ID: 1127229842

View in Genome Browser
Species Human (GRCh38)
Location 15:56978520-56978542
Sequence CAGAATTGTTTCAAAAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127229837_1127229842 16 Left 1127229837 15:56978481-56978503 CCCAGACAAAACAATACATTTTT 0: 1
1: 0
2: 10
3: 81
4: 818
Right 1127229842 15:56978520-56978542 CAGAATTGTTTCAAAAAGCAAGG 0: 1
1: 0
2: 2
3: 45
4: 410
1127229838_1127229842 15 Left 1127229838 15:56978482-56978504 CCAGACAAAACAATACATTTTTA 0: 1
1: 2
2: 6
3: 62
4: 653
Right 1127229842 15:56978520-56978542 CAGAATTGTTTCAAAAAGCAAGG 0: 1
1: 0
2: 2
3: 45
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127229842 Original CRISPR CAGAATTGTTTCAAAAAGCA AGG Intronic
900969662 1:5984225-5984247 CTGAATTTTTTTGAAAAGCAAGG + Intronic
901150668 1:7099047-7099069 CAAAATTTTTTTAAAAAGCATGG - Intronic
901359960 1:8689200-8689222 CAGAATTCTTTCAGAATGAAGGG + Intronic
903429930 1:23287877-23287899 TAAATTTGTTTCATAAAGCAAGG - Intergenic
903913391 1:26745442-26745464 CTGAATTGTATCCAAAACCAAGG + Intronic
906775520 1:48525976-48525998 CAGAATTGTAACAACAAGCGAGG - Intergenic
906834703 1:49070785-49070807 TGGAATTGTTTCAAAAGGAATGG + Intronic
907894415 1:58672128-58672150 AAAAATTGTTTCAAAAGACACGG + Intronic
908103327 1:60813497-60813519 GATAATTCTTTCAAAAAGAAGGG - Intergenic
908455002 1:64295027-64295049 CAGATTTGTTCCCAAAACCATGG + Intergenic
908833655 1:68207069-68207091 AAGAACTGTTCCTAAAAGCAAGG + Intronic
909181334 1:72427572-72427594 TAGAATAGTTTCAGAAAGAATGG + Intergenic
909343315 1:74556007-74556029 CAGAATGGTTTCAGAAGGAATGG - Intergenic
909526675 1:76631823-76631845 CATAATTCTATGAAAAAGCAAGG + Exonic
909635247 1:77810551-77810573 CAGTATTGTTCCAGGAAGCAGGG + Intronic
910857829 1:91713547-91713569 CAGAATCATTTCAAAAGACATGG + Intronic
911584414 1:99674065-99674087 GATAATTGTTTAAAAAACCAGGG - Intronic
911712949 1:101095984-101096006 CAGAATAGTTTCAAAAGGGTGGG - Intergenic
911958956 1:104273839-104273861 CAGTATTTTTTCAAAAACTAGGG - Intergenic
912051031 1:105527651-105527673 GAGAATTGGTTGAAAAAGAATGG - Intergenic
912271852 1:108219205-108219227 CAGTATTCTTTCAACAAACAAGG - Intergenic
912855496 1:113165509-113165531 CAGAGATGTTTCAAAAATCATGG + Intergenic
914397375 1:147283089-147283111 CAACATTTTTTTAAAAAGCATGG + Intronic
916557127 1:165902857-165902879 GTGAATTTTTTAAAAAAGCAGGG - Intronic
916712344 1:167422878-167422900 AAGACTTCCTTCAAAAAGCAGGG - Exonic
917079380 1:171240933-171240955 CAGAATAGTTTCAGAAGGAATGG - Intergenic
917900457 1:179537745-179537767 CAGAATAGTTTCAGAAGGAATGG + Intronic
919299025 1:195737746-195737768 AAAAATTGTTTCAAAAACTATGG + Intergenic
919665904 1:200291642-200291664 CAGAATTCATTGAAAAAGCACGG + Intergenic
