ID: 1127213885

View in Genome Browser
Species Human (GRCh38)
Location 15:56803799-56803821
Sequence ATTTTTAAGGAGATTGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 0, 2: 5, 3: 66, 4: 535}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127213885_1127213887 -7 Left 1127213885 15:56803799-56803821 CCTTTCTCAATCTCCTTAAAAAT 0: 1
1: 0
2: 5
3: 66
4: 535
Right 1127213887 15:56803815-56803837 TAAAAATCTCCAAAGTATGTTGG 0: 1
1: 0
2: 3
3: 30
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127213885 Original CRISPR ATTTTTAAGGAGATTGAGAA AGG (reversed) Intronic
901353116 1:8616539-8616561 ATTTTAAAGGAGCTTAAGAAAGG - Intronic
901564235 1:10099379-10099401 CTTTTTAATGAAATTGTGAATGG - Intronic
901589512 1:10328503-10328525 ATTTTTATTAAAATTGAGAAAGG + Intronic
903794157 1:25915793-25915815 TTTTTTAATGAGATGGGGAAAGG + Intergenic
903796275 1:25931179-25931201 CTTTATAAGCAGCTTGAGAATGG + Intergenic
904094199 1:27965137-27965159 ATTTTTAAAGAGGTGCAGAAAGG + Intronic
904448221 1:30592283-30592305 ATTTTGGAAGAGATTGAGGAGGG - Intergenic
905967275 1:42109398-42109420 ATTTTCAGGGAGATTGTAAAAGG + Intergenic
906015581 1:42576018-42576040 AGTTTTAAAGAGATAGACAAGGG + Intronic
906138148 1:43515017-43515039 ATTTTGAAGGAGATTCTCAAGGG - Intergenic
906234553 1:44197324-44197346 ATCTTTAAGAAGATGGAAAATGG - Intergenic
906371000 1:45253789-45253811 TTTCTTAAGTAGATTGACAAAGG + Intronic
906799976 1:48728434-48728456 ATTTATAAAAAGATTGAAAATGG - Intronic
907157409 1:52347108-52347130 TTTTTTATGGAGAAGGAGAAAGG - Intronic
907534256 1:55135153-55135175 ATTTTTAAAAAAATTGAGATGGG + Intronic
908917590 1:69148824-69148846 ATTTTTAAGGACAGTGGAAAGGG - Intergenic
908940242 1:69423619-69423641 ATATTTAAGGATATTCAGTAAGG - Intergenic
909252779 1:73380119-73380141 AAGTTTAAGGACATTGAGTATGG - Intergenic
909281638 1:73762603-73762625 TCTTTTAAAGAGATTGAAAAAGG + Intergenic
909322948 1:74313039-74313061 TTTTTCAATGAAATTGAGAATGG + Intronic
909461857 1:75925787-75925809 AAATTGAAGGAGAATGAGAAGGG - Intronic
909845259 1:80385930-80385952 ATTTTTAATGAAAATGAAAAGGG + Intergenic
910326798 1:86018447-86018469 CTCTTTAAAGAGATAGAGAAAGG + Intronic
910525604 1:88174157-88174179 GTTGTTAATGAGATAGAGAAGGG + Intergenic
911241525 1:95472425-95472447 TTTTATTAGGAGATTCAGAAGGG + Intergenic
912118080 1:106432594-106432616 AGTTTTAAGCAGAGTGAGTAAGG + Intergenic
913502356 1:119482981-119483003 GTGTTTAAGAAGATTGAAAAAGG - Intergenic
913517668 1:119618241-119618263 GTTTTTAAGGAGGTTGAAAAAGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
913675180 1:121133490-121133512 ATTTTTAATAAAATGGAGAATGG - Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914027018 1:143921110-143921132 ATTTTTAATAAAATGGAGAATGG - Intergenic
914249033 1:145906891-145906913 ATTTTGGAGGAGAATGAGCAGGG + Intronic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914690522 1:150021984-150022006 ATGATTAAGGAGAGAGAGAAAGG - Intergenic
914773810 1:150717521-150717543 ATTTTTAAAAAAATTGAGACAGG + Intronic
915162400 1:153929742-153929764 GTTCTTATGGAGAGTGAGAAAGG - Exonic
915638452 1:157202980-157203002 ATTTTTAAGGAGCTTGAGGAAGG + Intergenic
917186603 1:172363608-172363630 TTATTTAAGGAGAGTGAGACTGG - Intronic
917939280 1:179901981-179902003 AATTTTAAGGAGGTGGTGAAGGG - Intronic
917954361 1:180077820-180077842 TTTTTTAATGAGCTTGACAAAGG - Intronic
918386991 1:184019031-184019053 ATTTTTAGGGACCATGAGAAAGG - Intronic
918788138 1:188791055-188791077 ATTTTTAAGCAAATTAACAAAGG + Intergenic
920418100 1:205812341-205812363 GTGTTTAAGGAGATTGGAAAAGG - Intronic
920462542 1:206152328-206152350 ATTTTTAATAAAATGGAGAATGG - Intergenic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
921983318 1:221282503-221282525 GTTTTTAAGCAGATTGGGAGAGG - Intergenic
922019185 1:221686343-221686365 ATATATAAGGAGACTGAGTAAGG - Intergenic
923373869 1:233340492-233340514 ATTTAGAATGAGATTGAGAAGGG + Intronic
1063203546 10:3808476-3808498 ATTTTTAAAAAGATTCTGAATGG - Intergenic
1063303356 10:4873937-4873959 ATGTTAAAGTAGATAGAGAAAGG + Intergenic
1064823772 10:19371385-19371407 ATCTCTTAGGATATTGAGAATGG - Intronic
1065147687 10:22787754-22787776 ATATAAAAAGAGATTGAGAATGG - Intergenic
1066720085 10:38328666-38328688 ATTTTTATGCAGTTAGAGAAAGG - Intergenic
1066791389 10:39068277-39068299 ATTTTTAAAGAATCTGAGAAGGG + Intergenic
1068946674 10:62736427-62736449 ATTTCCAAGGAGAGAGAGAATGG + Intergenic
1069099071 10:64295693-64295715 ATTTTGAAAGAGGTTGAGTAGGG - Intergenic
1069211501 10:65766778-65766800 ATTTTAAAAGAGAGTTAGAAGGG - Intergenic
1069601480 10:69710955-69710977 ATTTTTCAGGAGATTCAAAGAGG - Intergenic
1070852604 10:79579476-79579498 ATTTTTAAAGTGATTGTAAATGG - Intergenic
1070942827 10:80361642-80361664 ATATATAAGTAGATTAAGAAGGG - Intronic
1072755827 10:98020088-98020110 ATTGTTCAGGTGAGTGAGAAAGG - Intronic
1072868592 10:99091528-99091550 ATTTTTAAGAAAACAGAGAATGG - Intronic
1073512897 10:104053469-104053491 ATTTTTAAGGAGCATCAGGAAGG - Intronic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1075945414 10:126428734-126428756 ATTTTTCAGTAAATTGAAAAGGG + Intronic
1076001213 10:126914567-126914589 TTTTTTAAGGAGATTGGGAGAGG + Intronic
1076394195 10:130126662-130126684 ATTTTAGAGGAGAGAGAGAATGG + Intergenic
1077572899 11:3354820-3354842 ATTAGTAAGGAAATTCAGAAGGG + Intronic
