ID: 1127221713

View in Genome Browser
Species Human (GRCh38)
Location 15:56887310-56887332
Sequence CCGCGCGCGGCCCGGCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 5, 3: 65, 4: 415}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127221713_1127221719 -5 Left 1127221713 15:56887310-56887332 CCGCCGGGCCGGGCCGCGCGCGG 0: 1
1: 0
2: 5
3: 65
4: 415
Right 1127221719 15:56887328-56887350 CGCGGAAGGACAAATAGTTCCGG 0: 1
1: 0
2: 0
3: 6
4: 37
1127221713_1127221722 21 Left 1127221713 15:56887310-56887332 CCGCCGGGCCGGGCCGCGCGCGG 0: 1
1: 0
2: 5
3: 65
4: 415
Right 1127221722 15:56887354-56887376 CAGTGCCGCGCACCTCTACGCGG 0: 1
1: 0
2: 0
3: 1
4: 39
1127221713_1127221720 -2 Left 1127221713 15:56887310-56887332 CCGCCGGGCCGGGCCGCGCGCGG 0: 1
1: 0
2: 5
3: 65
4: 415
Right 1127221720 15:56887331-56887353 GGAAGGACAAATAGTTCCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127221713 Original CRISPR CCGCGCGCGGCCCGGCCCGG CGG (reversed) Intronic
900191780 1:1355174-1355196 CGGCGCGCGGGCCGGGGCGGCGG + Intronic
900284159 1:1891272-1891294 CCCCCGGCGGCCCGGCCCTGCGG + Intergenic
900412303 1:2518179-2518201 CCGAGCTCGGCCCGGCGCAGCGG - Exonic
900513027 1:3069341-3069363 GCCCGGGCGCCCCGGCCCGGCGG - Intronic
900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG + Intronic
900633904 1:3652527-3652549 CCGCCCGCGCACCCGCCCGGAGG + Exonic
900923023 1:5685634-5685656 CAGTGCCTGGCCCGGCCCGGAGG - Intergenic
901060812 1:6471145-6471167 CCTGGCGCGGGCCGGCCCGCAGG - Intronic
901084459 1:6602168-6602190 CAGTGCGCGGCGCGGCGCGGCGG + Exonic
901332765 1:8423723-8423745 CCGCGCGGCGCGGGGCCCGGGGG + Intronic
901797965 1:11691579-11691601 GCGCGCCGGGCCCGGCCCCGGGG + Exonic
902214303 1:14924626-14924648 CCTCGCGCGCCCGGCCCCGGCGG - Intronic
903724319 1:25430051-25430073 TCCGGCCCGGCCCGGCCCGGAGG + Intronic
903738190 1:25543618-25543640 CCGCGCGCCGCAGGGCCGGGCGG + Exonic
903907327 1:26696279-26696301 CCCCGCGAGGCCCGCCCGGGCGG + Exonic
904006632 1:27366475-27366497 CCGCGCGCAGCCCCGGCCCGGGG + Exonic
904190207 1:28737346-28737368 CGCGGCGCGGCCCGGCCCGTGGG - Intronic
904500079 1:30908392-30908414 CCGCGCGGGGGGCGGCCCCGGGG + Intronic
904500205 1:30908798-30908820 CCGCGCTGGGGGCGGCCCGGCGG - Intergenic
904642006 1:31938128-31938150 CGACACCCGGCCCGGCCCGGCGG + Exonic
905442747 1:38005438-38005460 CCCCGCTTGGCCCGGCCCGCAGG - Exonic
905655862 1:39685590-39685612 CTGGGCGCGGCCGGGCACGGTGG + Intronic
906262865 1:44406810-44406832 CCGTGGGCGGCCTCGCCCGGGGG - Intronic
906344642 1:45007547-45007569 CCGCCAGCGGCCAGGCCTGGTGG - Exonic
906478760 1:46186947-46186969 CCGGGCGTGGCCGGGCACGGTGG - Intergenic
906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG + Exonic
906637008 1:47416479-47416501 CCGCGCCCGGCCCGGGGCGGCGG + Exonic
907053504 1:51345069-51345091 CCGCGGGCGGCCCCTCGCGGCGG + Exonic
907136251 1:52142155-52142177 GCGCCCCCGGCCCGGCTCGGCGG + Exonic
907415027 1:54308312-54308334 CCGGGCGTGGCCGGGCACGGTGG + Intronic
908477631 1:64505531-64505553 CGGGGCGGGGCGCGGCCCGGGGG - Intronic
909958030 1:81802161-81802183 CCGCGCGGGGACAGGCGCGGAGG - Intronic
913144565 1:115976612-115976634 CTGCGCGCGGCCCGCCATGGAGG + Exonic
914919513 1:151838079-151838101 CTGCGGGCGGCCAGGTCCGGGGG + Exonic
915165695 1:153946640-153946662 GCGCCCGCGGCCCGGAGCGGGGG - Exonic
915559182 1:156676622-156676644 CCGCGAGCGGCTGGGCCGGGCGG - Exonic
916667041 1:166975746-166975768 CCCCGCTCGGCGCGGCCCGCGGG - Intronic
916694513 1:167221637-167221659 CCGCGCGGGGCTGAGCCCGGGGG + Intronic
919878791 1:201889012-201889034 CGGTGAGCGGCGCGGCCCGGCGG - Exonic
919892038 1:201982689-201982711 CCGGCAGCGGCGCGGCCCGGCGG + Exonic
919892105 1:201982948-201982970 GCGGGAGCGGCCCGGCTCGGAGG + Exonic
920184591 1:204152082-204152104 CCGCCCCCGCCCCGGCCCGCGGG + Intergenic
920914869 1:210251624-210251646 GCGAGCGCGGCGCGGCCCGGCGG + Intergenic
922558273 1:226549188-226549210 GAGCGCGCGGCCCCGCCAGGAGG - Intronic
922584083 1:226720762-226720784 CCGGGCGCGGCCGGGCGTGGTGG + Intronic
922812464 1:228425184-228425206 CCGCTACCGGCCCGGCACGGTGG - Exonic
923506439 1:234609743-234609765 CCGTGCCCGGGCCGGCCGGGGGG - Intergenic
923744299 1:236686400-236686422 CCGCCCCCGGCCCCGCCCGTCGG - Intergenic
924560616 1:245154630-245154652 TGGCGCGCGGCCCGGGCCCGGGG - Intergenic
924953395 1:248906167-248906189 CGGGGCGTGGCCTGGCCCGGGGG + Intergenic