919749376 1:201027028-201027050 CAGAGTTGTTATAAATAGCAAGG + Intergenic
920893884 1:210023758-210023780 GAGAATTATTTCAACAAGCATGG + Intronic
921026763 1:211291436-211291458 CAGAAGTGTTTCAAATTTCAGGG - Intronic
921436431 1:215128804-215128826 AAGAATTGTTTAAAGAAGTAGGG + Intronic
921474063 1:215584254-215584276 GAAAATTGTTTCAAAAACTATGG - Intronic
921535881 1:216348728-216348750 AAGAATTGCTTCAAAAACTATGG + Intronic
921947937 1:220900025-220900047 CAGAATAGTTTCAGAAGGAATGG + Intergenic
922121099 1:222669581-222669603 CAGTATTGTTCCAGGAAGCAGGG + Exonic
923815861 1:237377911-237377933 CTGCATTGTTTCAAAGAGTAGGG + Intronic
1063338325 10:5238388-5238410 CAGAATAGTTTCAGAAGGAATGG - Intergenic
1064258223 10:13763641-13763663 AGGAATTTTTTCAAAAACCAAGG - Intronic
1064711394 10:18129984-18130006 CAAAATTTATTTAAAAAGCAGGG - Intergenic
1065075681 10:22076876-22076898 TGGAATAGTTTCAAAAAGAATGG + Intergenic
1066333661 10:34453306-34453328 CAGAGTGGTAACAAAAAGCATGG - Intronic
1066555531 10:36608630-36608652 CATTATTCTTTCAAAAAGAATGG - Intergenic
1067113809 10:43419678-43419700 CATAATAGTTTCAAATAGCTAGG - Intergenic
1067656584 10:48196745-48196767 AAGAAATATTTTAAAAAGCAAGG + Intronic
1067786078 10:49249061-49249083 AAGAATAGTTTCAGAAAGAATGG - Intergenic
1068207282 10:53872015-53872037 CAAAATTGCTTCAAAAATGAGGG - Intronic
1068474229 10:57505580-57505602 AATAACTGTTTCAAAATGCATGG - Intergenic
1069669252 10:70188058-70188080 GAGAATTTGTTCAAAAAGAAGGG + Intergenic
1071718703 10:88121694-88121716 CAGAGTTGTTTCAAGATTCAGGG - Intergenic
1072584136 10:96766310-96766332 CACAACTGTTTTAAAAGGCAAGG + Intergenic
1072727014 10:97820899-97820921 TTGAATTGTTACAATAAGCATGG - Intergenic
1073930512 10:108568841-108568863 CAGAATAGTTTCACTGAGCAGGG - Intergenic
1074964640 10:118479525-118479547 CTGAAATGTTTCAAACAGCTTGG + Intergenic
1075189625 10:120294928-120294950 GAGAATTGTTTCAGAAATCTTGG + Intergenic
1077640223 11:3874656-3874678 CAGAGTAGTCTGAAAAAGCAGGG - Intronic
1079539373 11:21553371-21553393 CAGAAATGTTTCAATAATTATGG + Intronic
1079578136 11:22028527-22028549 CAGAATAGTTTCAGAAGGAATGG - Intergenic
1079822623 11:25149902-25149924 CGGAATTCTTTGAAAAAGAAAGG - Intergenic
1079991002 11:27246979-27247001 CTGAATAGTCACAAAAAGCAGGG + Intergenic
1080519011 11:33050282-33050304 CACAATTTTTTGCAAAAGCAAGG + Intronic
1080936870 11:36872989-36873011 CATACTTTTTTTAAAAAGCAAGG + Intergenic
1082195076 11:49294053-49294075 CAAAAATGTTTCAAAAAATATGG + Intergenic
1083003356 11:59318020-59318042 TAGAATAGTTTCAGAAAGAATGG + Intergenic
1083686360 11:64378386-64378408 CAGCACTGTTTAAAATAGCAAGG - Intergenic
1085218354 11:74851634-74851656 CAGAACTGTTCCACAAAGCAGGG + Intronic