1077820629 11:5736401-5736423 ATTTCTAAAGAGATGAAGAAAGG + Intronic
1077965146 11:7122647-7122669 ACTTTTACTGAGATTCAGAACGG + Intergenic
1078785562 11:14488275-14488297 ATCTTTATGGAGGTTTAGAAAGG + Intronic
1079157112 11:17958381-17958403 ATTTTTTAGAAGAATGAGGATGG - Intronic
1080239309 11:30108330-30108352 ATGGTTAAGTAGATTGTGAAAGG - Intergenic
1080892794 11:36423996-36424018 ATTGCTAAGGAGATTAAGAATGG - Intronic
1080940835 11:36915976-36915998 ATTTTTAAGGAACTTCAGCAAGG - Intergenic
1081584522 11:44375384-44375406 ATTTATAAGGGAAATGAGAAAGG + Intergenic
1082115072 11:48319347-48319369 AATTTTGAAGAAATTGAGAAAGG + Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082309781 11:50632513-50632535 GTTTTTAAGGAGAAAAAGAAAGG + Intergenic
1082779825 11:57278411-57278433 ATTTTTAAGGATCTTTAGAAAGG - Intergenic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084893508 11:72249371-72249393 ATTTTTAAAAAGAGGGAGAAGGG - Intergenic
1084993456 11:72951785-72951807 ATTTATAAAGAGATTGTGAAAGG - Intronic
1086510056 11:87546972-87546994 ATTTTTAAGTAGATTCTGCAAGG - Intergenic
1086588385 11:88482624-88482646 ATGTTTAGGCAGATTGAGGAGGG + Intergenic
1086642096 11:89171744-89171766 ATATCTTAGGAGATGGAGAATGG - Intergenic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087450258 11:98311745-98311767 AGATTTAAAGAGATTGAGAAGGG - Intergenic
1087735992 11:101834637-101834659 ATTTTTAAAGATTTTTAGAATGG - Intronic
1087954307 11:104265907-104265929 ATTTTTAAGGCAATTATGAATGG - Intergenic
1088182983 11:107133106-107133128 ATTTTTAAGGTGGGTGAGGAGGG + Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1089686721 11:120154369-120154391 ATTGTTAAGGATTTTGAGATGGG - Intronic
1089813004 11:121147134-121147156 ATGGTTAATGAGATTGAGACAGG - Intronic
1090609938 11:128462117-128462139 AATTTTCAGGAGAGGGAGAAGGG - Exonic
1090742562 11:129678379-129678401 TTTTTTATGGCTATTGAGAAAGG - Intergenic
1091144969 11:133271200-133271222 ATTTTTATAGAGATTAAAAAGGG + Intronic
1091250292 11:134138599-134138621 ATTTTGAAGGAGAAGTAGAAGGG + Intronic
1091700634 12:2658283-2658305 ATTTTTAAGTAGATTTTGGAGGG - Intronic
1092382331 12:8007013-8007035 AATTTTATGGAGGTTGAGAGAGG + Intergenic
1092515625 12:9208642-9208664 ATTTTGAAAGAGATGGAGAAAGG - Intergenic
1093611901 12:21171113-21171135 AATTTTAAAGAGATTGATCAAGG + Intronic
1094105736 12:26809587-26809609 ATTATAAAAGAGAGTGAGAAAGG - Intronic
1094376636 12:29797265-29797287 AATGTTAAGCAGATTGAAAAAGG - Intergenic
1095374441 12:41509270-41509292 ATTATGAGGGAGAGTGAGAAAGG + Intronic
1095423617 12:42051119-42051141 ATTTTTAAGCACATTGAGTCTGG - Intergenic
1095550745 12:43436018-43436040 ATTTCAAAAGATATTGAGAAAGG - Intronic
1095646170 12:44550430-44550452 ATTTTTCAGGAGACTGAGGCAGG + Intronic
1095684429 12:45016468-45016490 ATATTGAAGGACATGGAGAAGGG + Exonic
1097518649 12:60640985-60641007 ATTTTTAAGGAGATAAAAAGGGG - Intergenic
1097698877 12:62800686-62800708 ATATTTAAGGATATTTATAAGGG - Intronic
1098427889 12:70386606-70386628 TTTTTTAAGGAGATGGGGAAAGG + Intronic
1098577409 12:72058909-72058931 TTTTTTAATAGGATTGAGAATGG - Intronic
1099555384 12:84103274-84103296 ATTTGTAAGGAGAAAAAGAAAGG + Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099754310 12:86823655-86823677 ATTTTTAAAGAGAGTTAAAAGGG + Intronic
1100167916 12:91939237-91939259 ATTTGCAAGTAGATTGAGTACGG - Intergenic
1100459768 12:94787888-94787910 ATTTCCAAGGAAAGTGAGAAAGG - Intergenic
1100731245 12:97472218-97472240 ATTTTAAAAAATATTGAGAATGG + Intergenic
1101517255 12:105448257-105448279 ATTTTCAAGGTGAGTGATAATGG - Intergenic
1101618539 12:106361384-106361406 ATATTCATTGAGATTGAGAATGG + Intronic
1101711207 12:107268469-107268491 ATTTTGAACAAGATTGAAAAAGG + Intergenic
1102089030 12:110170826-110170848 ATTTATAAGCAGCTTTAGAAAGG + Intronic
1102803483 12:115758642-115758664 TTTTTTGAAGAGATTTAGAAAGG + Intergenic
1102844417 12:116163662-116163684 ATTTTTAAGTGTATTGAAAAGGG + Intronic
1103365771 12:120382057-120382079 AATTTTAAAAAGGTTGAGAAAGG + Intergenic
1103668451 12:122591643-122591665 ATTTTTAAGGAAATTAAAAGGGG + Intronic
1105410795 13:20169605-20169627 TATTTTAAGGAGCTGGAGAAGGG - Intergenic
1105483773 13:20805396-20805418 ATTTTTTAGGAGATGGAGTTAGG - Intronic
1107194537 13:37633331-37633353 AGTTTTAAGGACACTGAGCATGG + Intergenic
1108276272 13:48813012-48813034 ATTGGTGAGGAGATGGAGAAAGG - Intergenic
1108766240 13:53633243-53633265 ATTTTTAGGCAGATTGGGAAAGG + Intergenic
1109752880 13:66719419-66719441 ATTATGAAAGAGATTGAGGAGGG + Intronic
1109980863 13:69904386-69904408 ATTTATAAAGATATTGAGGAGGG - Intronic
1110124785 13:71929237-71929259 ATTTTCCTGGAGAATGAGAAAGG + Intergenic
1110893202 13:80715873-80715895 ATTATGAAAGAAATTGAGAAGGG - Intergenic
1110907355 13:80908756-80908778 CTTTTTCAGAAGATGGAGAAAGG + Intergenic
1111289252 13:86142351-86142373 AGTGTTAAGGAAATTGTGAAAGG + Intergenic
1112390214 13:98976483-98976505 ATTTTTAAGAATATTCACAAGGG + Intronic
1112544604 13:100354011-100354033 ATTCTTTGGGAGATTGAGACTGG + Intronic
1112675528 13:101696830-101696852 ACAATTAAGGAGAATGAGAAAGG + Intronic
1113718961 13:112537665-112537687 TTTTTTAAGGAATCTGAGAAGGG + Intronic
1114369991 14:22076255-22076277 ATTATTAAGGATCTTGAGATGGG - Intergenic
1114986625 14:28238078-28238100 CTTTTTAAGCAGCATGAGAATGG + Intergenic
