ID: 1127216884

View in Genome Browser
Species Human (GRCh38)
Location 15:56832888-56832910
Sequence CTTTAAACCCTAAAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127216881_1127216884 13 Left 1127216881 15:56832852-56832874 CCAATATGAAGCAAGTGATAACT 0: 1
1: 0
2: 1
3: 8
4: 165
Right 1127216884 15:56832888-56832910 CTTTAAACCCTAAAAGTGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127216884 Original CRISPR CTTTAAACCCTAAAAGTGGG AGG Intronic
904559309 1:31386092-31386114 CTATAAACCAAAAAAGTTGGAGG - Intergenic
906919869 1:50052334-50052356 CTTTACACACAAAAAGTGTGGGG - Intronic
914886160 1:151586078-151586100 CTTTAAACACAAAATGTGTGTGG + Intergenic
919681319 1:200437592-200437614 CATTGAACCTTAAAAGTGGGAGG + Intergenic
922383226 1:225054426-225054448 TTTAAACCCCAAAAAGTGGGAGG + Intronic
1064764562 10:18658272-18658294 CTTTAAACCATAGCACTGGGAGG + Intergenic
1068145452 10:53064192-53064214 CTTTAAATGCTAAAAGTTTGAGG - Intergenic
1068495985 10:57786056-57786078 CTATATAGTCTAAAAGTGGGAGG + Intergenic
1070502175 10:77082396-77082418 ATTTAAACCCTAACTGTGGTAGG - Intronic
1071069717 10:81677569-81677591 CTTTAAACTCAAGAAGTGGGAGG - Intergenic
1071443549 10:85725625-85725647 CTCTTGACCCTCAAAGTGGGAGG + Intronic
1071532539 10:86400856-86400878 CTTCCAACCCGAAAAGTGGGTGG - Intergenic
1071720481 10:88139172-88139194 CTTTAAAACCTAACAATTGGAGG + Intergenic
1072662227 10:97370167-97370189 CTTTAAACTCGAAAAGGAGGTGG + Exonic
1076112004 10:127867211-127867233 ATTTAAAACCTAAAAGCAGGAGG + Intergenic
1079707215 11:23635965-23635987 CATCAAATGCTAAAAGTGGGGGG - Intergenic
1080269212 11:30433222-30433244 CTTTATACCTTAAAATTGGAGGG - Intronic
1081227734 11:40545454-40545476 GTTTAAAACCTAAAAGTAAGGGG + Intronic
1082061529 11:47865135-47865157 CTTTAAACCCTGAAAAAGGAAGG - Intergenic
1084273189 11:68039650-68039672 ATTTACACCATAAAAGTGGCTGG + Intronic
1084439559 11:69164799-69164821 CTTTCAACACTAAAATGGGGAGG + Intergenic
1085109899 11:73878338-73878360 CATTATACCCTAAAAGTGCTAGG + Intronic
1085420038 11:76349206-76349228 CTTTAAACCATTAAATTTGGGGG + Intergenic
1092382336 12:8007101-8007123 CTTTATAACCTAAAAGTGCAAGG + Intergenic
1093380509 12:18485850-18485872 CTGTAAACCTTAAAAGAGAGTGG + Intronic
1103160828 12:118727836-118727858 CTAAAAAACCTAAAAATGGGAGG - Intergenic
1103974227 12:124691728-124691750 CTTTAAAAGGTGAAAGTGGGTGG - Intergenic
1106504577 13:30360129-30360151 CTTTTACCCAAAAAAGTGGGAGG - Intergenic
1112868286 13:103936072-103936094 TTTTACACCCTAAAAGTCGAGGG - Intergenic
1115925555 14:38429451-38429473 CTTTACACCCTGAAAGTGGGAGG - Intergenic
