTGAACCTTCAGAGGGCGAAGGG + Intergenic
949501977 3:4688641-4688663 GCAAATCTATAGAGGGAGGAGGG + Intronic
949966237 3:9358872-9358894 GTAAACCTTCAGAGGGCCAAGGG - Intronic
950371056 3:12531027-12531049 GCACCTCTTCAGAGGGTGGCAGG + Intronic
950511913 3:13434525-13434547 GCAAAACTTCAGAGGATGAAAGG + Intergenic
950635992 3:14315091-14315113 GCAAACCTTCTGAGAGTGAATGG + Intergenic
950755841 3:15171772-15171794 GGAAACCTTCAGAGGGCAGGTGG - Intergenic
950854092 3:16089194-16089216 GCAAACTTTTTGGGGGTGGATGG + Intergenic
951738828 3:25897811-25897833 GCAACCCTTCTGTGGGTTGAGGG + Intergenic
951772356 3:26272537-26272559 GCAAACCTTCAGAGGGCAGAGGG + Intergenic
952065156 3:29560892-29560914 GGGACCTTTCAGAGGGTGGAGGG - Intronic
952579897 3:34820864-34820886 GCAGACCTTCAGAGGATGAAGGG + Intergenic
953058146 3:39404791-39404813 GTGAACACTCAGAGGGTGGAGGG + Intergenic
953109346 3:39918577-39918599 GCAAACCTTCAGAGGGCGAAGGG - Intronic
953438090 3:42895773-42895795 GCAAAACTGGAGAGGGGGGATGG + Intronic
954578168 3:51688239-51688261 GCAAACCTGCAGAGGGGAGATGG + Intronic
955004330 3:54955020-54955042 GCAAACCTTCAGAGGGTGAAGGG - Intronic
955009849 3:55003418-55003440 GCAAACCTTCAGGGGATGATGGG - Intronic
955579514 3:60403916-60403938 GCAATCCTTCATAGAGTGAAGGG + Intronic
957103998 3:75862932-75862954 TCATACCTTCAGAGGGTAGAGGG - Intergenic
957228416 3:77478880-77478902 TTAAACCTTTAGAGGGTGAAGGG - Intronic
957288067 3:78242256-78242278 GAGAACCTTCAGAGGGTAGAGGG + Intergenic
957387920 3:79521072-79521094 GCAAGCCTACAGATGGTGGCTGG + Intronic
958511382 3:95053764-95053786 GTAAACCTTCCAAGGGTGGAAGG + Intergenic
959158519 3:102695844-102695866 GTGAACCTTCAGAGAGAGGAGGG - Intergenic
959314613 3:104787008-104787030 GGAGACTATCAGAGGGTGGAGGG + Intergenic
959686401 3:109151997-109152019 GCAAATCTTCACACGGTGGCAGG - Intergenic
959822454 3:110752623-110752645 GCAAACTTTCAGAGGGCAAAGGG + Intergenic
959847323 3:111049182-111049204 GCAAACCTTCAGAGGGCAAAGGG - Intergenic
960435289 3:117619075-117619097 GCATATCTTCACAGGGTGGCAGG - Intergenic
961834626 3:129646858-129646880 AGAAAACTTCAGAGAGTGGAAGG - Intergenic
961988436 3:131161670-131161692 GGAATTTTTCAGAGGGTGGAGGG + Intronic
962119431 3:132545964-132545986 GTGAACCTTCAGAGGGTGACAGG - Intergenic
962171215 3:133103422-133103444 GGGACCTTTCAGAGGGTGGAGGG + Intronic
963295928 3:143546576-143546598 GTAAACCTTGAATGGGTGGAAGG - Intronic
964175478 3:153822606-153822628 GCAAACCTTCAGAGGACAGAAGG - Intergenic
964308731 3:155369669-155369691 GCAAACCTTCAGAGAGTGAAGGG + Intergenic
964312699 3:155411537-155411559 GCAAACTTTCAGAGGGCCAAGGG + Intronic
964487209 3:157198317-157198339 AAAAACCTTCAGAGGGAAGAGGG - Intergenic
964847405 3:161058692-161058714 TCAAACATTCAGAGTGGGGAGGG - Intronic
965415717 3:168389623-168389645 GCAAACCTTCAGAGGGTGAAAGG + Intergenic
965794548 3:172426336-172426358 GCAAACCATCAGAGCTTGTAAGG - Intergenic