1116064671 14:39968169-39968191 ATTTTTAAAGAGTTAAAGAAAGG - Intergenic
1116083539 14:40205399-40205421 ATTTTTGTGGAGATTTGGAAAGG + Intergenic
1116105605 14:40499913-40499935 ATTTTTAAGGTAATTCAGTAAGG - Intergenic
1116614952 14:47123586-47123608 ATTTTTTATGAAATTGATAATGG - Intronic
1116679496 14:47947477-47947499 ATTTTTGAGGATATTGGAAATGG + Intergenic
1117236846 14:53786951-53786973 ATGTTTAAGGAGAAAGAAAAAGG - Intergenic
1118329286 14:64803160-64803182 ATTTGTAAGGAAATTTAGAAAGG - Intronic
1118435960 14:65771087-65771109 CTTTTCAAGGAGGTAGAGAAAGG - Intergenic
1118587436 14:67367935-67367957 ATTTTTAAAGAAACTAAGAAGGG - Intronic
1119794779 14:77386025-77386047 TTTTTTGAGGAGATAGAGATGGG + Intronic
1119914629 14:78386264-78386286 ATTTAAAAGGAGATAGATAAAGG + Intronic
1119983637 14:79111109-79111131 GTTTTTTGGGAAATTGAGAATGG + Intronic
1120557827 14:85951570-85951592 ATTATTATGCAGATTGATAAAGG + Intergenic
1120631294 14:86894587-86894609 ATTTTTAAGGAGATGGCCAAAGG - Intergenic
1121770204 14:96528171-96528193 ATTTTTAAAAAGATTTAAAATGG - Intronic
1122457626 14:101866781-101866803 ATTTTTAAAAAAATTCAGAATGG + Intronic
1123959594 15:25383003-25383025 TTTTTCAAAGAGTTTGAGAAGGG - Intronic
1124438155 15:29667971-29667993 AGTTTTAAGGAGAATGGGTAGGG - Intergenic
1124602544 15:31147312-31147334 ATGTTTATGGAAATTCAGAACGG - Intronic
1124813404 15:32964662-32964684 ATTCTGAAGGAGACTGAAAATGG + Intronic
1125302145 15:38266702-38266724 ATTTTTAAAGAGAAGGAGAGTGG + Intronic
1125995609 15:44157041-44157063 ATTTTTAATGACAGAGAGAAAGG - Intronic
1126128498 15:45317570-45317592 ATTTTTTAGGAGATTGTCATGGG - Intergenic
1127213885 15:56803799-56803821 ATTTTTAAGGAGATTGAGAAAGG - Intronic
1127690557 15:61391917-61391939 ATTTTTGATGAGATGGAGAAGGG - Intergenic
1127708502 15:61571178-61571200 ACTTTTGAGGAGGTTTAGAAAGG + Intergenic
1127960674 15:63888056-63888078 AGTTTTAAGCAGACTGAGAAGGG - Intergenic
1128050306 15:64658176-64658198 ATTTTTAAGGTAAATGAAAAGGG - Intronic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1128994101 15:72284290-72284312 TTTCTGAAGGAGATTAAGAAGGG - Intronic
1130414655 15:83681511-83681533 ATCTTTAAGGTGATCAAGAATGG + Intronic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1130743834 15:86629215-86629237 ATTTTTAAGAAGATAAAGATTGG + Intronic
1130921173 15:88345945-88345967 ATTTTTAGAGAGTTTGAGCAAGG - Intergenic
1131917378 15:97283585-97283607 TATTTTAAGCAGATAGAGAAAGG - Intergenic
1131938332 15:97532814-97532836 ATCCTTAAAGAGATTGAGGAAGG + Intergenic
1132353448 15:101154720-101154742 AGTTTTAAAGAAAATGAGAAGGG - Intergenic
1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG + Intergenic
1134584334 16:15397160-15397182 TTTTATAAGGTGATGGAGAAAGG + Intronic
1135217643 16:20586675-20586697 ATTTTCCTGGAGATTGAGGAGGG - Intergenic
1135392167 16:22103003-22103025 AGGTATAAGGAGATTGTGAAAGG - Intronic
1135749288 16:25044141-25044163 TTTTACAAGGAGAATGAGAAAGG + Intergenic
1137999862 16:53265982-53266004 TTTTTTAAGGAAACTGGGAAGGG + Intronic
1138767810 16:59624934-59624956 GTTTGTAAGGAGAAAGAGAAAGG + Intergenic
1138911215 16:61401418-61401440 ATTGCTTAGGATATTGAGAATGG - Intergenic
1139049298 16:63103594-63103616 ATTTTTAAACTGATTCAGAAGGG - Intergenic
1139828032 16:69772990-69773012 ATTTTGATGGAGTTTGAGAAGGG + Intronic
1140233443 16:73137459-73137481 CCTTCTAAGGAGATTAAGAACGG + Intronic
1140596075 16:76414434-76414456 ATTTTTAAGGAGTTTTGGATTGG + Intronic
1140951275 16:79820209-79820231 TTTTTTAAGGACATTAGGAAAGG + Intergenic
1141081016 16:81052543-81052565 ATTTTTAAAAAGAAAGAGAAGGG + Intergenic
1142579101 17:929788-929810 TTTTTTAAGAAGATTAAAAACGG - Intronic
1144177278 17:12719337-12719359 ATTTTTAAGGAGTTTGATACAGG - Intronic
1146122354 17:30207000-30207022 ACATTTAAGGAGATTGAGGCTGG - Intronic
1146351560 17:32099418-32099440 ATTTTTAAGCAAATGGAGAATGG - Intergenic
1149584396 17:57775745-57775767 ATATTTAAAAAGATAGAGAAGGG - Intergenic
1149652843 17:58287909-58287931 ATTTTTAAAAAGAATGAGGAAGG - Intergenic
1150751609 17:67868708-67868730 ATTTTTAAGCAAATGGAGAATGG - Intronic
1150946825 17:69756152-69756174 ATATCTAAGAAGATTGAGCATGG - Intergenic
1150971254 17:70030683-70030705 CTTTTTAAGGAGAATGGAAAGGG - Intergenic
1150985379 17:70190724-70190746 ATTTTTAAGGAACTTGGGGAAGG - Intergenic
1151180934 17:72327747-72327769 ATTTTCAAGGACATTTAAAATGG + Intergenic
1151787345 17:76281494-76281516 CTTTCTAGGGAAATTGAGAAGGG + Intronic
1153059724 18:982665-982687 AGTTTTAAGGAGAATGAAAAAGG - Intergenic
1153205119 18:2690901-2690923 ATTTTTCAAAAGAATGAGAAGGG + Intronic
1154331820 18:13436112-13436134 ATTATGAAGGAGATAAAGAAGGG + Intronic
1155258155 18:24015733-24015755 ATTTTTAAAAAGTATGAGAATGG + Intronic
1155435609 18:25809645-25809667 ATTTTTGAGTAGAGTTAGAAGGG - Intergenic
1155565083 18:27125551-27125573 ATTCTTAAAAAAATTGAGAAGGG - Intronic
1156675133 18:39518878-39518900 ATCTTTAAGCATATAGAGAAGGG + Intergenic
1156839113 18:41590460-41590482 ATGTTTAAGGAGCTTGGTAATGG + Intergenic
1156980135 18:43277113-43277135 ATTTAAAAGGAAAATGAGAATGG - Intronic
1157652294 18:49345972-49345994 CTTTTGAAGAAGAGTGAGAAAGG + Intronic
1158494201 18:57938956-57938978 ATTTTTAATGCTATTCAGAATGG - Intergenic
1158776797 18:60592821-60592843 ATTGCTAAGGAACTTGAGAATGG - Intergenic
1158998791 18:62951710-62951732 AGTTTTACTCAGATTGAGAAGGG - Intronic