1117604931 14:57418821-57418843 CTAAAAACACTAAAATTGGGTGG - Intergenic
1117785148 14:59275975-59275997 CTTTAAGCCCTAAAAGGGATTGG - Intronic
1120521684 14:85533112-85533134 CTTTAAACCAGAAAAGTAGGAGG + Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1127216884 15:56832888-56832910 CTTTAAACCCTAAAAGTGGGAGG + Intronic
1127578901 15:60318826-60318848 CTTTCAACTCTAATGGTGGGAGG - Intergenic
1129583698 15:76840119-76840141 CTTTAAACATAAAAAGTGGCTGG + Intronic
1130079961 15:80724217-80724239 CTTTAATCCCAGAAGGTGGGAGG + Intronic
1130440094 15:83944752-83944774 CTCTAAAGCCTAAATCTGGGTGG + Intronic
1133472619 16:6090181-6090203 CCTTAAAACCTAGAAGAGGGAGG - Intronic
1138124759 16:54429628-54429650 CTTTAGGCTCTATAAGTGGGTGG - Intergenic
1141195679 16:81859218-81859240 CTTTAAACCTTCCAAGGGGGTGG + Intronic
1143427184 17:6849293-6849315 GTTTCAAGCATAAAAGTGGGTGG - Intergenic
1143858609 17:9871492-9871514 CCTTAGACCCTAAAAGTTTGTGG - Intronic
1146671331 17:34740176-34740198 CTTTTTACCCTGAAAGTGGGTGG + Intergenic
1150413659 17:64968982-64969004 TTTTAAACCCTATAAGTGTGAGG - Intergenic
1150798149 17:68256186-68256208 TTTTAAACCCTATAAGTGTGTGG + Intronic
1153123343 18:1759113-1759135 CTTTAAACTGCAAAAGTGTGGGG + Intergenic
1155935096 18:31745439-31745461 ATTGAAACCCTCAAAGTTGGTGG + Intergenic
1158917505 18:62150278-62150300 CTTTAAACCCTATCAGAGGCTGG - Intronic
1162911682 19:13851180-13851202 CTGGAACCCCTAGAAGTGGGTGG + Intergenic
1166284405 19:41815092-41815114 CTTCAAACCACTAAAGTGGGTGG + Intergenic
1167410883 19:49343103-49343125 CATTAAACCCTCAAAGAGGCTGG + Intronic
1168599752 19:57708269-57708291 TTTTAAACCCTAACATAGGGCGG + Intronic
928700147 2:33890736-33890758 TCTTAAACCCTAAAAGTGAGAGG + Intergenic
941714072 2:168745588-168745610 CCTTCAACCCTAAAATTGGAAGG + Intronic
943787837 2:191898476-191898498 ATTTAAACCATAAAAGTCAGAGG - Intergenic
945001564 2:205356476-205356498 CTGTAAACCCTAAAAGTGTTGGG + Intronic
947208153 2:227681345-227681367 ATTTAAACACTAAAAGGGGAGGG + Intergenic
1169625059 20:7556938-7556960 ATTTAAACCTTAAAAGATGGAGG - Intergenic
1169847808 20:10014681-10014703 CTTTTGACCATAAAAGTGAGAGG - Intronic
1169926797 20:10792482-10792504 CTTTAAAACATAAAAATGTGTGG + Intergenic
1172496039 20:35385111-35385133 GTTTTAAACCTAAAAGTGGCTGG - Intronic
1175252477 20:57617749-57617771 CTTAAGAGGCTAAAAGTGGGAGG + Intronic
1178995878 21:37399187-37399209 TTTTAAAACCTAGAAGTGGTTGG + Intronic
1182240789 22:28914512-28914534 TTTTAAACTTTAAAAGTTGGAGG + Intronic
1182641246 22:31769619-31769641 CTTTAAATTCAAAAAGTGGCTGG + Intronic
949990939 3:9578581-9578603 CTTGAACCCCTAATAGTGGGGGG + Intergenic