1086261085 11:84941795-84941817 CAGAATAGTTTCAATAAGACTGG + Intronic
1086415567 11:86586091-86586113 CAAAACTTTTTCAAAAAGCTTGG + Intronic
1087020446 11:93597329-93597351 CAGGTTAGTTTCAATAAGCAAGG + Intergenic
1087364326 11:97199899-97199921 CAAAATTGTTTCATAAATGAAGG - Intergenic
1087538605 11:99485233-99485255 CAAAATTGTTTAAAAAAAAAAGG + Intronic
1087623960 11:100574324-100574346 GAGAATCATTCCAAAAAGCAAGG + Intergenic
1088659436 11:112030751-112030773 CAGAATTATTTAGAAAAGGACGG - Intronic
1089962762 11:122630371-122630393 AAAAATTGTTTCAAAAAGCCTGG - Intergenic
1089965730 11:122653929-122653951 CTGAATTGTTTCCAAATGCCTGG - Intergenic
1090290853 11:125543232-125543254 AAGAATTTTTTTAAAAAACATGG + Intergenic
1091484007 12:866307-866329 CTGAATTCTTTTAAAAAGCGGGG + Intronic
1091608754 12:1984162-1984184 CAGATTGGATTAAAAAAGCATGG - Intronic
1094643264 12:32296936-32296958 CAGAAGTTTTTTAAAAAGGAGGG + Intronic
1095332090 12:40978240-40978262 CATAATTGTATTAAAAAACAGGG - Intronic
1095356730 12:41283449-41283471 CAGAATAGTTTCAGAAGGAATGG - Intronic
1096006067 12:48173099-48173121 TAGAAGTGTTTCAAAAAATAGGG + Intronic
1097451442 12:59741627-59741649 TAGAGTTCTTTCAAGAAGCAAGG + Intronic
1098783049 12:74712479-74712501 GTGAATTTTTTCAAAATGCAAGG + Intergenic
1098819728 12:75211957-75211979 CAGAATTGATACACAAAGCAAGG + Intergenic
1098820031 12:75215587-75215609 AAGAATTGTTTTTCAAAGCAAGG - Intergenic
1099026067 12:77466029-77466051 CAGACATTTTTTAAAAAGCAGGG - Intergenic
1099078164 12:78138626-78138648 CAGAACCATTTCAGAAAGCAGGG - Intronic
1099216961 12:79864906-79864928 CAGAATAGTTTCAGAAGGAATGG - Intronic
1099418029 12:82418003-82418025 CAGTGTTGTGACAAAAAGCAGGG + Intronic
1100849465 12:98694488-98694510 AAGAAATCTTTCAAAAAGTAGGG - Intronic
1101263757 12:103063388-103063410 CAGCATTGATTGAAAAAGAATGG + Intergenic
1104353430 12:128064672-128064694 CAGAATTGATGCAACAAACAAGG + Intergenic
1104521367 12:129478521-129478543 CTGAACTGTTCCAAAAATCAAGG - Intronic
1105264836 13:18806626-18806648 CAGAAATCTTTCAATAATCATGG + Intergenic
1106402896 13:29446368-29446390 CAGATTTGTTTCAAAGATCTTGG + Intronic
1106491511 13:30228324-30228346 CAGTATTTTTTAAAAAAACAAGG + Intronic
1106854808 13:33839317-33839339 CAGACTTGGTTCAAAAAGGATGG - Intronic
1107187328 13:37538984-37539006 GAAAACTGTTTAAAAAAGCAGGG + Intergenic
1109008155 13:56904742-56904764 CTGAATTATTTCAAAAATGAAGG - Intergenic
1109132780 13:58610046-58610068 CAAATTTGTTTCAAATTGCAGGG + Intergenic
1109144904 13:58767348-58767370 GATAACTGTTTCAAAAAGCCAGG + Intergenic
1109298149 13:60560869-60560891 AACAACTGTTTCAAAATGCATGG - Intronic