1159394178 18:67834726-67834748 ATTTCAAAGGATATAGAGAAAGG - Intergenic
1159646909 18:70929963-70929985 ATTTAGGAGGAGATGGAGAAAGG - Intergenic
1159924262 18:74253071-74253093 TTTTTCAAGGAAATTAAGAAAGG - Exonic
1164330194 19:24247017-24247039 ATTTTTAAGGAGAAAAAGAAAGG - Intergenic
1164393215 19:27843401-27843423 ATTAGTAAGGAAATTGAGAAGGG + Intergenic
1164874434 19:31673606-31673628 ATATTTCAGGAGGTGGAGAAGGG - Intergenic
1165670662 19:37676029-37676051 ATTTTTAAGGAGCTAGATGATGG - Intronic
1165978631 19:39700178-39700200 CTTTTTATGGAAATTGTGAATGG - Intergenic
925075395 2:1012618-1012640 ATTTATAAGGACAGAGAGAAGGG + Intronic
925075415 2:1012729-1012751 ATTTATAAGGACAGAGAGAAGGG + Intronic
925075736 2:1014357-1014379 ATTTATAAGGACAGAGAGAAGGG + Intronic
925075755 2:1014468-1014490 ATTTATAAGGACAGAGAGAAGGG + Intronic
925075784 2:1014616-1014638 ATTTATAAGGACAGAGAGAAGGG + Intronic
925823637 2:7824985-7825007 AGATTTAAGGACATTTAGAAAGG - Intergenic
926578687 2:14611017-14611039 ATTGTAAAGGATATTAAGAAGGG - Intergenic
927334849 2:21909891-21909913 ATTTTTAATGAGAGTGTGAATGG + Intergenic
927339336 2:21964208-21964230 ATTTTTAAGGATTTTGACATAGG - Intergenic
927900066 2:26812635-26812657 ATTATTTAGGAGAATGGGAATGG - Intergenic
928600972 2:32903343-32903365 ATTTTCAACGGGATAGAGAAAGG + Intergenic
929234360 2:39590720-39590742 ATTTTAAGGGAGAAAGAGAAAGG + Intergenic
929707668 2:44232063-44232085 ATTTTTAAGTGCTTTGAGAAAGG + Intronic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
929890633 2:45916084-45916106 AACTCTAAGGACATTGAGAAGGG + Intronic
930039544 2:47109645-47109667 ATATTTGAGGAGGTTGAGACTGG + Intronic
930206257 2:48589056-48589078 ATTATTAAGGGGAATGAGAGTGG + Intronic
930306470 2:49680692-49680714 GTTTATAAGGAAATTGAGAAGGG - Intergenic
930343258 2:50144503-50144525 ATTTTTTAGGAGATTGAGTTGGG - Intronic
931487542 2:62707600-62707622 AATTTTAAGGAGACAAAGAATGG + Intronic
931654473 2:64498444-64498466 ATTTTCAAGGAGCTAGAGAATGG + Intergenic
932398626 2:71464917-71464939 ATTTTGAAGGAGAGTGGGAGGGG + Intronic
932450946 2:71810524-71810546 ATTTTTAGGGAGTTGGGGAAAGG + Intergenic
932549432 2:72752891-72752913 TTATTGAAGGAGACTGAGAATGG - Intronic
932786537 2:74609693-74609715 ATTGGTGAGGAGATGGAGAAGGG - Intronic
933472389 2:82742404-82742426 ATTTTTAACTAGATTGAAAATGG + Intergenic
933698988 2:85241002-85241024 GTTTTTAAGGAAATGGAGAAAGG + Intronic
933867264 2:86532200-86532222 ATTTTTGATGCTATTGAGAATGG + Intronic
933971289 2:87471757-87471779 ATTTTAAAGGAGATTAATTATGG - Intergenic
934061743 2:88301016-88301038 ATTCTTAATGACATTTAGAATGG - Intergenic
934910634 2:98251225-98251247 ATTTTTATGGATATTGGAAAGGG - Intronic
934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG + Intronic
935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG + Intergenic
935498494 2:103809812-103809834 TTCTTTAAGGAGTGTGAGAATGG + Intergenic
936322439 2:111478431-111478453 ATTTTAAAGGAGATTAATTATGG + Intergenic
937458674 2:122066703-122066725 ATTTCTACTCAGATTGAGAATGG - Intergenic
937556426 2:123163615-123163637 ATTATTAAGCAGATTCTGAAGGG - Intergenic
937623524 2:124017516-124017538 ATTTTTAAGGGAAGTGAGATGGG + Intergenic
937643653 2:124242015-124242037 ATTTTGATGGAGGTGGAGAATGG + Intronic
937695897 2:124808290-124808312 ATTTTGAAGGAGTTTAAGAAGGG - Intronic
938702506 2:133892350-133892372 TTCTTCAAGGAGATGGAGAAGGG - Intergenic
938726344 2:134111928-134111950 ACTTTTGGGGATATTGAGAAGGG + Intergenic
939434802 2:142161591-142161613 CTTTTTATGGAAATTGTGAATGG - Intergenic
939833988 2:147105713-147105735 ATTTTTAAAAAGAGAGAGAAAGG - Intergenic
940375826 2:152957517-152957539 AGTTTTAAGAAGAGAGAGAATGG - Intergenic
940648968 2:156421796-156421818 ATTCTTAAGGAAAATCAGAAGGG - Intergenic
941318699 2:164027674-164027696 ATTTTTAAAGTGAATGTGAAAGG + Intergenic
941356377 2:164498031-164498053 ATTTTTAATGAGTTTTATAATGG + Intronic
941410903 2:165156113-165156135 ATATTTACGGACATTTAGAATGG + Intronic
941502693 2:166299642-166299664 ATTTTTAAGTAGATAGAGAATGG - Intronic
942883904 2:180898947-180898969 ATTTTTAAAGAGTTTGACAAGGG - Intergenic
942996231 2:182263771-182263793 AGTTGTAAGGAGATTAGGAAAGG - Intronic
944194379 2:197036992-197037014 GTTTTTAATGACATTGGGAAAGG + Intronic
944261100 2:197678070-197678092 ATTTTTAAGGTGATAAAGAAAGG + Intergenic
944295683 2:198059729-198059751 ATTTCTCAGGAAATTGGGAAAGG + Intronic
946503074 2:220270404-220270426 ATTTTTAAAGAGATTAATCATGG - Intergenic
947066451 2:226231534-226231556 ATTCTAAATGAGATTTAGAAGGG + Intergenic
947420466 2:229937777-229937799 TTTTTTAAGCAGACTCAGAAGGG + Intronic
947654526 2:231815106-231815128 ATTTTTAATGACATCTAGAATGG + Intergenic
1168946935 20:1768873-1768895 ATTTTGAAGGAGCTTGAGCCAGG + Intergenic
1168982984 20:2023875-2023897 ATGTTTAAGAAGACTGAGCATGG - Intergenic
1169105117 20:2987923-2987945 TTTTTAAAGGCGATTTAGAAAGG + Intronic
1169934194 20:10865359-10865381 ATTTTTAATGATCTTCAGAAAGG - Intergenic
1169963267 20:11186972-11186994 ATTTTTAAAGAGTTGGAGGAAGG - Intergenic
1170236720 20:14114591-14114613 TTTTATAAGAAGATTGAGGAAGG + Intronic
1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG + Intergenic
1171037051 20:21722605-21722627 ATTTTTATGGCCATTGAGAGAGG + Intergenic
1171354061 20:24530103-24530125 ATTTTTAAGGATAATGTGGAGGG - Intronic