966058909 3:175732174-175732196 GCAAACCTTCAGAGAGTGGAGGG - Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967589976 3:191261183-191261205 GCAAACCTTCAGAGGGGCAAAGG - Intronic
967593395 3:191303324-191303346 TCAAACTTTCAGAGGGTGGAAGG + Intronic
1202750133 3_GL000221v1_random:152686-152708 TCATACCTTCAGAGGGTAGAGGG - Intergenic
971400441 4:26270734-26270756 TCAAACCTTCAGAGGGTAGAGGG - Intronic
971568423 4:28176823-28176845 GCAAACCTTCAGAGTTTTGTTGG - Intergenic
971710662 4:30106730-30106752 GCACTCCTTCACAGGGTGGCAGG + Intergenic
972199304 4:36694522-36694544 GGAGCCTTTCAGAGGGTGGAAGG + Intergenic
972771644 4:42202964-42202986 GGAAATCTGCAGAGGATGGATGG + Intergenic
973158920 4:46992619-46992641 GCAAAGCTTCTGAGGGGGCAGGG + Intronic
974799873 4:66802738-66802760 GCAAACCTTTAGAGGGCAAAGGG + Intergenic
974845013 4:67341589-67341611 GCAAACCTTCAGAGGTTAAAGGG - Intergenic
975572853 4:75835837-75835859 GTGAACCTTCAGAGGGTAAAGGG - Intergenic
976399111 4:84587658-84587680 GCAAGTCTTCAGAGGGCAGAGGG - Intronic
976491769 4:85678920-85678942 GCAAACCTTCAGAGGATAAAGGG - Intronic
976671001 4:87653817-87653839 GCAAACCTTCAGAGGGTGAGGGG - Intronic
976736924 4:88319583-88319605 GCAAACCTTCAGAGAGTGAAGGG - Intergenic
976810159 4:89091753-89091775 GCAAACCTTCAGAGGGTAAAGGG + Intronic
977349054 4:95857258-95857280 TCAAACCTTCTGAGAGTAGAAGG - Intergenic
978069670 4:104451772-104451794 GCAAACCTCTAGAGGGCAGAAGG - Intergenic
978505856 4:109455125-109455147 GCACACCTTCAGAGGGCCAAGGG + Intronic
978840730 4:113208987-113209009 GCCAGCCTTCAGAGGATGAAGGG - Intronic
979559726 4:122088544-122088566 CGAAACCTCCAGAGGGTGAAGGG + Intergenic
979797470 4:124864119-124864141 GTGAACCTCCAGAGGATGGAGGG + Intergenic
979809745 4:125021793-125021815 GCAAACCTTCAGAGTGTAAGGGG - Intergenic
979831491 4:125310900-125310922 GCAAACTTTCAGAAGTAGGAGGG - Intergenic
980426927 4:132637359-132637381 GCACATCTTCAGAAGGTGGCAGG - Intergenic
980702336 4:136448641-136448663 GCAAACCTTCAGAGGGCAAAGGG - Intergenic
980982951 4:139669683-139669705 GTGAACCTTCAGAGGGTGAAGGG - Intronic
982303303 4:153902178-153902200 GTAACCCTTCAGTGGTTGGATGG + Intergenic
984005954 4:174308465-174308487 GGAGCCTTTCAGAGGGTGGAGGG + Intronic
984458821 4:180007375-180007397 GAAGCCTTTCAGAGGGTGGAGGG + Intergenic
985041208 4:185893531-185893553 TCAAACCTTCAGAAGCTGGAGGG - Intronic
985041728 4:185897583-185897605 GCGAACCTTCAGAGGGTGAAGGG + Intronic
985220961 4:187705071-187705093 GCAAACCTTCAGATGGTGAAGGG - Intergenic
1202751650 4_GL000008v2_random:10775-10797 TCATACCTTCAGAGGGTAGAGGG + Intergenic
986004991 5:3660165-3660187 GCATTCCTGCAGAGGGGGGAAGG - Intergenic
986146591 5:5083552-5083574 ACCAACCTTCAGAGGGTAAAGGG + Intergenic
986967377 5:13290630-13290652 GGTCCCCTTCAGAGGGTGGAGGG - Intergenic
987274201 5:16344800-16344822 TCAAACCTTCAGAAGATAGAAGG + Intergenic
987831145 5:23096795-23096817 GGGCCCCTTCAGAGGGTGGAGGG + Intergenic