951311680 3:21133858-21133880 CTTTAAAACTTAAAAGTAGATGG + Intergenic
951973948 3:28481790-28481812 CTTTAAATCCTAAACTTAGGTGG - Intronic
953569394 3:44059082-44059104 CTTTACACCCAAAAGGAGGGAGG + Intergenic
956832283 3:73063159-73063181 CTTTAAATCCCAAAAATGTGGGG - Exonic
956930848 3:74041253-74041275 CTCTGAAACCTCAAAGTGGGAGG + Intergenic
957388704 3:79533032-79533054 CTTTAAACCATTAAAAAGGGTGG + Intronic
958255577 3:91321036-91321058 CTTTACACTCTAAATGTTGGAGG + Intergenic
959087504 3:101867228-101867250 CTTGAAAACCTAGATGTGGGTGG - Intergenic
959551850 3:107668982-107669004 CTTTAACCTCTGAATGTGGGAGG - Intronic
962051100 3:131816543-131816565 GTTTCAATCCTAAAAGTGGTGGG - Intronic
963230139 3:142901232-142901254 CTTTAAACCCCAAATGTGAGAGG - Intergenic
964491925 3:157246104-157246126 TTTTAAAGCATAAAAATGGGTGG + Intergenic
966779489 3:183571632-183571654 ATTTAAAACATAAAAGTGGCTGG - Intergenic
971034048 4:22674078-22674100 CCTTAAACAATAAAAGTGGCAGG + Intergenic
972410976 4:38794333-38794355 CTTTGAAGCATAATAGTGGGAGG - Intronic
976163867 4:82232579-82232601 CTGTAAACCCAAAATTTGGGAGG + Intergenic
977788592 4:101070563-101070585 CTTTATACTTTAAAAGTGAGAGG - Intronic
977986133 4:103385445-103385467 GTTTCAAGCCTAAAACTGGGTGG + Intergenic
982850115 4:160303900-160303922 CTTTAAAACCAAAAAGAGAGAGG - Intergenic
983391599 4:167138559-167138581 GTTTAAACACTTAAAGTAGGTGG - Intronic
983971467 4:173880442-173880464 CTCTCACCCCTAGAAGTGGGTGG - Intergenic
984264476 4:177480770-177480792 CTATAAACCCAGAATGTGGGGGG - Intergenic
985369416 4:189269524-189269546 CTTTGTAACCTAAAAGTGTGAGG + Intergenic
986958692 5:13188050-13188072 CTTCAGACCTTAAAAGTTGGTGG + Intergenic
987660416 5:20865797-20865819 GTTGAAACCCTAAAAGTCAGGGG - Intergenic
988440575 5:31228187-31228209 CCTTAGACCTTAAAAGAGGGAGG - Intronic
988763236 5:34339879-34339901 GTTGAAACCCTAAAAGTCAGGGG + Intergenic
992546738 5:77820971-77820993 CCTAAAACCCTCAAACTGGGTGG - Intronic
992612463 5:78519348-78519370 CTCTGTACCCTACAAGTGGGTGG + Intronic
993553037 5:89299000-89299022 CTTTTATCCCTAAAAGTTGTTGG - Intergenic
994849009 5:105029068-105029090 CTTTAATTCCTAACAGTTGGGGG - Intergenic
995400624 5:111736995-111737017 CTTTAAGACCCAAACGTGGGTGG - Intronic
1000630456 5:163585130-163585152 CTGTAAACCCTAAAGATAGGAGG + Intergenic
1001668735 5:173455930-173455952 CTTTTAGTCCAAAAAGTGGGTGG - Intergenic
1002126377 5:177048081-177048103 CTGTAACACCAAAAAGTGGGGGG - Intronic
1002922623 6:1583428-1583450 CTTTAAAGCCTTGAAGAGGGAGG + Intergenic
1003372448 6:5541917-5541939 CTATATACTCTAAAAGGGGGAGG - Intronic