1174701522 20:52614031-52614053 ATTTATAACCAGATTGAAAAAGG - Intergenic
1176104416 20:63379160-63379182 ATTTTTGAGCAGATGAAGAAAGG - Intergenic
1176944469 21:14962262-14962284 ATTTTAAAGAACAGTGAGAAAGG - Exonic
1177382083 21:20357728-20357750 ATTTTTAAGAAGTTTAATAAAGG - Intergenic
1177394329 21:20513012-20513034 ATTTTTAAAGGCATTAAGAAAGG - Intergenic
1178017237 21:28362316-28362338 TTTTTTAAAGAGTCTGAGAAAGG + Intergenic
1179051701 21:37893775-37893797 TATTTTAAAAAGATTGAGAAAGG + Intronic
1179455433 21:41496598-41496620 ATTTTTAAGTAGGCTGAGGAAGG - Intronic
1181867710 22:25872365-25872387 ATGTTGACGGACATTGAGAATGG + Intronic
1182181414 22:28352867-28352889 ATGTTGAAGGAGATAAAGAAAGG + Intronic
1183593868 22:38797933-38797955 ATTTAGAAGGACATTGACAATGG - Intergenic
949112276 3:276367-276389 ATTTTTGAGGAGTTGGAGATAGG + Intronic
949120642 3:379609-379631 TTTTGTAAGGAAATTGAGAAGGG - Intronic
949388637 3:3534921-3534943 TTATTTAAGGAGAATGAGGAAGG - Intergenic
949739673 3:7216627-7216649 ATTTTTAGGGAGAGTGAGGGTGG - Intronic
952226569 3:31382622-31382644 AATATTGAGGAAATTGAGAAAGG - Intergenic
952486221 3:33813501-33813523 ATATTTAATGAGATTCAGGAAGG + Intronic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
952603263 3:35110569-35110591 AACTTTAAGTAGATTGTGAAAGG - Intergenic
952647960 3:35684960-35684982 TTTTTAATGGAGATTGAAAAGGG + Intronic
953107765 3:39901976-39901998 AGTTTTAAGCTGAGTGAGAAAGG + Intronic
953633562 3:44642017-44642039 ATTTTGAAGAAGAGTGTGAATGG + Exonic
953738485 3:45516326-45516348 ACTTTGAAGGAGTTTGAGGAAGG + Intronic
955517880 3:59746121-59746143 ATAGTCAAGGTGATTGAGAAAGG - Intergenic
955674188 3:61433382-61433404 GTTTTTAAGGTGATAGAGCAAGG + Intergenic
956175935 3:66473058-66473080 TTTTTTAAAGAGACTGAGAAGGG + Intronic
956719640 3:72106526-72106548 ATTTGAAAGAAGACTGAGAAGGG - Intergenic
957202609 3:77156168-77156190 ATTTGAAAGGAGAAGGAGAATGG - Intronic
957236330 3:77597092-77597114 ATGTTAAATGAGATGGAGAAGGG - Intronic
958121428 3:89294567-89294589 AATTTTCATGAGCTTGAGAAAGG - Intronic
958267894 3:91461099-91461121 ATTCTTAATGACATTTAGAATGG - Intergenic
958704420 3:97635940-97635962 ATTTTTCAGAAAAGTGAGAAGGG + Intronic
958801033 3:98756116-98756138 ATTTTTAAGGAGACTGAGCTGGG + Intronic
959086983 3:101861953-101861975 ATTTAAAAAGAGATTCAGAAGGG + Intergenic
960140750 3:114149748-114149770 ATTTTTTAGGAGATGGCAAAAGG + Intronic
960337269 3:116433982-116434004 ATTTTTTTGGAAAATGAGAAGGG - Intronic
961786625 3:129351246-129351268 ACTTTTAAGGACTCTGAGAAAGG - Intergenic
962160426 3:132993482-132993504 ATTTTGAAAGAGATAGCGAAGGG + Intergenic
962181838 3:133214336-133214358 ATTTGTGAGGAGATTGAGAAAGG - Intronic
962326394 3:134436876-134436898 TTTTTTAATGGTATTGAGAATGG + Intergenic
962426847 3:135277821-135277843 ATTTTAAAGGAGGTTGAATATGG - Intergenic
963217195 3:142761622-142761644 ATTTTTGAAGAGTTTGAGTAAGG + Intronic
963511018 3:146249837-146249859 ATTTTTAAGAAGATATAAAAAGG - Intronic
963974762 3:151468322-151468344 ATTTAAAATGAGAATGAGAAAGG - Intergenic
963986777 3:151605336-151605358 TTTCTTAAGGAGTTTTAGAAGGG + Intergenic
964795457 3:160491880-160491902 ATTTGTGAGGAGAAAGAGAATGG - Intergenic
965083314 3:164063879-164063901 ATTTATTAGGAGCATGAGAATGG + Intergenic
965794196 3:172421741-172421763 ATTTTGAAGGAAAATGTGAAAGG - Intergenic
966104184 3:176315308-176315330 ATTATTAATGTGATTGATAATGG - Intergenic
967347808 3:188477963-188477985 ATTTTGATGCAGATTGAGGATGG + Intronic
969985895 4:11210270-11210292 ATTTTTATGTAGGTTGACAAAGG - Intergenic
970610200 4:17718192-17718214 ATTTTTTAAGAGCTTAAGAAGGG - Intronic
970636387 4:18014117-18014139 ATTTTAAAGGCGACTGAGGATGG + Intronic
971803326 4:31320777-31320799 ATTTTTAAAGTCATTGACAATGG - Intergenic
971978957 4:33729717-33729739 ATTTTGAAGAAGAAAGAGAACGG + Intergenic
972146561 4:36034393-36034415 ATTTTTGTGGATATTGTGAATGG + Intronic
972442236 4:39106027-39106049 ATTCTGAATGAGATGGAGAACGG - Intronic
973769711 4:54195343-54195365 ATTTTTAGGTAAATTGAGCATGG - Intronic
974312418 4:60230118-60230140 ATTTATAAGCAGCGTGAGAACGG - Intergenic
974616790 4:64296549-64296571 ATTTTTGAAGACATTAAGAAAGG + Intronic
974843058 4:67320318-67320340 AATTTTAAAGACATTGAAAAGGG - Intergenic
975065505 4:70057948-70057970 ATTTTCAAGGAAATAGAAAATGG + Intronic
975323093 4:73030543-73030565 GTTCTTAATGACATTGAGAATGG - Intergenic
975383471 4:73728824-73728846 ATTTTTAAAAAGATGGAGAGGGG - Intergenic
975453185 4:74554267-74554289 ATTTTTAAGCAAATTAAGAATGG + Intergenic
975480518 4:74874767-74874789 ATTTTTAAAGATTTTGATAAGGG + Intergenic
976625580 4:87177851-87177873 AGTTTTATGGAGATTGAGGTGGG - Intronic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
977322319 4:95532984-95533006 AGGTTTGAGGAGAGTGAGAAAGG + Intronic
977758657 4:100704248-100704270 ATGTTAAAGGAGTTTAAGAATGG + Intronic
977901282 4:102425046-102425068 ATTTTCAAAAAGATTGAAAATGG - Intronic
978045084 4:104115476-104115498 CTTTATTAGCAGATTGAGAATGG - Intergenic
978292879 4:107166628-107166650 ACTTCTAATGAGATTGACAAGGG - Intronic
978320328 4:107486361-107486383 ATTTTTGAGGTGAATGAAAATGG + Intergenic
978324275 4:107534266-107534288 ATCATTAAGGAGATTAAGTAAGG + Intergenic
978702632 4:111667107-111667129 ATTTTGAAGTATTTTGAGAATGG + Intergenic
979006690 4:115307830-115307852 ATTTTTAAGGTGATGGAGGATGG - Intergenic