988294145 5:29333029-29333051 GGAGACTGTCAGAGGGTGGAGGG - Intergenic
988894858 5:35661578-35661600 GGGACCTTTCAGAGGGTGGAGGG - Intronic
989588556 5:43092692-43092714 TCAAACCTTCAGAGGAGGAAGGG - Intronic
989602199 5:43210705-43210727 GTGAACCTGCAGAGGGTGAAGGG - Intronic
990148720 5:52791495-52791517 GCAAGACATCAGAGGGTGGGAGG - Intronic
990495887 5:56347398-56347420 GCAAACCTTCAGAGGGTAGAAGG + Intergenic
990562847 5:57000829-57000851 GTAAAACTTCAGAGGGTGAAGGG - Intergenic
991030769 5:62080087-62080109 GCAAACTTTCAGAGGGCAAAGGG + Intergenic
991240823 5:64458228-64458250 GCAAAACTACAGATGGTGGGGGG + Intergenic
992261899 5:74978963-74978985 GTGAACCTTCAGAGGATGAAGGG + Intergenic
992871193 5:81007193-81007215 GGAAACCTGCAGAAGGTGAAGGG + Intronic
993247454 5:85468746-85468768 GCAAATCTTCAGAAGGTGAAGGG - Intergenic
993517676 5:88857719-88857741 GCACCCCTTCACAGGGTGGCAGG - Intronic
994512646 5:100724681-100724703 TCAAGCCTTCAGAGGGAGTATGG + Intergenic
994749745 5:103722707-103722729 GCAACTCTTCACAGGGTGGCAGG + Intergenic
995039985 5:107576910-107576932 GCTAACCTTCATGGGGTGGAGGG - Intronic
996438349 5:123460701-123460723 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
996472110 5:123872622-123872644 GCAAACCTTCAAAGGGCCAAGGG + Intergenic
996497825 5:124181805-124181827 GCAAACGTGTAGAGGGTGAAGGG - Intergenic
997506963 5:134425319-134425341 GTGAATCTTCAGAGGGTGAAGGG + Intergenic
998108697 5:139484862-139484884 GCAAGCCTTCAGAGGGCGGAGGG + Intergenic
998402838 5:141856837-141856859 GGAAACCTTGAGAAGGTGGGTGG - Intronic
998942606 5:147300964-147300986 GTGAACCTTCAGAGGGTGAAGGG - Intronic
999825240 5:155267349-155267371 GGGAGCTTTCAGAGGGTGGAGGG - Intergenic
999967215 5:156822176-156822198 GCAAAACTTCAGAGGGCCAAGGG + Intergenic
1000028617 5:157382003-157382025 GCAAACATACAGTGGTTGGAGGG - Intronic
1000614188 5:163409715-163409737 GCAAACCTTCAGAGGGCAAAGGG + Intergenic
1001886328 5:175293642-175293664 GCAAACCTTCAAAGGGTGAAGGG + Intergenic
1002906509 6:1453451-1453473 GTGAAACTTCAGAGGGTGAAGGG + Intergenic
1002907855 6:1465419-1465441 GCAAACCTTCAGAGGATGAAGGG - Intergenic
1005096270 6:22120227-22120249 GCAAACCTTTAAAGGGTGAAGGG - Intergenic
1005162197 6:22876737-22876759 GCGATCTTTCAGAGGGTGAAAGG + Intergenic
1005293013 6:24397630-24397652 GCAAACTTTCAGTGGCTGAAGGG - Intergenic
1005647378 6:27853792-27853814 TCAAACCCTCAGAGGGCAGAGGG + Intronic
1005652605 6:27898266-27898288 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1005670088 6:28096938-28096960 TCAAATCCTCAGAGGGTAGAGGG + Intergenic
1006328881 6:33374974-33374996 GCCAACCTTCAGAGGGCGAAAGG + Intergenic
1006448818 6:34094278-34094300 GGAAACCTACAAAGGGTAGAAGG - Intronic
1006590132 6:35148866-35148888 GCAAACCATGGGATGGTGGAAGG + Intergenic
1007033062 6:38646654-38646676 GCACAGCTTCAGAGGGCAGAGGG - Intergenic
1007976179 6:46103753-46103775 GCAAAACTTCAGAGGGCAAAGGG + Intergenic