1062774536 10:134986-135008 CAGTGCGCGGCCCGGCCGCGGGG + Intronic
1062774853 10:135952-135974 CCGTGCGCAGTCCGGGCCGGCGG + Intronic
1064048725 10:12042523-12042545 CCAAGCATGGCCCGGCCCGGGGG + Intronic
1064060138 10:12129964-12129986 CCGTGCGAGGCCTTGCCCGGCGG + Intronic
1066465143 10:35643423-35643445 CTGCGGGCGGCCCGGGCCGGCGG + Intergenic
1067091301 10:43266902-43266924 CAGCGCGCGGCCGGCGCCGGCGG + Intronic
1069191304 10:65494631-65494653 CCGCGCCCGGCCCGGACCAGTGG + Intergenic
1069695511 10:70382628-70382650 CCCCGCGCGCCCCGCCCCGCCGG - Intronic
1070182915 10:74031775-74031797 CCGAGTGTGGCCCGGCACGGTGG + Intronic
1073236387 10:102020387-102020409 CCGAGCACGGCCGGGCGCGGTGG + Intronic
1073265628 10:102226685-102226707 CCCCTCGCGCCCCGGCCCCGGGG - Intronic
1073268340 10:102241563-102241585 ACGCGCGCGGCTCGCCGCGGCGG - Intergenic
1074522631 10:114239494-114239516 CCGGGCGCGGCTCGGGCCAGGGG - Exonic
1076039186 10:127228336-127228358 CCCCACGCTGCCCGGCCCGGAGG + Intronic
1076369967 10:129946178-129946200 CCGCGCGAGGCCAGGACCGAGGG - Intronic
1076998591 11:311144-311166 AGGCGCGCGGCCCCGCCCGGCGG + Intronic
1077000152 11:318615-318637 AGGCGCGCGGCCCCGCCCGGCGG - Intergenic
1077020836 11:416576-416598 CCGCGGCCGCCCCTGCCCGGTGG + Intronic
1077098475 11:810131-810153 CCGCGCGTGGCTCGGCCCGTAGG - Intronic
1077098480 11:810144-810166 CCACGCGCGGCCTCGCCCGGCGG + Intronic
1077227646 11:1445348-1445370 CCGCTCGCTGCCCAGCCTGGAGG + Exonic
1077299034 11:1838828-1838850 CAGCACGCGGCCAGGCCAGGCGG + Intergenic
1077891165 11:6419093-6419115 CCGCTCGGGGCGCGGCCCCGCGG - Intronic
1078164542 11:8871002-8871024 CCGGGAGCCGCGCGGCCCGGAGG + Intronic
1080283595 11:30585377-30585399 GCGCGCGCGGGCGGCCCCGGGGG + Intronic
1080386969 11:31816114-31816136 GCACGCGCGGCGCGGCCCGCGGG + Intronic
1080802138 11:35618778-35618800 CGGCGCCCGGCCCGGAGCGGCGG + Exonic
1081831467 11:46119881-46119903 CCGCCCGCGCCCCCGCCGGGGGG - Intronic
1081863666 11:46347997-46348019 CCGCCCGTGTCCCGGCCCTGGGG - Intronic
1082802822 11:57427002-57427024 CCGAGCGCGGCCTGGCCCCTCGG - Intronic
1083335169 11:61917727-61917749 CTGAGCGCGGCGCGGCCCGCGGG - Intronic
1083655267 11:64226344-64226366 CCCCGCGCGCCCCGGGTCGGAGG + Exonic
1083729204 11:64643760-64643782 GCGCGCGCGTCCAGGCGCGGGGG - Intronic
1083753864 11:64778564-64778586 CCGCCCCCGGCCCGCCCCCGCGG - Intronic
1083883300 11:65558631-65558653 CCCCGCCCCGCCCCGCCCGGAGG - Intronic
1084336604 11:68461201-68461223 CCGGGCGCGGGCCGGGCGGGGGG - Intronic
1084527246 11:69704823-69704845 CCGCGCTCGCCCCGGCCCCGCGG + Intergenic
1084588712 11:70078334-70078356 CCAGGCGCGGGCCGGCCCGCGGG + Exonic
1085574254 11:77588744-77588766 CCGGGCGCGGCTGGGCGCGGTGG - Intronic
1089527637 11:119107626-119107648 CCCCGCGCGCCCAGCCCCGGGGG + Exonic
1090190286 11:124762372-124762394 CCCCGCGCGCCCCGCCCGGGAGG - Intergenic
1090211061 11:124921336-124921358 CGGCGAGCGGCCGGGCACGGCGG + Exonic
1091259821 11:134225096-134225118 CCGAGACCCGCCCGGCCCGGCGG + Exonic
1091434148 12:460299-460321 GGGCGCGGGGCCCGGCCGGGGGG + Intergenic
1091616223 12:2053029-2053051 CGGCGCTCGGCGCGGCGCGGCGG + Intronic
1092256231 12:6928057-6928079 CGCCGCGCCGCCCGGCCCCGCGG - Intronic
1094107999 12:26833386-26833408 CCCCGCGCGGGCCGGTGCGGCGG - Intergenic
1096435800 12:51590791-51590813 CAGCCCGCGGCCCCTCCCGGCGG + Intronic
1096782586 12:53999740-53999762 CCGCGCCCAGCTCGGCCCTGGGG + Intronic
1097712919 12:62934848-62934870 CCGCGCGCGGCGCGTCCCAGTGG - Exonic
1098161152 12:67649029-67649051 CCGCGCGAGGGGCGGCCGGGAGG + Exonic
1098161437 12:67649958-67649980 CCGCGGGCGGCCCGGGCGGTGGG + Intronic
1099989554 12:89708555-89708577 CCGCCCGCGGCCGGGGGCGGCGG - Intronic
1101910483 12:108857389-108857411 CCGCGCCCGGCCTGGGCCGCCGG - Intronic
1102043331 12:109814751-109814773 CCGCGCGGGGCCCGGGGAGGTGG - Exonic
1102933579 12:116879829-116879851 CGGCGCGCGGCGGGGCTCGGGGG + Intronic
1102973538 12:117190117-117190139 CCGCGCGCGGGGCGGCCGCGGGG + Intronic
1102997343 12:117360813-117360835 CCGCGGGCAGCCCGGGCTGGGGG - Intronic
1103096433 12:118136366-118136388 CAGCGAGCGGCACGGCGCGGAGG + Intronic
1103698492 12:122835433-122835455 CCGCGCCCGGGCCCGCCCGCCGG - Exonic
1104344511 12:127983611-127983633 CCGAGCGCTGCCCGGCGGGGAGG - Intergenic
1104841567 12:131828380-131828402 CCGCGCGGGGCTCAGTCCGGCGG + Exonic