979717398 4:123857382-123857404 ATTTTTAACCAGATTGCAAATGG - Intergenic
979833596 4:125332177-125332199 CTTGTTGAGGAAATTGAGAAAGG - Intronic
979966702 4:127084972-127084994 ATTTTCAAGGAGGTAGAGAAGGG + Intergenic
980334530 4:131454125-131454147 ATTTCAAAAGAGATTGATAAAGG - Intergenic
980805864 4:137812519-137812541 ATGTTTTAGGAGTTTGAAAAAGG + Intergenic
981895925 4:149799263-149799285 ATTAATAAGGAAATTGAAAAAGG + Intergenic
983031233 4:162804442-162804464 ATTTTTAATTAGATTTAGAAAGG - Intergenic
983199189 4:164842693-164842715 AAAATTAAGGAAATTGAGAAAGG + Intergenic
983477023 4:168225884-168225906 ATTTTTAAGGGTAATGAGTAAGG - Intronic
983963335 4:173780546-173780568 ATTTTTAATGACATCTAGAATGG - Intergenic
984738132 4:183130600-183130622 TTTTTTAAAGAGGTTTAGAAAGG + Intronic
987201980 5:15586370-15586392 ATTGAGAAAGAGATTGAGAAAGG - Intronic
987934995 5:24451936-24451958 ATTCTTAAGGAAATTGAAACAGG + Intergenic
988266315 5:28955049-28955071 ATTTTTAAGGAAAATTGGAATGG + Intergenic
988654948 5:33200499-33200521 ATATTGAAGGAGATGGGGAAAGG - Intergenic
989548533 5:42703794-42703816 ATTTTTATAGATATTGTGAAAGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989649993 5:43677227-43677249 ATTTTCAAGGAGAATGTGAGGGG + Intronic
990053214 5:51534129-51534151 ATTTTGGATGAGGTTGAGAAGGG + Intergenic
990506616 5:56451616-56451638 GCTGTTTAGGAGATTGAGAAAGG + Intergenic
990565743 5:57026771-57026793 AGTTTTGAAGAGATTGAAAATGG + Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
991194495 5:63916764-63916786 CTTTTTCAGGAGAATGAAAATGG + Intergenic
991523054 5:67522318-67522340 TTTTTTAAGGAGATAGATATGGG + Intergenic
991644092 5:68783531-68783553 ATTTTTAAGAAGAAATAGAAAGG + Intergenic
991926195 5:71707324-71707346 TTTTTAAAGGAGATAGAAAAAGG - Intergenic
991950353 5:71941473-71941495 ATTTTTAATGCTACTGAGAATGG - Intergenic
992023740 5:72650827-72650849 ATTTTTAAGAAGCCTGAAAAAGG - Intergenic
992161485 5:74008296-74008318 ATTTTTGAGAAGATTGACATTGG - Intergenic
992981535 5:82179657-82179679 ATTTTTAAGGAGATGATGATTGG - Intronic
993075183 5:83220733-83220755 TTTTTTGAGGAGAGAGAGAAAGG + Intronic
993224281 5:85145888-85145910 ATTTTCTTGGAGAGTGAGAAAGG - Intergenic
993538542 5:89119100-89119122 ATTTCTAAGGAGATTCAGATTGG + Intergenic
993540345 5:89141561-89141583 GTTTTTAAGAAGGTTGTGAAAGG + Intergenic
993590338 5:89787609-89787631 CATATTAAGGAGGTTGAGAAAGG + Intergenic
993653729 5:90553112-90553134 ATTTTTTTAGAGGTTGAGAATGG + Intronic
993799695 5:92317495-92317517 ATCATTAAGGAGATTGAGCAGGG + Intergenic
994255712 5:97593393-97593415 ATTTTTAATGACATATAGAATGG + Intergenic
994472648 5:100228150-100228172 AGTGTTAAGAAGATTGAGAAAGG - Intergenic
994639094 5:102383744-102383766 TTTTTTAAAAAGTTTGAGAAAGG + Intronic
994911297 5:105911995-105912017 ATTTTGTATGAGATTGAAAAGGG - Intergenic
994967204 5:106689657-106689679 GTTTTTAATGACATTTAGAATGG - Intergenic
996030195 5:118696224-118696246 ATGATTAAGGAGACTGAAAAGGG - Intergenic
996552864 5:124748030-124748052 TTTTTTAAGGAGATGGCGAATGG + Intronic
996887706 5:128377874-128377896 ATATCTAGGAAGATTGAGAATGG + Exonic
996888762 5:128391759-128391781 ATTTCTAAGGAGAATGGAAAGGG + Intronic
997937119 5:138122490-138122512 ATTTTTAATGTCATTGTGAATGG + Intronic
998297345 5:140984406-140984428 TTTTTTACAGAGATAGAGAAGGG + Intronic
998756785 5:145390280-145390302 ATTTATTAGAAGAGTGAGAATGG - Intergenic
998911464 5:146964837-146964859 ATTTTTAAGGGAGTTGACAAAGG + Intronic
999160875 5:149497710-149497732 ATTTGTAAGGAGGTAGACAAAGG - Intronic
999352327 5:150885665-150885687 ATTTTTATGGCAATTGTGAAAGG + Intronic
999941769 5:156550832-156550854 TTTTTAAAGGAGATAGTGAAGGG + Intronic
1000110880 5:158107133-158107155 ATTTTAAAGGACATTGAGAGAGG - Intergenic
1000734031 5:164875796-164875818 ATTTTTAATTAGATTTGGAAAGG + Intergenic
1000756017 5:165161225-165161247 ATTTCTTAGGAGACAGAGAAAGG - Intergenic
1001426618 5:171627001-171627023 ATTTTATATGACATTGAGAAGGG - Intergenic
1001941186 5:175740849-175740871 ATTTTCAAGAAGATTTACAAAGG - Intergenic
1002819311 6:709961-709983 ATTTTTAAAAAGATTTAGAATGG - Intergenic
1003194225 6:3900806-3900828 ATTTTTATAAATATTGAGAAGGG - Intergenic
1003710355 6:8582812-8582834 TTTTTTTAGAAGATTGAGTAGGG - Intergenic
1005273088 6:24187155-24187177 TTTTTTAAGGAAATAGAGGAGGG - Intronic
1006690233 6:35877539-35877561 ATTTTTTAGAAGACTGAAAATGG + Intronic
1008159167 6:48056249-48056271 ATTTTGAAGGAAAATAAGAAAGG + Intronic
1008189796 6:48440376-48440398 ATTTTTAATGAGATTGTAAATGG - Intergenic
1008402453 6:51079461-51079483 ATTTTTATGGATGTTGAGATGGG + Intergenic
1008764650 6:54896654-54896676 ATTTTAAAGGCTATTGAGAGTGG - Intronic
1008987315 6:57560479-57560501 ATTCTTAATGACATTTAGAATGG + Intronic
1009175273 6:60453031-60453053 ATTCTTAATGACATTTAGAATGG + Intergenic
1009393784 6:63173214-63173236 ATTATGAAGGAGATTGAACAGGG - Intergenic
1009785002 6:68325260-68325282 ATTTTTAAGAAAATTGGTAAAGG + Intergenic
1009831209 6:68938242-68938264 ATGTTTAAGGAGTTTGTGAAAGG + Intronic
1010167666 6:72935972-72935994 ATTATTAAGAAGGCTGAGAAGGG - Intronic
1010401686 6:75453508-75453530 ATTTTTTAAGAGAGGGAGAAAGG + Intronic
1010401897 6:75455477-75455499 ATTTTTAATGAAATTGATACTGG + Intronic
1010409940 6:75549931-75549953 ATATTCAAAAAGATTGAGAAAGG - Intergenic
1011720716 6:90154039-90154061 ATTTTAAAAGAGATAGAGATTGG - Intronic