1008225861 6:48915576-48915598 GCACACTTTCTGAGGGAGGAGGG + Intergenic
1008613099 6:53202164-53202186 GTGAACCTTCAGAGGGTGAAGGG + Intergenic
1009031965 6:58070076-58070098 GTGAATCTTCAGAGGGTGAAGGG - Intergenic
1009207792 6:60824528-60824550 GTGAATCTTCAGAGGGTGAAGGG - Intergenic
1011424591 6:87212970-87212992 GTGAACCTTCAGAGGATGAAGGG - Intronic
1011992219 6:93536094-93536116 GGGACCTTTCAGAGGGTGGAAGG - Intergenic
1013488298 6:110619000-110619022 GCGAACTTTCAGAGAGTGAAAGG + Intronic
1013825209 6:114203157-114203179 GCAAGCCTTCAGAGGGAAAAGGG - Intronic
1014806681 6:125838054-125838076 GTGAAGCTTCAGAGGGTGAAGGG - Intronic
1015312006 6:131776498-131776520 GTGATCTTTCAGAGGGTGGAGGG - Intergenic
1016105667 6:140159084-140159106 GCACATCTTCAGATGGTGGTAGG + Intergenic
1018043879 6:159949316-159949338 GCGAACATTCAGAGGGTGAGGGG + Intergenic
1019843084 7:3468894-3468916 GCATACCTTCAGAGGGTGAAGGG + Intronic
1020556715 7:9679582-9679604 GGAGCCTTTCAGAGGGTGGAGGG + Intergenic
1020683975 7:11270743-11270765 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1020763928 7:12298113-12298135 GCAAACCTCCAGAGGGCCAAGGG + Intergenic
1020764053 7:12299143-12299165 GTGAAACTTCAGAGGGTGAAGGG - Intergenic
1020785556 7:12569034-12569056 GTGAAACTTCAGAGGGTAGAGGG + Intergenic
1020936597 7:14473290-14473312 CCATAGCTTCAGAGGGTGCAAGG + Intronic
1021201021 7:17728720-17728742 GCAAACCTTCAGAGGACAAAGGG + Intergenic
1021413017 7:20349978-20350000 GCAAATCTTTGGTGGGTGGAAGG - Intronic
1021507054 7:21397468-21397490 GCAAATCTTTAGAGGGCAGAGGG - Intergenic
1021566281 7:22019802-22019824 GGGACCTTTCAGAGGGTGGAGGG + Intergenic
1021585284 7:22201261-22201283 GCAAGAGATCAGAGGGTGGAAGG - Intronic
1022417438 7:30190303-30190325 GCGAACCTTCAGAGGGCGAAGGG + Intergenic
1022552681 7:31256366-31256388 GCAAACCTGCAGAGGGTGAAGGG - Intergenic
1022857627 7:34331169-34331191 GCAAACCTTTCAAAGGTGGATGG - Intergenic
1023168686 7:37368963-37368985 GCAAACCTTCAGGAGATGAAGGG + Intronic
1023953474 7:44866880-44866902 GCGTAGCCTCAGAGGGTGGATGG + Intergenic
1024361564 7:48474127-48474149 GTGAAGCTTCAGAGGGTGAAAGG - Intronic
1024362041 7:48478402-48478424 GCAAACTTACAGAGGATGAAGGG - Intronic
1024714638 7:52062131-52062153 GTGAACCTTCAGAGGGCTGAGGG + Intergenic
1024719939 7:52124988-52125010 GCGAACCTTCAAAGGATGGAGGG - Intergenic
1024865686 7:53903372-53903394 GGAAACTTTCACATGGTGGAAGG + Intergenic
1024945945 7:54807532-54807554 ACAAACCTTGAGATGGAGGAGGG + Intergenic
1025070311 7:55892518-55892540 GCAAACCTTCAGAGGGCAAAGGG - Intronic
1025740524 7:64192367-64192389 GCAAAGGTTCAGCGGGTTGAGGG + Intronic
1026910788 7:74090681-74090703 GAACACCTTCAGAGGGGTGAGGG - Intronic
1027691008 7:81344640-81344662 GAAGCCTTTCAGAGGGTGGAGGG - Intergenic
1029276350 7:99407328-99407350 GTAAAACTTCGGAGGGAGGATGG + Intronic
1029964474 7:104724595-104724617 GGGACCTTTCAGAGGGTGGAGGG + Intronic
1031211763 7:118838051-118838073 GCAAACCTTCAAAGGATGAAGGG - Intergenic