1105472172 13:20704032-20704054 GCGCCCGCGGCCCAGCTCGGCGG - Exonic
1105984144 13:25549170-25549192 CCGGGCCCGGCCGGGCGCGGTGG + Intronic
1107054944 13:36092771-36092793 CCTCTCGCGGCCGGGCGCGGTGG - Intronic
1107899073 13:44994293-44994315 CCTCTCGCGGCCGGGCACGGTGG + Intronic
1109858831 13:68171147-68171169 CCGCGCCCTGCCCCGCGCGGAGG - Intergenic
1112504630 13:99968609-99968631 CCGCGCGCGGCCCCGCGCTTGGG + Intronic
1112506334 13:99978553-99978575 CCGCGCGCGGCCGGGCGGTGGGG - Intergenic
1113492846 13:110705987-110706009 CCGCTCGCCGCCCGGCCCGCAGG + Exonic
1113541783 13:111115164-111115186 CCGCGCACGGCCTGGAGCGGAGG + Intronic
1113981671 13:114281686-114281708 CCGCGCGGGGCCCGAGCGGGAGG + Exonic
1113994249 14:16053472-16053494 GCCGGCCCGGCCCGGCCCGGCGG - Intergenic
1115235630 14:31207079-31207101 CGGCGCCCTGCCTGGCCCGGCGG - Exonic
1115490071 14:33950554-33950576 CGGCGCGCGGCCCCGCCAGCTGG + Exonic
1116006409 14:39296566-39296588 CCGCCCGTGGCCAGGCGCGGTGG - Intronic
1116886935 14:50231315-50231337 CAGCCCGCGGGCCGGGCCGGTGG + Exonic
1117315153 14:54566183-54566205 CCCCGCGCCGCCCGCCCCGACGG + Intergenic
1117875963 14:60249833-60249855 CCGTCCGCCGCCCGGCTCGGGGG - Intronic
1117978647 14:61321505-61321527 CGGTCCGCGGCCCGGCCCTGCGG - Intronic
1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG + Intergenic
1119106784 14:71932457-71932479 TCGCGCTCGGCCCTGCTCGGCGG + Exonic
1119260946 14:73237777-73237799 CCGCGCGCCCCCCGGCCTGGAGG + Intronic
1121352542 14:93184934-93184956 GCGCGCGCGCCCCGCCCCCGAGG - Intronic
1122130846 14:99604025-99604047 CCGCGCGCGGACCGGCCCAGCGG - Exonic
1122137957 14:99645479-99645501 CCGCGCCCCGCCCCGCCCGGTGG - Intronic
1122208338 14:100159476-100159498 CCGCGCGGGGCCCACCCCGGTGG - Intronic
1122221310 14:100240300-100240322 CCGCGTCCCGCCCGGGCCGGGGG - Intronic
1122545395 14:102518998-102519020 CCGGGCGTGGCCAGGCGCGGTGG + Intergenic
1122719709 14:103715394-103715416 CGGCTCGCAGCCCGGCTCGGCGG + Intronic
1122905626 14:104800391-104800413 GCGCGCGGGGCCCGGCCGGGTGG + Intergenic
1122975054 14:105167629-105167651 CCGCGCGCGCCCAGGCGGGGCGG - Intronic
1122982163 14:105196784-105196806 CCCCGCGGCGCCCGGCGCGGGGG + Intergenic
1123036653 14:105474517-105474539 CCGGGGACGGCCCGGCCAGGCGG + Intronic
1123158824 14:106257702-106257724 CCCCGCGCGGCCCTGCAGGGAGG + Intergenic
1124392207 15:29269532-29269554 CTGCGAGCCGCCCGGCCCGCGGG + Exonic
1124477043 15:30044594-30044616 CCCCCCGCCGCCAGGCCCGGCGG + Intergenic
1125516643 15:40324436-40324458 GCTCGAGCGGCCCGGCCGGGGGG - Intergenic
1127221713 15:56887310-56887332 CCGCGCGCGGCCCGGCCCGGCGG - Intronic
1127763793 15:62165337-62165359 CCGCCAGCGGCCCAACCCGGAGG + Intergenic
1127880940 15:63157803-63157825 CCGAGAGCGGCCGGGCCAGGGGG - Intronic
1128528912 15:68431209-68431231 CCGCGCGCCCCTCGGGCCGGAGG + Intronic
1129483377 15:75844423-75844445 CAGCGCGCAGCCAGGCCCGGGGG - Intronic
1129524274 15:76204105-76204127 CCTCGCCCGGCCCAGCCCAGCGG + Exonic
1130115418 15:81001385-81001407 CAGAGCGCGGCCCGGCGCCGCGG - Exonic
1130370890 15:83284594-83284616 CCGCGTCCGCCCCGGCTCGGCGG + Exonic
1130531175 15:84748675-84748697 CCCCGCTCGGCCCGGCCCGCGGG - Intronic
1131133205 15:89913010-89913032 CCGCGCGCGGCCTGGCGTGCAGG - Intergenic
1132186918 15:99808240-99808262 CAGCGCGCGGCCAGGCCCCGGGG - Intergenic
1132251921 15:100341133-100341155 GCGGGCGCGGCCCGGCGCCGCGG - Exonic
1132428771 15:101744481-101744503 CAGCGCGCGGCCAGGCCCCGGGG + Exonic
1132499872 16:280540-280562 CCGGGCGCGGCTGGGCGCGGGGG + Intronic
1132583450 16:695385-695407 CCCCGCCCGGCGCGGCCCGGGGG + Intronic
1132683435 16:1152975-1152997 GCGCGCGCGTCTCGGGCCGGGGG + Intergenic
1132719774 16:1309874-1309896 CGGCGCGGGGCCCGGCTCGGCGG - Intronic
1133771292 16:8868543-8868565 GCTGGCGCGGCCAGGCCCGGCGG + Intronic
1133809427 16:9149608-9149630 CTGCGCCCGGCCAGGCCTGGTGG - Intergenic
1134554442 16:15154167-15154189 CCGCGGTTGGCACGGCCCGGGGG - Intergenic
1134615717 16:15650075-15650097 CCGGGCGCGGCGCGGCCAAGCGG - Intronic
1134849796 16:17470603-17470625 CGGCGCGGGGCCGGGGCCGGGGG + Exonic
1136037230 16:27549645-27549667 CAGCGGGCGGCCTGGCCTGGCGG - Intronic
1136365192 16:29806438-29806460 CCCCGCGGGGCCGGGGCCGGGGG - Intronic
1136365268 16:29806627-29806649 CCGCGCGGGGCCCGGGCTCGGGG - Exonic
1136366489 16:29811528-29811550 CCACGCGCGTCACGGCCCTGAGG + Intronic