1003887701 6:10535938-10535960 CCCTGAACCCTAAATGTGGGTGG + Intronic
1003958604 6:11189254-11189276 TTTTAATCCCTCAAAGTGGAAGG + Intronic
1004280100 6:14273289-14273311 GTTGAAATACTAAAAGTGGGAGG + Intergenic
1004922766 6:20392373-20392395 CTTTATAACATAAAAGTGTGAGG - Intergenic
1005005584 6:21284088-21284110 CATAAAATCCTAAATGTGGGAGG - Intergenic
1005978742 6:30819878-30819900 ATTAAAACCCTGATAGTGGGTGG + Intergenic
1009949319 6:70377614-70377636 CTTCAAACCCTTAAAGTCTGAGG + Intergenic
1012197194 6:96358144-96358166 CTTTAAAGACTAAATGTGGCTGG + Intergenic
1013088778 6:106879968-106879990 CTTTAAAACCTAAAAGTGCAAGG - Intergenic
1016914530 6:149232631-149232653 GTTCAAACCATAGAAGTGGGGGG + Intronic
1018268350 6:162050554-162050576 CATTAAACCCTCAAAGTTAGAGG - Intronic
1021902771 7:25303792-25303814 ATTTAAACCCTAAAATAGGAGGG - Intergenic
1022258532 7:28682666-28682688 AATTCAAACCTAAAAGTGGGGGG + Intronic
1022705420 7:32797616-32797638 CTTCAACACCTAAAAGTGTGTGG + Intergenic
1023893996 7:44416999-44417021 GTATAGAACCTAAAAGTGGGTGG - Intronic
1037335674 8:17789325-17789347 ATTTAAAAACTAAAAGTGGCCGG - Intronic
1045262384 8:100587982-100588004 GTTTATAGCCTAAGAGTGGGAGG - Intronic
1047511719 8:125520797-125520819 CTTTGAATGCTAAAGGTGGGTGG + Intergenic
1047676173 8:127205748-127205770 CTGTAAACCCTAGCAGTGGCGGG + Intergenic
1052361254 9:27562121-27562143 TTATAATTCCTAAAAGTGGGAGG - Intronic
1055390985 9:75821843-75821865 GTTTAAAGCATAAAACTGGGTGG - Intergenic
1060064350 9:120490154-120490176 TTCTAACCCCTAAAAGTAGGTGG - Intronic
1060835133 9:126750170-126750192 CATTAAACCCTAGAAATGGTAGG - Intergenic
1061998258 9:134199991-134200013 CCTTAACCCCTAAAAGTGCTGGG - Intergenic
1185935227 X:4249271-4249293 ATTTAAACTCTAAAAGCAGGTGG - Intergenic
1186436224 X:9545224-9545246 TTTCAAACCATAAAAATGGGGGG - Intronic
1188329945 X:28857242-28857264 CTTTATAACATAAAAGTGTGAGG + Intronic
1188639183 X:32477449-32477471 CTTTAACTCTTAAAAGAGGGAGG + Intronic
1189081631 X:37979210-37979232 ATTTAAACGGGAAAAGTGGGCGG + Intronic
1192043964 X:67652437-67652459 CTTTAAACACTAAAACTTGAAGG + Intronic
1192222205 X:69204985-69205007 CTGTAGTCCCGAAAAGTGGGAGG - Intergenic
1193771214 X:85589833-85589855 CTTTAAAAAATAAATGTGGGTGG - Intergenic
1195645451 X:107226260-107226282 CTTTAAACCCCACGAGTGGAAGG + Intronic
1196154616 X:112414627-112414649 CTTCAAACCCAAATAGTGTGTGG + Intergenic
1197644289 X:129001300-129001322 CTAAAAACCCATAAAGTGGGCGG + Intergenic
1197847013 X:130813799-130813821 ATTTCAAGCATAAAAGTGGGCGG + Intronic
1199416605 X:147590687-147590709 CTTTAAGATCTAAAACTGGGGGG - Intergenic