1031417715 7:121512377-121512399 GCAAACCATCAGAGGGTGAAGGG + Intergenic
1031690885 7:124786285-124786307 GCATCTCTTCAGAGGGTGGCAGG - Intronic
1033772856 7:144572882-144572904 GCTATCCATCAGAGAGTGGATGG + Intronic
1033795137 7:144836854-144836876 GGAAACCTTAAGAGGGTAGAGGG - Intergenic
1033798666 7:144876377-144876399 GGGAACCTTCAGAGGGTGAAAGG - Intergenic
1033995287 7:147338163-147338185 GCAACTCTTCACAGAGTGGAAGG + Intronic
1034047619 7:147946799-147946821 GCTAACCTTTAGAGGGTGAAGGG - Intronic
1034097545 7:148424202-148424224 GGGTACCTTTAGAGGGTGGAGGG + Intergenic
1034100953 7:148450010-148450032 GCAAACCTTCAGAGGTTGAAGGG + Intergenic
1034339635 7:150343539-150343561 GCAAACCTTCAGAAGGCAAAGGG + Intergenic
1035790641 8:2301300-2301322 GCACATCTTCACAGGGTGGCAGG + Intergenic
1035802164 8:2420405-2420427 GCACATCTTCACAGGGTGGCAGG - Intergenic
1035810783 8:2489333-2489355 GCTAACCTTCAGAGGGTGAAGGG + Intergenic
1037412927 8:18617112-18617134 GTGAACCTTCAGAGGGTGATGGG + Intronic
1038143374 8:24870768-24870790 TCAAAGCTTCAGAGGGAGCATGG - Intergenic
1038176079 8:25183578-25183600 GAAAACCTTCACAGGCTGCAAGG + Intergenic
1038522840 8:28248019-28248041 ACAAACCTTAAGAAGGGGGAAGG + Intergenic
1038648116 8:29378244-29378266 GCAAATCTTCAGAGGGCAAAGGG - Intergenic
1039029243 8:33291899-33291921 GCAGCCTTTCGGAGGGTGGAGGG - Intergenic
1039146419 8:34451885-34451907 GTAAAAATTGAGAGGGTGGAAGG - Intergenic
1039227767 8:35407692-35407714 GGAGCCTTTCAGAGGGTGGAGGG - Intronic
1040088999 8:43376830-43376852 GCTAACCTTCAGAGGGCTCAAGG - Intergenic
1040577599 8:48667424-48667446 GCACATCTTCACAGGGTGGCAGG + Intergenic
1040853543 8:51925976-51925998 GTGAACCTTCAGAGGTTGAAAGG + Intergenic
1040889606 8:52303198-52303220 CCAAGCCTTCAGAGGGTGCATGG - Intronic
1040996262 8:53405943-53405965 GCAGAACTTCAGTGGGAGGAGGG - Intergenic
1041195541 8:55398116-55398138 GCGCACTTTCAGAGGATGGAAGG + Intronic
1041804808 8:61838462-61838484 GTGAACCTTCAGAGAGTGGAGGG - Intergenic
1042321444 8:67479508-67479530 GCAAAACTTCAGAGGGCAAAGGG + Intronic
1043192822 8:77248274-77248296 GTGAACCTTCAAAGGGTGAATGG - Intergenic
1044074942 8:87808859-87808881 GATATCCTTCAGAGGGTGAATGG + Intergenic
1044233086 8:89801304-89801326 GCAAACCTTCAGAGGGCAAAGGG + Intergenic
1044533989 8:93338984-93339006 CAAAACCTTCAGAGGGAGCATGG - Intergenic
1045252030 8:100490384-100490406 GTGAAACTTCAGAGGGTGAAGGG + Intergenic
1045644046 8:104282912-104282934 GTGAACATTCAGAGGGTGAACGG + Intergenic
1046659122 8:116929523-116929545 GGGAACCTTCAGAAGGTGAACGG + Intergenic
1046945015 8:119966439-119966461 GCAAACCTTCAGAGGGCAAAGGG - Intronic
1049478383 8:142807386-142807408 GCCTAGCTTCCGAGGGTGGATGG - Intergenic
1049626805 8:143627136-143627158 TCAAATGCTCAGAGGGTGGAGGG - Intergenic
1050238098 9:3604390-3604412 GCAAACCTTTAAAGGGTGATTGG - Intergenic
1052087801 9:24289947-24289969 GCAAACCTTCAGAGGGCAGAAGG - Intergenic