1136390603 16:29962011-29962033 CCTCGCGCGGCCCCGCCCCGCGG - Intronic
1136414698 16:30096106-30096128 GCGCGCGGGGCCCGGTCCGCCGG + Exonic
1136546641 16:30958359-30958381 CCGGGCTCGGCCCGGGCCGCTGG + Intronic
1137426410 16:48384914-48384936 CCGCCCTCGGCCCGGCCGCGCGG + Intronic
1138105339 16:54284770-54284792 CCGCTCGCCTCCCGGCGCGGGGG - Exonic
1138327958 16:56191300-56191322 CCGCGCCCTCCCCGTCCCGGGGG + Intergenic
1138360754 16:56425447-56425469 CCCGGCCCGGCCCGGCGCGGCGG - Exonic
1138619134 16:58197875-58197897 CCGCGCCAGGCCGGGCCCGCGGG + Exonic
1139272674 16:65698490-65698512 CCACGTGCGGCCGGGCACGGTGG + Intergenic
1139528475 16:67530229-67530251 CCTGGCCAGGCCCGGCCCGGGGG + Intronic
1139775043 16:69311588-69311610 CCGCCCGCCGCCCGGCTCTGCGG - Intronic
1140078500 16:71723503-71723525 CCGCGCGCCGCCCGCCTCGCAGG - Intronic
1141068231 16:80931195-80931217 CCGGGCGTGGCCAGGCGCGGTGG + Intergenic
1141085968 16:81096009-81096031 CCGCGCTCGCTCCGCCCCGGTGG + Intronic
1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG + Exonic
1142156182 16:88533811-88533833 GGGCGCGCGGGCCGGGCCGGGGG - Exonic
1142299533 16:89248313-89248335 CCGCGCAGAGCCCGGCCCGTCGG + Intergenic
1142333410 16:89470700-89470722 CCGGGCGTGGCCGGGCGCGGTGG + Intronic
1142350178 16:89576101-89576123 CGGCGCCAGCCCCGGCCCGGTGG - Intronic
1142412339 16:89923140-89923162 CCGCGCCCGGCCCAGCGCTGGGG + Intronic
1142547257 17:713747-713769 CCACGCGCGGCCCTGCCTGCAGG - Intronic
1142549969 17:732480-732502 CTGCGCGTGACCAGGCCCGGCGG - Exonic
1142685967 17:1577152-1577174 CCGCGCCCGGCCCTGCTGGGTGG + Intronic
1142757279 17:2023906-2023928 CCGCGCCTGGCCCGGCCAGGAGG - Intronic
1142757509 17:2024771-2024793 CCGGGCGCCGCCCGGCGCCGGGG - Intronic
1142758837 17:2031271-2031293 CCGTGCGTGGCCGGGCACGGTGG + Intronic
1142846121 17:2678112-2678134 CCGGGCGTGGCCAGGCGCGGTGG + Intronic
1142876315 17:2853715-2853737 CGGGGCGCGGCCCGGGCCGGCGG - Intronic
1143030473 17:3964484-3964506 CCCCGCGCCGCCCCGCCCCGGGG - Intergenic
1143479465 17:7220151-7220173 CCCGGCCCGGCCCTGCCCGGCGG + Exonic
1143676416 17:8436150-8436172 CCCGGCCCGGCCCGCCCCGGCGG - Intronic
1143904571 17:10198608-10198630 CCGCGAGCTGCCCGGCCCGGGGG - Intergenic
1144502344 17:15799595-15799617 CCGGGCGTGGCCGGGCGCGGTGG - Intergenic
1145164521 17:20602254-20602276 CCGGGCGTGGCCGGGCGCGGTGG - Intergenic
1145246934 17:21275639-21275661 CCTCGGGAGGCCCGGCCCTGGGG + Intergenic
1145750006 17:27349046-27349068 CCGCCCGCGCCCCAGCGCGGCGG - Intergenic
1146329684 17:31917209-31917231 GCGGGCGCTGCCCTGCCCGGCGG + Intergenic
1146329706 17:31917256-31917278 CCGCGGGCGGCTCGGCAGGGCGG + Intergenic
1146445342 17:32928249-32928271 CCGCGGCCCGCCCGGCCCGGCGG - Intronic
1147123800 17:38352202-38352224 CCTCGCGCGGCCCGGCCCGCGGG + Intergenic
1147307410 17:39573646-39573668 CGGAGCCCGGCGCGGCCCGGCGG - Intergenic
1147599088 17:41734685-41734707 CTACGCGTGGTCCGGCCCGGCGG - Intergenic
1147629010 17:41918329-41918351 CCCCGCGTGGCCCGCCCCGGAGG + Intronic
1147719810 17:42532137-42532159 GCGCGCGACGCCCGGCCCGGCGG - Intergenic
1147900135 17:43778574-43778596 CCGGGCGCGGCCCTTCCCCGTGG - Intronic
1148406802 17:47423457-47423479 CCGCCCGCAGCCAGGCGCGGTGG - Intronic
1148616426 17:49004025-49004047 GAGCGCTCGCCCCGGCCCGGCGG + Intronic
1148664175 17:49362160-49362182 CCCCGCGCTGCCCGCCCCGCCGG - Intronic
1148782523 17:50129906-50129928 CCGCGTCCGGCCAGGCCTGGCGG - Intergenic
1149430624 17:56593749-56593771 CCGCGGCCGGCTCTGCCCGGCGG - Exonic
1149430812 17:56594470-56594492 CCCCCCGAGGACCGGCCCGGCGG + Exonic
1150239823 17:63622571-63622593 CCGCCCGCGGCCGGGCGCTGTGG - Exonic
1150268788 17:63849271-63849293 CCTCGCGCGCCCCCGCCTGGCGG + Intergenic
1151210465 17:72540474-72540496 CCGCCCGCGCCCGCGCCCGGTGG + Intergenic
1151767014 17:76137892-76137914 CCGTCAGCGGCCCGGCCCGGGGG + Exonic
1151783839 17:76265641-76265663 ACCCCCGCGGCCCGGCCCCGCGG - Intronic
1152349700 17:79777936-79777958 CCGCGCGGGGCCCCGGGCGGGGG - Intergenic
1152357022 17:79812487-79812509 CCCCGGCCGGCCCGGCCCGCTGG + Intergenic
1152581189 17:81166238-81166260 GCGCGCGCGGAGCGGCGCGGGGG + Intergenic
1152617161 17:81343285-81343307 CCGAGCATGGCCCGGCCCGGCGG + Intergenic
1152627353 17:81393760-81393782 CTTCGGGCGGCTCGGCCCGGAGG - Intergenic
1152703869 17:81833112-81833134 CCGGGCGGGGCCGGGCGCGGGGG - Intronic