1109591693 13:64492067-64492089 CAGAATTGTTTAATACATCATGG + Intergenic
1109615747 13:64831601-64831623 CTGAATAGTTTCAGAAAGAATGG - Intergenic
1109657206 13:65408702-65408724 CAGGATTGTTTGTATAAGCACGG + Intergenic
1109663316 13:65494441-65494463 CAGCATTGCTTCAGAAAGCAAGG + Intergenic
1110159447 13:72358310-72358332 CAGAATAGTTTCAGAAGGAACGG + Intergenic
1110393654 13:75004969-75004991 AAGAATTGGTTAAAACAGCATGG - Intergenic
1110500088 13:76217280-76217302 CAAAATTGTTCATAAAAGCAGGG + Intergenic
1110715622 13:78700665-78700687 CAGACATTTCTCAAAAAGCAGGG - Intergenic
1110748796 13:79088592-79088614 CTGAATTGATTAAAAGAGCAAGG + Intergenic
1110785792 13:79524055-79524077 CTGAAGTGTTTCAAATGGCACGG - Intronic
1111817973 13:93178482-93178504 CAGACTGCTTTCAAAAGGCATGG + Intergenic
1112444050 13:99447471-99447493 CAAAATAGTTTCAAAAGGCCGGG + Intergenic
1113573290 13:111373972-111373994 TATAATTGTTTAAAAAAACAGGG - Intergenic
1114274876 14:21133988-21134010 AAGCATTCTTTCAAAAAGTATGG - Intergenic
1116101644 14:40445617-40445639 CAAAATTGTTTAAAATAACATGG + Intergenic
1116275337 14:42825082-42825104 ATGATTTGTTTCAAAATGCAAGG + Intergenic
1116662482 14:47728886-47728908 CAGAATTGTTTAAATAATAAAGG - Intergenic
1116946065 14:50836301-50836323 CAGAAATGTTTTAAAATGTATGG - Intergenic
1118140477 14:63075161-63075183 TAGGATAGTATCAAAAAGCAAGG - Intronic
1119073438 14:71610975-71610997 CAGAATTCTGTCCCAAAGCATGG - Intronic
1119311554 14:73650989-73651011 CACATTTATTTCAATAAGCATGG - Intronic
1120495668 14:85231604-85231626 CAAAACTGTTTCAAAAATCAAGG - Intergenic
1121707119 14:96005527-96005549 TAGAATAGTTTCAAAAGGAATGG - Intergenic
1122191732 14:100050312-100050334 CACAAATTTTTAAAAAAGCAAGG - Intronic
1202833626 14_GL000009v2_random:61493-61515 CAGAAATCTTTCAATAATCATGG - Intergenic
1124487508 15:30132541-30132563 CACAATTGTTTCAAGAAACTCGG + Intergenic
1124542597 15:30601519-30601541 CACAATTGTTTCAAGAAACTCGG + Intergenic
1124918555 15:34000595-34000617 CAGAATTGTTTCAAGGAGTATGG + Intronic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1125216157 15:37277834-37277856 CAAAACTGTTTTCAAAAGCAAGG - Intergenic
1127199959 15:56634759-56634781 CACAATAGTTTCAAAACTCAGGG - Intronic
1127229842 15:56978520-56978542 CAGAATTGTTTCAAAAAGCAAGG + Intronic
1128902224 15:71434780-71434802 AAGGATTGTTTCAAAAAGAAAGG - Intronic
1130414420 15:83678283-83678305 AAGAAGTGTTCCAAAAAGAAAGG - Intronic
1133697474 16:8278588-8278610 TAGAGATGTTTCAAAATGCAAGG + Intergenic
1134227695 16:12404162-12404184 GAGAATTCTTTCCAAAAGAAGGG + Intronic
1135800825 16:25493513-25493535 CACAAGTGTTCCAACAAGCAAGG + Intergenic
1137420179 16:48326698-48326720 CAAGATTTTTTCAAACAGCAAGG + Intronic