1052202368 9:25798756-25798778 GCAAACCTTCAGAAGGCAAAAGG + Intergenic
1052221674 9:26031782-26031804 GTGAACCTTCAGAGGGTCAAGGG - Intergenic
1053097669 9:35342598-35342620 GCACACATCCAGAGGGTGGCTGG - Intronic
1053201100 9:36151972-36151994 GCACCCCTCTAGAGGGTGGAAGG - Intronic
1053537842 9:38943885-38943907 GCAAACATTGAAAAGGTGGATGG - Intergenic
1053611991 9:39723274-39723296 GCAAACCTTCAGAGGGCAAAGGG + Intergenic
1053694059 9:40619109-40619131 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1053870029 9:42481268-42481290 GCAAACCTTCAGAGGGCAAAGGG + Intergenic
1053941049 9:43249528-43249550 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054086263 9:60747882-60747904 GCAAACCTTCAGAGGGCAAAGGG - Intergenic
1054241528 9:62619119-62619141 GCAAACCTTCAGAGGGCAAAGGG - Intergenic
1054270776 9:63021018-63021040 GGTAATCTTCAGAGGGTGAAAGG - Intergenic
1054305304 9:63418333-63418355 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054404051 9:64742322-64742344 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054437672 9:65227822-65227844 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054492731 9:65794145-65794167 GGTAATCTTCAGAGGGTGAAAGG - Intergenic
1054555654 9:66653642-66653664 GCAAACCTTCAGAGGGCGAAGGG - Intergenic
1054628292 9:67420040-67420062 GCAAACATTGAAAAGGTGGATGG + Intergenic
1055444645 9:76370436-76370458 GCAATAATTCAGAGGGTGGGGGG + Intergenic
1055713984 9:79097475-79097497 ACACACTCTCAGAGGGTGGAGGG - Intergenic
1056432585 9:86542698-86542720 GTAAATCTCTAGAGGGTGGATGG + Intergenic
1056597616 9:88020625-88020647 GCAAATCTTCAGAGGGCAAAGGG + Intergenic
1057635087 9:96757162-96757184 GGAAACCTCCAGAGAGGGGAGGG - Exonic
1058295068 9:103295879-103295901 GCAAACCTTCAGAGAGCCAAGGG + Intergenic
1058962802 9:110007695-110007717 GTGAACCTTCACAGGGTGAAAGG - Intronic
1059338486 9:113583842-113583864 GCAGATCTTGACAGGGTGGAAGG - Exonic
1059831375 9:118100157-118100179 GCAAACCTTCAAAGGATGAATGG - Intergenic
1061891968 9:133626791-133626813 GCATATCTTCACAGGGTGGCAGG + Intergenic
1203718775 Un_KI270742v1:182776-182798 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1203653003 Un_KI270751v1:146450-146472 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1185637098 X:1560734-1560756 GCACACCTTCACAAGGTGGCAGG - Intergenic
1185829940 X:3291444-3291466 GCACATCTTCACAGGGTGGGAGG - Intergenic
1185920287 X:4083882-4083904 GCAAACCTTCAGAGCGCCAAGGG - Intergenic
1186039576 X:5461130-5461152 GGGAAACTTCAGAGGGTGAAGGG + Intergenic
1186185356 X:7015115-7015137 GCAAACCTTCAGAGCGTGAAGGG - Intergenic
1186214238 X:7281970-7281992 GAGAAACTTCAGAGGGTGAAGGG - Intronic
1186218122 X:7322008-7322030 GCAAACCTTCAGAGGGCAAAGGG - Intronic
1186232658 X:7472700-7472722 GGAGCCCATCAGAGGGTGGAAGG + Intergenic
1186744821 X:12556777-12556799 GAGAACCTTCAGAGGGTGAAGGG - Intronic
1186785501 X:12953058-12953080 GTAAACCTTCAGAGGGCGAAGGG + Intergenic