1152817786 17:82418498-82418520 CCGCGTCCGGCCCGGCTCCGCGG - Exonic
1152834367 17:82519851-82519873 GCCCGCGCGGAGCGGCCCGGGGG + Exonic
1152970609 18:158278-158300 CCTGGCGCGGCCCAGCCCTGCGG - Intergenic
1153382493 18:4454967-4454989 CCGCGCACGCCCCAGCCCCGCGG + Intronic
1153688056 18:7566687-7566709 CCGCTCCCGGCCGGGCCCGCCGG - Intergenic
1155654297 18:28176927-28176949 CCGCCCGTGGCCCGGCCCGCGGG + Intronic
1156036601 18:32772086-32772108 CCGCCCGCGCGCCGGCCCGCCGG + Exonic
1156253826 18:35376965-35376987 AGGCGCGCGGCGCGGCGCGGTGG - Intronic
1156275764 18:35581650-35581672 CCGCGCCCGGCTCGGGTCGGCGG - Intronic
1156350569 18:36298087-36298109 CCGCGCCCAGCCCAGCCCAGGGG - Intronic
1156502270 18:37567198-37567220 CCGCGCGAGTCTCGGTCCGGCGG - Intergenic
1157610096 18:48950605-48950627 CCGCGCGCGCCCCGGCCTCCGGG - Exonic
1157867142 18:51197072-51197094 CGGCGCAGGGCCAGGCCCGGCGG - Exonic
1158954273 18:62524037-62524059 CTGCGCGCGGCCCGGGGCGAGGG + Exonic
1159040743 18:63320574-63320596 CCGCACGCGGCCGGGCCGGGCGG + Intergenic
1159045553 18:63366573-63366595 CGGCGCGCGGCCCCGGGCGGGGG - Intronic
1159947828 18:74457221-74457243 GCGCGCGGGGCCCTGCCGGGTGG - Exonic
1160025063 18:75209650-75209672 CCGAGCGCGGCCCGGGCGGCGGG + Intergenic
1160453403 18:78979974-78979996 CAGCGCGCGCCCCGGTCCCGAGG + Intergenic
1160725519 19:616374-616396 CCGCGCCCAGCCCGGACCGCAGG + Exonic
1160791603 19:926066-926088 CGGCGCGCGGCACAGCCCCGTGG + Intronic
1160869274 19:1269592-1269614 TCGCCGGCGGCCCGGACCGGCGG - Intronic
1160948044 19:1652451-1652473 CCCCGCGTGGCCCGTCCCGCGGG + Intronic
1160991867 19:1863398-1863420 CCGCGGGCGGCCCGGCCCCGAGG - Exonic
1161050919 19:2163832-2163854 GCGCGCGCGGGTCGGCCCGCTGG + Intronic
1161051152 19:2164522-2164544 CCGCGCCCGGGACAGCCCGGCGG - Intronic
1161150107 19:2702872-2702894 CCGGGCGCGGGCGGGGCCGGGGG + Intergenic
1161703068 19:5805329-5805351 CCGGGGGGGGCCCGGGCCGGAGG - Intergenic
1162113352 19:8413340-8413362 CCCGGCCCGGCCCGGCCCGTCGG - Intronic
1162363175 19:10231433-10231455 CCGCGTGCGCCCCGGCCAGCCGG - Intergenic
1162426861 19:10602399-10602421 GCGCGCGGGGGCTGGCCCGGCGG + Intergenic
1162731747 19:12722379-12722401 CCGCGCGCGGCCCGGGCGTCGGG - Intronic
1163666681 19:18606854-18606876 CCCGGCCCGGCCCGGCCCCGGGG + Intronic
1164492470 19:28727549-28727571 CGGCTCCTGGCCCGGCCCGGCGG + Intergenic
1165422963 19:35731543-35731565 TCCCGCCCGCCCCGGCCCGGAGG - Intronic
1165871301 19:38975474-38975496 CCGCGCCAGGCCCTGCCCGGAGG - Intronic
1168696768 19:58408272-58408294 CCCCGCGCGGCGCGGTCCGATGG + Intronic
927215850 2:20667441-20667463 CGGCGCGCGGCGCGGGCCCGGGG - Exonic
927558219 2:24050343-24050365 CCGCTCACAGCCCGGCCCGCAGG - Intronic
927652306 2:24920077-24920099 GCGCGCGGGGCCCTCCCCGGCGG + Intergenic
927956773 2:27212322-27212344 GCTCGCGCGACCCGGCCCCGCGG - Exonic
927971325 2:27307682-27307704 CCGCGCGGGGCCCGGCCGATTGG - Exonic
928158138 2:28894977-28894999 CCACGCGCCACCCGGCCCGGAGG - Intronic
929242306 2:39665755-39665777 CCGCCCCCGGCCCGGCCCCCGGG - Intronic
930534510 2:52629903-52629925 CAGCGCCCGGCCTGGCCCGGCGG + Intergenic
931357282 2:61548370-61548392 CCGGGCGTGGCCGGGCGCGGTGG - Intergenic
931735026 2:65186202-65186224 CCGGGTGCGGCCAGGCGCGGCGG - Intergenic
932699903 2:73985211-73985233 GCGCGGGGGGCCCGGCCCGGGGG + Intergenic
935971587 2:108534649-108534671 CCCGGCCCGGCCCGGCCCGAAGG - Intronic
937261224 2:120587683-120587705 GAGGGCGCGGCCCGGCCCGCGGG - Intergenic
937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG + Exonic
940038034 2:149330481-149330503 CCGCGGCCGGCCCGGCCTCGAGG - Intronic
943669788 2:190648852-190648874 CCGCCCCCGCCCCCGCCCGGCGG + Intronic
944415017 2:199471494-199471516 CTCTGCGCGGTCCGGCCCGGCGG + Intergenic
944515754 2:200510122-200510144 CCCCGTGCGGCCCGGCTCTGAGG + Intronic
947435457 2:230068518-230068540 CCGCGCGCGCCGCGGGCCTGGGG - Intronic
947860473 2:233354434-233354456 CCGAGGGCGGGCCGGGCCGGGGG - Intergenic
948415365 2:237798952-237798974 CCGCGTGTGGCCGGTCCCGGCGG + Intronic
948824671 2:240568451-240568473 CGGCGCGGGGCCGGGCCGGGCGG + Intronic
948824790 2:240568909-240568931 CGGCGCGGGCCCCGGCCCGGGGG - Exonic
949004374 2:241637068-241637090 CCGCCCGCGGACCGCCCCGAGGG + Exonic
1168757384 20:326495-326517 CCCCGAGCGGCCCGTCCCGCCGG - Exonic