1011808559 6:91102053-91102075 AATTTAAAGCACATTGAGAAGGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1011963836 6:93127278-93127300 GTTTTTAATGAGATCTAGAATGG + Intergenic
1012523719 6:100151954-100151976 ATTTATAATGAGAATGATAAAGG - Intergenic
1013154967 6:107484504-107484526 ATTTTAAAGGAGCTGAAGAATGG - Intergenic
1013433257 6:110075257-110075279 TTTTTTAAGGAGAATGAAAAGGG + Intergenic
1013678866 6:112500202-112500224 ATTTTTAAGGAGGCAGACAAAGG + Intergenic
1013798667 6:113914350-113914372 ATGTTTAAGAAGATAGAAAATGG - Intergenic
1014293235 6:119585739-119585761 CTTTGTAAGGAGATTAATAAAGG - Intergenic
1014608040 6:123503319-123503341 ATTCCTAAGGAGTTTGTGAAGGG - Intronic
1015173041 6:130275986-130276008 ATAATTAAGGATTTTGAGAAGGG + Intronic
1015327781 6:131943242-131943264 AGTTTTAATAAGAATGAGAAAGG - Intergenic
1015653062 6:135484409-135484431 ATTTTAAAAGAGATTCAGATTGG - Intronic
1015768525 6:136744972-136744994 ATTTCTAAGGAGCATGATAATGG - Intronic
1016280753 6:142415787-142415809 ATTTTTTAGGAAATTGCGAAGGG + Exonic
1016739224 6:147509870-147509892 ATTTTTTATGGAATTGAGAAAGG - Intronic
1017344189 6:153360382-153360404 ATTTTTAGGTAGACTGATAATGG - Intergenic
1017738670 6:157385198-157385220 GTTACTAAGGAGACTGAGAAGGG - Intronic
1018691716 6:166350737-166350759 ATTATTAAGCATATTGAGGAAGG - Intergenic
1020040067 7:4995261-4995283 ATTTTTAAAGAGGTGCAGAAAGG + Intronic
1021115998 7:16747343-16747365 AGTTTTAAGGAGATTTGGCAAGG - Intergenic
1021865513 7:24952833-24952855 ATTTTAAATGAGATTGGGGAGGG - Intronic
1021979322 7:26039274-26039296 AGTTTTACCGAGAATGAGAAAGG + Intergenic
1022182245 7:27932139-27932161 ATGTGTATGGAGAGTGAGAAAGG + Intronic
1022313823 7:29225127-29225149 ATCTATAAGGAGTTTGAAAAGGG - Intronic
1023662627 7:42486191-42486213 ATTTTTAGAGAGTTTGAAAATGG - Intergenic
1023977952 7:45045878-45045900 ATTTTTTAAGTGATTGTGAATGG - Intronic
1024220906 7:47285705-47285727 GCTTCTGAGGAGATTGAGAAAGG + Intronic
1024409349 7:49021836-49021858 ATTTTTAAAGAGAAGGATAAAGG + Intergenic
1024688956 7:51779015-51779037 ATTTTTAAAAAGCTTGAGATTGG + Intergenic
1024781122 7:52849447-52849469 ATTATTTAGGAGCTTGAGCAAGG - Intergenic
1024782474 7:52867005-52867027 CTGTTTAAGGAGATTGAAGATGG - Intergenic
1025875943 7:65479586-65479608 ATTAGCAAGGAAATTGAGAAGGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026729287 7:72897249-72897271 TTTTATAAGGTGGTTGAGAAAGG + Intronic
1027114713 7:75469865-75469887 TTTTATAAGGTGGTTGAGAAAGG - Intronic
1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG + Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1028218088 7:88160145-88160167 ATTTTTATGGCAATTGTGAATGG - Intronic
1028566807 7:92242787-92242809 ATTATCAAGGAAATTGATAAGGG - Intronic
1029006809 7:97219529-97219551 ATTTTTAAGGAGGAAGGGAATGG - Intergenic
1029998167 7:105030147-105030169 ATTCTTTAGGAGGTTAAGAAGGG + Intronic
1031628548 7:124019033-124019055 ATATTTCAGGATATTCAGAAAGG - Intergenic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033583009 7:142753535-142753557 ATTTTCCAGGTGAATGAGAAGGG - Intronic
1033586036 7:142775012-142775034 ATTTTCCAGGCGAATGAGAAGGG - Intergenic
1033644338 7:143288884-143288906 ATTTTTAAGGAGACAGAGTATGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034586144 7:152094181-152094203 CTTTTTTAGGAAATTGACAATGG + Exonic
1034841860 7:154405507-154405529 TTTTCTAAGCAGACTGAGAAAGG + Intronic
1035483672 7:159205958-159205980 GTTTTTCAGGAGTTTGGGAAAGG + Intergenic
1036403716 8:8434252-8434274 ATGTTTTATGAGAATGAGAAAGG + Intergenic
1036728418 8:11240740-11240762 ATTTTTAAGTTGAGTGTGAATGG + Intergenic
1037332862 8:17761822-17761844 ACTTTTAAGAAGACTGATAATGG - Intronic
1037928010 8:22859844-22859866 TTTTTTAAAAAGATTGGGAAGGG - Intronic
1038045548 8:23762833-23762855 ATTTTTGAGGAGCTTGACAATGG + Intergenic
1038555177 8:28506651-28506673 ATCTTTAATGAGAATGACAAAGG - Intronic
1038560442 8:28573491-28573513 ATTTTCAATGACCTTGAGAAAGG + Exonic
1038715830 8:29990210-29990232 ATTTTTAAAGAAATAGAGATGGG - Intergenic
1038814756 8:30890484-30890506 AAATCAAAGGAGATTGAGAAGGG - Intronic
1039179088 8:34843814-34843836 TTGTGTAAGGAGAATGAGAAGGG + Intergenic
1040692946 8:49961957-49961979 ACTTTCAGGGAGTTTGAGAATGG + Intronic
1040799991 8:51329856-51329878 ATGTTTATGGAGATTGAGAAGGG + Intronic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1041265016 8:56055973-56055995 ATTTTGAAGGAGCCTGAAAAAGG + Intergenic
1041313439 8:56538924-56538946 GTTTTTTAGTAGATTGATAATGG - Intergenic
1041415028 8:57598346-57598368 ATATTTAAGGAAACAGAGAAAGG - Intergenic
1042069706 8:64917763-64917785 ATTTGCAAGGAGAAGGAGAAAGG - Intergenic
1042496835 8:69464266-69464288 ATTTTCAAGTACATTGAGCAGGG - Intergenic
1042698843 8:71588272-71588294 ATTTTTAACAACATTCAGAAAGG - Intronic
1042880802 8:73486583-73486605 ATTTTTCAGGAAAAAGAGAAAGG - Intronic
1043051375 8:75390123-75390145 ATTTTTAAGCAGTGTTAGAATGG - Intergenic
1043291234 8:78604134-78604156 ATTTTTAAGGAGAGAAGGAAAGG + Exonic
1043324932 8:79038317-79038339 ATTTTTGTGGAAATTGTGAATGG - Intergenic
1043541506 8:81268807-81268829 ATTTTCAAAGAAAGTGAGAAGGG - Intergenic
1044363757 8:91319083-91319105 ATATTTAAGAAAATTAAGAATGG - Intronic
1044384807 8:91575142-91575164 ATTTTTAATGATATTGGAAATGG + Intergenic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1045768887 8:105710449-105710471 ATTTGTAAGCAGATGGTGAAAGG + Intronic