1186830254 X:13383072-13383094 GCAAACCTTCAGAGGGCAAAGGG - Intergenic
1187090190 X:16088240-16088262 GAAAACCTTCAGTGGATAGAGGG - Intergenic
1187276105 X:17817750-17817772 GCAAACCATCAAAGGGTACAAGG - Intronic
1187419267 X:19121389-19121411 GCGAACCTTCAGGGGGCGAAGGG + Intronic
1187530563 X:20092720-20092742 GCAAAACTTCAGAGGGCAAAGGG + Intronic
1188245029 X:27829201-27829223 GCAAACATTTCGAGGGTGAATGG + Intergenic
1188480006 X:30627785-30627807 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1188495774 X:30781598-30781620 ACAAACTTTCAGAGGGCGAAGGG + Intergenic
1188727946 X:33607933-33607955 GCAAACCTCCAGAAGGTGAATGG - Intergenic
1188909297 X:35825849-35825871 GGAAACCTCCAAAGGGTGAAGGG + Intergenic
1189001327 X:36950253-36950275 GATATCCTTCAGAAGGTGGATGG - Intergenic
1189587077 X:42473238-42473260 GCAAGCCTTCAGAGGATGAAGGG - Intergenic
1189633427 X:42978640-42978662 CCAAACCCTCAGAGGGTAGAGGG + Intergenic
1189664814 X:43342766-43342788 GTGAACCTTCAGAGGATGAAGGG + Intergenic
1190510543 X:51169782-51169804 GCGAACCTTCCGAGGGCGAAGGG + Intergenic
1191989942 X:67024319-67024341 GGGGACTTTCAGAGGGTGGAAGG - Intergenic
1192231430 X:69267755-69267777 GCAAACCTTCAGAGGGTGAAGGG - Intergenic
1192239368 X:69317157-69317179 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1193316401 X:80070915-80070937 GCACATCTTCACAGGGTGGCAGG + Intergenic
1194093867 X:89611480-89611502 GTGAACCTTCAGAGGGTGAAGGG + Intergenic
1194170852 X:90578945-90578967 GCAAATCTTCAGAGGGTAAAAGG + Intergenic
1194538439 X:95138285-95138307 GCAAACCTTTAGAGGGCAGAGGG - Intergenic
1194757076 X:97749952-97749974 GCAAACTTTCAGAAGGTGAAGGG - Intergenic
1195474829 X:105273829-105273851 GCAAATCTTCAGAGGGCCAAGGG + Intronic
1195608490 X:106836185-106836207 GCACCTCTTCACAGGGTGGAAGG + Intronic
1195910599 X:109885280-109885302 GTGAAACTTCAGAGGGTGAATGG - Intergenic
1196076175 X:111578704-111578726 GCAAACTTTCAGAGGGCAAATGG + Intergenic
1196279367 X:113804760-113804782 GCAAACCTTCAGAGGGTGAAGGG + Intergenic
1196366187 X:114927030-114927052 CCGAAACTTCAGAGGGTGAAGGG - Intergenic
1196895083 X:120328149-120328171 GCAACTCTTCACAGGGTGGCAGG + Intergenic
1198567382 X:137918053-137918075 GTAAACCTTCAGAGGGCAGAAGG + Intergenic
1199070530 X:143470089-143470111 GCATCCCTTCACAGGGTGGCAGG + Intergenic
1199866893 X:151859783-151859805 GGGGACTTTCAGAGGGTGGAGGG + Intergenic
1199900637 X:152168629-152168651 GAGAACCTTCAGAGGCTGCAGGG + Intronic
1200446490 Y:3267613-3267635 GTGAACTTTCAGAGGGTGAAGGG + Intergenic
1200517087 Y:4156683-4156705 GCAAATCTTCAGAGGGTAAAAGG + Intergenic
1201172933 Y:11287612-11287634 TCATACCCTCAGAGGGTAGAGGG - Intergenic
1201191830 Y:11450662-11450684 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1201773977 Y:17644722-17644744 ATGAAACTTCAGAGGGTGGAAGG - Intergenic
1201827580 Y:18261267-18261289 ATGAAACTTCAGAGGGTGGAAGG + Intergenic