1168795893 20:610060-610082 CCGCCCGCCGCCCGCCCCCGGGG + Exonic
1170150548 20:13221924-13221946 CCGCGCACGGCCCTCTCCGGCGG - Intronic
1170578623 20:17681976-17681998 CCGCGCGCGGGCCGGGCCGTCGG - Intronic
1170756814 20:19212505-19212527 CCGCGCTCGGCCTGGGGCGGCGG - Intergenic
1170999055 20:21395997-21396019 ACCCGCGCTGCACGGCCCGGGGG - Exonic
1170999398 20:21397282-21397304 CGGCGCGCCACCCGGCCTGGGGG - Exonic
1171767434 20:29297818-29297840 CTGGGCTCGGCCCGGCCCGCTGG - Intergenic
1172118713 20:32585488-32585510 CCCCGCCCGGCCCGGCCCCTGGG + Intronic
1172118752 20:32585590-32585612 CCGGGCCCGGCCCGGCCAGACGG - Intronic
1172284744 20:33732411-33732433 GCGCGCGGGGCCCGGGACGGGGG + Intronic
1172474445 20:35226639-35226661 CTCCGCGCGCCCCGCCCCGGTGG - Exonic
1172474499 20:35226793-35226815 CAGCGCGGGGCCTGGCCCGGCGG - Exonic
1172596614 20:36154803-36154825 CCCCGCGCCGCCCCGCCCCGCGG + Exonic
1173166092 20:40688268-40688290 TCGCGTGCGGCCCGGGCCCGGGG + Exonic
1173279704 20:41617907-41617929 CCCAGCGCGGCTGGGCCCGGGGG + Intronic
1173548082 20:43914641-43914663 CCGGCGGCGGCCCAGCCCGGAGG + Intergenic
1173822559 20:46028898-46028920 CCGGGCGGGGCCCGGCACGTGGG - Intronic
1175399674 20:58693146-58693168 CCTCGTTGGGCCCGGCCCGGCGG - Intronic
1176178785 20:63740214-63740236 CCGCCCCCAGCCCGGCGCGGCGG - Intronic
1178414529 21:32393091-32393113 CCGCGCGAGGCTGGGACCGGCGG + Intergenic
1178555654 21:33588339-33588361 CTGCTCGCGGGCCGGCCCGTCGG + Exonic
1178843670 21:36157100-36157122 CGGCGCGCGGCCCGGGCCTGCGG + Intronic
1178948421 21:36966729-36966751 CCCCGCGCCGCCTGGCCCGGGGG - Intronic
1178992196 21:37366194-37366216 CCCCGCGCGCCCGGGCCTGGAGG - Intronic
1179489300 21:41729890-41729912 CTGCCTGCGGCCTGGCCCGGTGG - Intergenic
1179882791 21:44300422-44300444 CCGCCCGCGCCCTGCCCCGGGGG + Intronic
1180313020 22:11254043-11254065 GCCGGCCCGGCCCGGCCCGGCGG + Intergenic
1180980496 22:19876089-19876111 TCGAGCGCGGCCCCGCCGGGGGG + Intronic
1181087704 22:20449949-20449971 CCGCCGCCGCCCCGGCCCGGAGG - Intronic
1182485411 22:30635971-30635993 CCTGGCGGTGCCCGGCCCGGGGG - Exonic
1182804457 22:33058394-33058416 GCGCGAGCGCCCCCGCCCGGCGG + Intergenic
1183299502 22:37051956-37051978 CCGCTCGCCGCCCACCCCGGGGG - Intronic
1183486455 22:38089666-38089688 CCCCGCCCGGCCAGGCCCGGGGG - Exonic
1183702162 22:39457101-39457123 GCGCCCCCGGCCCGGCGCGGCGG + Intergenic
1184101465 22:42343645-42343667 GCGCGCCCCGGCCGGCCCGGGGG + Intergenic
1184767050 22:46577435-46577457 CCGCGCAGGGCCCTGCTCGGAGG - Intronic
1185336008 22:50271119-50271141 CCGCGGGCGGGCAGGCGCGGGGG + Intergenic
949414315 3:3799583-3799605 CAGCGAGCGGCCAGGTCCGGAGG - Exonic
950282441 3:11719587-11719609 GCACGCGCGGACCGGGCCGGCGG + Intronic
950345332 3:12287864-12287886 CCGAGCCGGGCCCGGCGCGGGGG - Intronic
950509927 3:13420034-13420056 AGGCGCGCGGCCGGGCCGGGCGG - Intronic
953326140 3:42013798-42013820 CCGCGCGCGGCCCCACTCTGGGG - Intronic
953705218 3:45225832-45225854 CCCCGAGCGCCCGGGCCCGGAGG - Exonic
953909025 3:46882606-46882628 CCCCGCGCCGCTCGGCTCGGTGG + Intronic
954110182 3:48429252-48429274 TCCCGCGGGGCCCGGCCGGGTGG - Exonic
954130431 3:48557822-48557844 CCACGCACGGCCGGGCGCGGTGG - Intronic
954256521 3:49411564-49411586 CCCCGCCCGGCCGGGCCTGGTGG - Intronic
954468954 3:50675247-50675269 CCGCGCCCGGCACGGCCATGTGG + Exonic
954838926 3:53494616-53494638 CGGCGTGCGGCGCGGCGCGGCGG + Intergenic
955368708 3:58332859-58332881 CCACGCGCCGCCGGGCCCGCGGG - Exonic
955674501 3:61434790-61434812 CCGCCAGCCGCCCGTCCCGGAGG - Intergenic
959085644 3:101849150-101849172 CCCCGGGCGCCCAGGCCCGGCGG + Intronic
961732116 3:128973367-128973389 CCGCCTGAGGCCGGGCCCGGTGG + Intronic
962323013 3:134406893-134406915 TGGCGCGTGGCCCAGCCCGGGGG - Intergenic
963904568 3:150763056-150763078 CCGCGCGGGGTCCGACGCGGAGG - Exonic
966390944 3:179451608-179451630 GCGCGCGCAGCCCGGGCGGGGGG + Intergenic
966808531 3:183824795-183824817 CCTCGCACGGCTAGGCCCGGCGG + Intronic
966849426 3:184155541-184155563 CGGCGCGCGGCGCGGCCCAGCGG - Exonic
966849440 3:184155589-184155611 CCGCGCGCGGCCTGCTCGGGCGG - Exonic
967858266 3:194134309-194134331 CGGCGCGCGGCCCGGCCAGCAGG + Intergenic
968674954 4:1872000-1872022 CCGCGGCCGCCCCGGACCGGGGG - Intronic
968803253 4:2756456-2756478 CCCCGCGCAGCCCCGCCCGACGG + Intergenic
968820928 4:2850710-2850732 CCGGGCGTGGCCAGGCGCGGTGG - Intronic