1046092307 8:109518338-109518360 ATTTTTAACCAGATTGTGAGAGG - Exonic
1046895531 8:119467892-119467914 ATTTTTGAAGTGATTGTGAATGG - Intergenic
1047293703 8:123552445-123552467 ATTTTTAAGGCATTTGAAAATGG - Intergenic
1048276821 8:133072354-133072376 ACTTGTAGGGAGATTGAGAGAGG + Intronic
1049122710 8:140753586-140753608 ATGTCAAAGGAGACTGAGAAGGG + Intronic
1050434118 9:5591296-5591318 ATTTTTAAGGAAATAGAGATGGG + Intergenic
1051000984 9:12281191-12281213 ACTCTAAAGGAGATTGAAAAGGG - Intergenic
1051326714 9:15979831-15979853 TTTTTTAAAGAGTTTGGGAAGGG + Intronic
1051993885 9:23189850-23189872 TTTTGAAAGGAGAATGAGAAAGG - Intergenic
1052052895 9:23867848-23867870 AATTCTAAGTAGATTGAGGAGGG + Intergenic
1052269345 9:26610838-26610860 TTTTTTAAGGAAAATGAGATGGG + Intergenic
1052296264 9:26898968-26898990 AATTTTAGGAGGATTGAGAATGG - Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1052901776 9:33799673-33799695 ATTTTCCAGGTGAATGAGAAGGG - Intergenic
1053100946 9:35371957-35371979 ACTTTTAAAGAGGATGAGAAAGG - Intronic
1055202646 9:73685121-73685143 ATTTTTAAGAAGACTGGAAAAGG + Intergenic
1055951823 9:81736348-81736370 ATTTACGAGGAGATTGAGAAGGG - Intergenic
1056120603 9:83484144-83484166 CTCTTTAAAGAGATTGATAAAGG - Intronic
1056140273 9:83671296-83671318 GTTCTTAATGACATTGAGAATGG + Intronic
1056276925 9:85002593-85002615 ATTTTTGAGGAATTTGTGAAAGG - Intronic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056427252 9:86489618-86489640 TTTTGGAAGGAGATGGAGAAGGG - Intergenic
1056486297 9:87061561-87061583 ATTTTAAAGGAGAAGGTGAAAGG - Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057728708 9:97589957-97589979 ACTTTTAAGTATATTGATAATGG - Intronic
1057775970 9:98009888-98009910 ATTTTGAAGCATATTGAGACAGG + Intronic
1057881024 9:98792831-98792853 ATTTTTAAGGAGGAAGAAAAGGG + Intronic
1058465906 9:105227116-105227138 ATTTTTAAAGCGTTTGAAAATGG - Intergenic
1059224237 9:112656961-112656983 TTTTATAAAGAGAGTGAGAAAGG - Intronic
1059780792 9:117524688-117524710 ATTTTTATGCAAAATGAGAATGG - Intergenic
1060459036 9:123830924-123830946 ATGTTTAATGAGATTGATGATGG - Intronic
1185472913 X:395612-395634 AATTTTAAGCAAATTGAGAATGG + Intergenic
1186735407 X:12458217-12458239 ACTTTTCATGAGATGGAGAAAGG + Intronic
1187312863 X:18162400-18162422 ATTTTTTAGCATAGTGAGAAAGG + Intergenic
1188106200 X:26150191-26150213 ATTTTTAAGTGAATTTAGAAAGG - Intergenic
1188409514 X:29854049-29854071 ATTTGGAAGGAGAATGAGAGAGG - Intronic
1188732696 X:33670975-33670997 ATTTCTAAGGATTTTTAGAATGG - Intergenic
1188762750 X:34052338-34052360 ATTTTTAATCTGATTGAAAAGGG + Intergenic
1188796823 X:34477266-34477288 TTTTTTAAGGCAATTGTGAATGG + Intergenic
1189722138 X:43930946-43930968 GTTTTTAAGAAGACTGAAAAAGG - Intergenic
1189970090 X:46409441-46409463 ATTTTTAAGGAGTGTGTGTAGGG - Intergenic
1190993506 X:55579450-55579472 ATGTTTAAGGTGATGGATAATGG - Intergenic
1191147351 X:57181473-57181495 TTTTTTATGGAAATTGTGAATGG - Intergenic
1191583052 X:62786889-62786911 ATTTTTGAGGAATCTGAGAAGGG - Intergenic
1191957696 X:66663693-66663715 ATTTTTAATGACATTTAGAGTGG + Intergenic
1192001494 X:67156590-67156612 AGTTTTATGGAGAATCAGAAAGG - Intergenic
1192877126 X:75242603-75242625 ATTTTTAAGTAACTTGATAATGG - Intergenic
1193349296 X:80440651-80440673 ATTTTTACTGATATTGACAATGG + Intronic
1194003689 X:88464182-88464204 ATTTATATGTAGATTGTGAAAGG + Intergenic
1194605516 X:95974089-95974111 ATTCTTCAGGATATGGAGAATGG + Intergenic
1194719931 X:97327969-97327991 GTTTTTAAGTAAATTAAGAAGGG - Intronic
1195061114 X:101195727-101195749 ATTTTTCAGAAGATCTAGAAGGG - Intergenic
1195101524 X:101559376-101559398 ATTTTGCAGGAGTTTGAGTAAGG + Intergenic
1195152534 X:102086612-102086634 AAATGAAAGGAGATTGAGAAAGG - Intergenic
1195510127 X:105706154-105706176 ATTTTGAAGGAGAGAGAGAAAGG + Intronic
1196427494 X:115586345-115586367 ATTTTTTAAAAGATTAAGAAAGG - Intronic
1196594159 X:117523580-117523602 ATTTTTAAGAAGTATGAGTACGG + Intergenic
1197516520 X:127438179-127438201 ATTTTTGAGGTGATTCAAAAAGG + Intergenic
1197546360 X:127829815-127829837 ATTTTTAAGGGAATTCAAAAAGG - Intergenic
1197782623 X:130172511-130172533 TTTTTTAGGGCGGTTGAGAATGG + Intronic
1198089565 X:133314267-133314289 ATTTTTTAAAAGAATGAGAAAGG - Intronic
1198192163 X:134318171-134318193 TTTTTGAAAGAGTTTGAGAATGG - Intergenic
1198600423 X:138278859-138278881 TTTTTTAAAGATATTGAAAATGG + Intergenic
1198613660 X:138430248-138430270 AAATTTAAGGAGGATGAGAATGG - Intergenic
1198929705 X:141840857-141840879 CTATTCAAGGGGATTGAGAATGG + Intronic
1199699853 X:150366990-150367012 ATTTTTAAGGAGATCTTGTAAGG - Intronic
1199724888 X:150569765-150569787 ATTTTGAAGGAAATTCAAAATGG - Intronic
1201274323 Y:12284304-12284326 ATTAGTAAGGAAATTGAGAAGGG + Intergenic
1201651273 Y:16290243-16290265 ATTTTTAAAATGATTGAGATAGG + Intergenic
1202274475 Y:23101196-23101218 CTTTTTACGTATATTGAGAATGG - Intergenic
1202291552 Y:23319490-23319512 CTTTTTACGTATATTGAGAATGG + Intergenic
1202305911 Y:23470278-23470300 ATTTTAAAGGAGCTTAAGAAAGG + Intergenic
1202427468 Y:24734931-24734953 CTTTTTACGTATATTGAGAATGG - Intergenic
1202443323 Y:24935163-24935185 CTTTTTACGTATATTGAGAATGG + Intergenic
1202564898 Y:26200311-26200333 ATTTTAAAGGAGCTTAAGAAAGG - Intergenic