ID: 1127226799

View in Genome Browser
Species Human (GRCh38)
Location 15:56939774-56939796
Sequence ATTAGCTGAGTGGAGACGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127226797_1127226799 -8 Left 1127226797 15:56939759-56939781 CCGAAACTTACGTTGATTAGCTG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1127226799 15:56939774-56939796 ATTAGCTGAGTGGAGACGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 138
1127226794_1127226799 29 Left 1127226794 15:56939722-56939744 CCTAGCACAAGCTGCATGGTGAG 0: 1
1: 0
2: 0
3: 17
4: 168
Right 1127226799 15:56939774-56939796 ATTAGCTGAGTGGAGACGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127226799 Original CRISPR ATTAGCTGAGTGGAGACGTG AGG Intronic