969285645 4:6200456-6200478 GCGCGCGCGGCTCGGCGGGGCGG + Exonic
972396852 4:38664759-38664781 CCGCGCCCTGCCCGGGACGGCGG - Intronic
972533185 4:39978035-39978057 CCGCGCGGGGCGCCTCCCGGAGG + Intergenic
972725852 4:41746060-41746082 CCGGGGGCGGCGGGGCCCGGGGG - Exonic
976629145 4:87219892-87219914 CCCCGCGCGGCGTGGCCCGGAGG + Intronic
978385685 4:108173265-108173287 CCGCGCGCGTCCCCGACCCGGGG - Intergenic
978385700 4:108173339-108173361 CTGCGCACGGCCCCGCGCGGCGG + Intergenic
979822545 4:125192034-125192056 CCGCGCTCGGAGCGGCCCGCTGG + Intergenic
979832181 4:125316531-125316553 CCTGGCGCGGCTCGGCCCCGTGG - Exonic
980053687 4:128061153-128061175 CCGGGTGCCGCCCGGCCCGAGGG - Intergenic
983238615 4:165207386-165207408 CCGCCCGCGTCCCGGCCTGCGGG + Intronic
984758152 4:183342823-183342845 CCCCACGCGGCCCGGCCCCGGGG + Intergenic
984889002 4:184474708-184474730 GCGCGAGCGGCCCGGCCGGGAGG + Intergenic
985512865 5:321942-321964 CCTCGCGTCGCCAGGCCCGGCGG + Intronic
986225037 5:5804445-5804467 CAGCGGGCGGCCGGGCACGGTGG + Intergenic
986297112 5:6448794-6448816 CAGGGCGGGGCCGGGCCCGGCGG + Exonic
986330606 5:6713897-6713919 GCGCGCGCGGCCGGGCCTCGGGG + Intergenic
987340671 5:16936356-16936378 CCGCTCGCGGCCCCGCCCCCAGG + Intergenic
988512679 5:31878846-31878868 CCGAGGTCGGCCCGGCGCGGTGG - Intronic
988577796 5:32444089-32444111 CCTGGCCCGGCCCAGCCCGGCGG - Intronic
992530109 5:77645242-77645264 CCGCGCCCCTCCCCGCCCGGGGG + Intergenic
992690521 5:79236597-79236619 CCTCGGGCGGGCCGGGCCGGCGG + Exonic
994107269 5:95961505-95961527 CCGGGCGCGGCCAGGCCGTGAGG + Intronic
997253655 5:132410770-132410792 CTGCGCGTGGCCTGGCCCGGTGG - Intronic
997297471 5:132777076-132777098 CCGCGCGCGCCGTGGCCCAGCGG + Intronic
997302109 5:132813763-132813785 CTGCGGGCGGCGCGGCCCCGCGG - Exonic
997551731 5:134759031-134759053 CCGCGCCAGGCCTGGCCCGGCGG - Intronic
997727301 5:136132701-136132723 CGGCGCGGAGCCCGGCGCGGAGG + Intergenic
1002160556 5:177311943-177311965 CCGCGGGCGGGGCGTCCCGGGGG - Exonic
1002180087 5:177426803-177426825 CGGCCGGCGGCGCGGCCCGGCGG + Intronic
1002415951 5:179121146-179121168 CCCCGCGCGGCCCTGTCCTGCGG - Intronic
1002415997 5:179121339-179121361 CCGAGCCCGTCCCGGCCCGGGGG - Intronic
1002521770 5:179796331-179796353 CGGCGCGCAGCGCGGCCGGGAGG - Exonic
1002524120 5:179806282-179806304 ACGGGCGCGGCCCGGGCCCGAGG + Intronic
1003290754 6:4776524-4776546 CCGAGCGCGAGCCGGCCCGCCGG + Exonic
1003545016 6:7051863-7051885 CAGCCCCCGGCCCGGCCCGGTGG + Intergenic
1004614886 6:17280831-17280853 CCCCGCGCGGCGCGGCGCTGGGG - Intergenic
1004664075 6:17735266-17735288 CGGCGAGCCGCCCGGTCCGGAGG - Intergenic
1006148315 6:31972183-31972205 CGGCGTGGGGCCCGGCCTGGCGG + Exonic
1006337442 6:33428001-33428023 GCTCGCGCCGCCCGGCGCGGTGG - Intronic
1007367789 6:41406968-41406990 CAGAGCGCGGCGCGGCGCGGCGG + Intergenic
1007701777 6:43770118-43770140 CCGCCCCCGGCCCGCCCCGGGGG - Intergenic
1007759835 6:44127428-44127450 GCGCGCCAGGCCCAGCCCGGCGG + Exonic
1007902061 6:45422088-45422110 CAGCGCGCGGCGCGGCGCGGCGG + Intronic
1010244800 6:73653514-73653536 CCGCCCCCGCCCCCGCCCGGTGG + Intronic
1013459055 6:110358117-110358139 CCCCGCCGGGCCCGGCCTGGCGG - Exonic
1016329839 6:142945025-142945047 CGGCGCGAGGCCCGGGCCGCCGG - Intronic
1016386697 6:143536891-143536913 CCCCGCGCGCCGCGACCCGGAGG - Intronic
1017103346 6:150866569-150866591 CCGCGCGCGGCCCCTCCTGCTGG + Intronic
1017206513 6:151808502-151808524 GGGCGCGCGGCCCAGCCCGGGGG + Intronic
1017497637 6:154995561-154995583 CCGCGCGCCGCCCCGCCCGCAGG - Intronic
1017719709 6:157236081-157236103 CCGCGCTCGGCTCCGCCTGGGGG + Intergenic
1018628727 6:165804788-165804810 CCGCCCGCGGCCCGGCCCCGGGG - Intronic
1018876596 6:167827088-167827110 CCGCGCGGGGCCGGGGCCGGAGG - Exonic
1019253415 7:33080-33102 CCGCCCGCAGCCAGGGCCGGCGG + Intergenic
1019279573 7:193044-193066 CTGCACGCGGCCCGGGCCCGGGG + Exonic
1019313310 7:373246-373268 CAGCCTGCGGTCCGGCCCGGAGG - Intergenic
1019343599 7:519561-519583 CCGCGCTGTGCCCGGCCGGGCGG - Intronic
1019711524 7:2520173-2520195 GCGCGAGCGGCTCGGCCAGGGGG - Exonic
1020274373 7:6615701-6615723 CCGCGCGGGGGCCGGGGCGGGGG - Exonic
1021992531 7:26152207-26152229 CCGCCCGCAGCCCGGCGCGGTGG - Intergenic
1021998515 7:26202207-26202229 CCGCGCGCCGCCAGGCCTCGCGG - Intronic
1022020875 7:26398541-26398563 CCCCTCCCGGCCCGGCTCGGCGG + Intergenic
1024255417 7:47537058-47537080 CCGCGCGCGAACCCTCCCGGTGG + Intronic
1026098315 7:67364654-67364676 CCGAGCCCTGCCCGGCCGGGAGG + Intergenic
1026765015 7:73154956-73154978 GCGCGCGGCGCCCGGCGCGGGGG - Intergenic
1027198603 7:76048262-76048284 ACGCACGTGGCCCGGGCCGGGGG - Intronic
1029285942 7:99466158-99466180 CCTCGCGCGGTCCGGCACAGCGG - Exonic
1029730096 7:102433404-102433426 CCCCGCCCCTCCCGGCCCGGCGG + Intronic
1032095801 7:128938084-128938106 CCGCGCCCGGCGCGCCCCGAGGG + Intronic
1032127471 7:129205418-129205440 CCGCGGGAGGGCAGGCCCGGGGG + Intronic
1033253251 7:139777961-139777983 CAGCGCGCGGCCAGGGCCGGCGG + Intronic
1034147237 7:148884130-148884152 CTGCGGGCGGCCCGGCCGGCGGG - Intronic
1034412305 7:150947829-150947851 CCCCGCCCGGCCCGGCCCCAAGG + Exonic
1034446288 7:151115723-151115745 CCGCGCGCGTCCGGGGCTGGCGG + Intronic
1035022676 7:155808589-155808611 CCGCGCGGAGCCCGGGCCGGAGG - Intronic
1037903831 8:22703774-22703796 CCGCCCGCGGCCCGGGCGGCGGG - Intergenic
1039875032 8:41578098-41578120 GCGCGCGCGGGCCGGCAGGGCGG - Intronic
1040471246 8:47737587-47737609 CCGGGCGGGGCCGGGCGCGGGGG + Exonic
1040599522 8:48870238-48870260 CCCCGCGCCTCCCGGCCGGGCGG - Intergenic
1040610541 8:48977919-48977941 CCGCGCAGGGCCGGGCCAGGAGG + Intergenic
1041689887 8:60678658-60678680 GCGGGCGCGGCGCGGCCCGGAGG + Intergenic
1042965829 8:74350713-74350735 CCGGGCGCGTCCCCGCCTGGAGG - Intronic
1043388154 8:79768013-79768035 CCGCGCCCGCCCCTGCCCGGCGG + Intergenic
1044306398 8:90645743-90645765 CCGCGCTCGCCCCGCCCCCGCGG + Exonic
1045063458 8:98426958-98426980 CTGCGCGGGGCGCGGCGCGGTGG - Intronic
1045663934 8:104466547-104466569 CCTCGCGCGGCGCGGCGCCGAGG - Intronic
1047961752 8:130016320-130016342 GCGCGCGCGGGCCGGCCGGGCGG + Intronic
1048833398 8:138497154-138497176 GGGCGCGCGGCGCGGCGCGGAGG - Intergenic
1049396457 8:142403235-142403257 CCGCGCGCGTCCGGGACCGGCGG - Intronic
1049649867 8:143760904-143760926 CGGGGCGCGGCCCAGCGCGGTGG + Intergenic
1049657136 8:143803912-143803934 CTGCGAGCGGCCAGGCCCCGCGG + Exonic
1049718416 8:144104467-144104489 AGGCGCGGGGCCGGGCCCGGCGG + Intronic
1049747985 8:144271051-144271073 CCGTGCGGGGCCTGACCCGGAGG - Intronic
1051780558 9:20684344-20684366 CCGCAGGCGGCGCGACCCGGCGG - Intronic
1053153427 9:35757092-35757114 CCGCCGGAGGCCCGGCCGGGCGG + Exonic
1053569431 9:39288487-39288509 CCGCGGCCGCCCCGCCCCGGTGG - Intergenic
1053835392 9:42129508-42129530 CCGCGGCCGCCCCGCCCCGGTGG - Intronic
1054127715 9:61330523-61330545 CCGCGGCCGCCCCGCCCCGGTGG + Intergenic
1054595234 9:67059102-67059124 CCGCGGCCGCCCCGCCCCGGTGG + Intergenic
1054820619 9:69517009-69517031 CCGCGCCCAGCTCGGCCAGGAGG - Exonic
1055447014 9:76394045-76394067 CCCCACGTGACCCGGCCCGGGGG + Intronic
1057752459 9:97803666-97803688 CTGTGCGCGGCCAGCCCCGGCGG + Intergenic
1058618777 9:106862443-106862465 GCGCGCACGCCTCGGCCCGGCGG + Intergenic
1058861282 9:109119822-109119844 CCGCGCGCGGTCGGGCCGAGTGG - Exonic
1060283159 9:122227352-122227374 CCTCCAGCGGCCCGGCCCTGGGG - Intronic
1060296500 9:122347045-122347067 CGGGCCGCGGCCCGGCCGGGCGG + Intergenic
1061737262 9:132670122-132670144 CCGCGCGTGCCCCCGCCTGGTGG + Exonic
1062272175 9:135714571-135714593 CCGCAGGCGGCCCTGCGCGGGGG + Exonic
1062491640 9:136807871-136807893 CCGCGCGCGCCGCGCCCCCGCGG + Intergenic
1062574609 9:137200369-137200391 GCCCGCGCCGCCCGCCCCGGGGG - Exonic
1062600270 9:137316159-137316181 TCCCACGCGGCCCGGCCCGGCGG - Intronic
1062640029 9:137514333-137514355 CCGCCCGCAGCCCGGCCACGGGG - Intronic
1062653437 9:137590144-137590166 CCGCCCCCGGCCCCGCGCGGAGG + Intronic
1185471445 X:386443-386465 CAGCGCAGGGCCCGGCCCGGGGG + Exonic
1185471535 X:386725-386747 CCGCGCCCCGCCCCGCCCCGGGG + Intronic
1185836035 X:3346562-3346584 ACTCGCGCGCCCCGGCTCGGTGG - Exonic
1186496448 X:10015537-10015559 GCGCGCGCGGGGCGGCCGGGCGG + Intergenic
1189731832 X:44029111-44029133 CCACGCGGGGCCGGGCGCGGTGG - Intergenic
1192344492 X:70289985-70290007 GCGCGCGCAGGCCGGCGCGGTGG - Intronic
1197035794 X:121871285-121871307 CCGCGCACGGCCAGGCACGCTGG - Intergenic
1197754306 X:129983709-129983731 CCCCGCCGCGCCCGGCCCGGCGG - Intronic
1199772741 X:150984408-150984430 CCGCGCGCGGCCGGCGCGGGCGG - Intronic
1200128909 X:153830643-153830665 CCGCGCGCCTCCCCGCCCGCGGG + Intergenic
1200173794 X:154097761-154097783 CAGCGCGCGGGCCGGCCAAGAGG - Intergenic