1138094131 16:54199092-54199114 AAGAATTAAATCAAAAAGCAGGG - Intergenic
1139352491 16:66346013-66346035 AAGAATTTTTTTTAAAAGCAAGG + Intergenic
1140314356 16:73880191-73880213 CAGATTTGCCCCAAAAAGCAAGG + Intergenic
1141620213 16:85233336-85233358 CAGAATTGTCACCAAAATCAAGG + Intergenic
1143276773 17:5717422-5717444 CAAAACTCTTTCAAAAAGGAAGG - Intergenic
1143373138 17:6452818-6452840 CAGAGCTGTTTCCAAAAGGAAGG + Exonic
1144249898 17:13405848-13405870 CACAATTTTTTTAAAAAGCTGGG + Intergenic
1144377201 17:14656250-14656272 CAGAATTCCTTGAAAAATCAGGG - Intergenic
1145341515 17:21958774-21958796 TAGAATGGATTCAAAAAGAATGG + Intergenic
1146675695 17:34772442-34772464 CAGAATCGCTTGAAACAGCAAGG + Intergenic
1146839171 17:36137946-36137968 CAGAATTGCTTCTACATGCATGG - Intergenic
1150575115 17:66423966-66423988 GAGAATTGTTTTAATAAACAGGG - Intronic
1150926778 17:69540589-69540611 CAGGATTGTTTTGAAATGCATGG + Intronic
1151482026 17:74375322-74375344 CAAAATTGTTTCAACCAGCCTGG - Intergenic
1152916430 17:83039185-83039207 CAGCAGTGTGTCAAAAAGCCAGG - Intronic
1153144278 18:2012177-2012199 GACAATTGGTTCAGAAAGCATGG - Intergenic
1153834018 18:8948437-8948459 TAGAATTGTTGGGAAAAGCAAGG + Intergenic
1154004042 18:10511521-10511543 CACAATTGTTTCTGACAGCAGGG + Intergenic
1154423558 18:14254924-14254946 CAGAAATCTTTCAATAATCATGG - Intergenic
1155730852 18:29156387-29156409 CACAATTCTTGCAGAAAGCAAGG - Intergenic
1155790736 18:29967183-29967205 CAGAATTGTTTGAAAAATATTGG - Intergenic
1156742261 18:40345782-40345804 CAGATTTGTTTTAAAAAGCTGGG + Intergenic
1156749160 18:40429575-40429597 CAGAATTGTTTATAATAGCAAGG + Intergenic
1158187709 18:54790551-54790573 CAGATTACTTTCAAAAAGCAAGG + Intronic
1158203689 18:54967366-54967388 TAGTTTTGTTTCCAAAAGCAAGG - Intergenic
1158327292 18:56325544-56325566 CAGAATTCATCCAAAAAGCCCGG + Intergenic
1158398002 18:57094812-57094834 GAGAATTGTTCCAAAGAGCAGGG - Intergenic
1159963137 18:74571349-74571371 CAGAGCTGGTTCAGAAAGCAAGG - Intronic
1163254247 19:16145543-16145565 AAGAAATGTTTAATAAAGCAGGG - Intronic
1164494997 19:28752208-28752230 TTGAAGTGTTTCAAAAAGAAAGG - Intergenic
1164964018 19:32464539-32464561 CAGAAGTGTTTAAAAAAGCCGGG + Intronic
1165903807 19:39181362-39181384 TAGAGTTGTTTCAAATGGCAGGG + Intronic
1167810134 19:51822470-51822492 CAGAATTGTTGCATAGAGAAAGG + Intronic
1168268392 19:55236163-55236185 CAGACTTGTCTCAAAAAAAAAGG - Intronic
1202639041 1_KI270706v1_random:66199-66221 CAGAAATCTTTCAATAATCATGG + Intergenic
925068284 2:947154-947176 GAGAATTGTTTCAACCAGCGAGG + Intergenic
925125433 2:1452204-1452226 CACAATTGATTTAATAAGCACGG + Intronic
925397058 2:3541845-3541867 CAGAGCTGTTTTAAAAAGCAAGG + Intronic
927160571 2:20254900-20254922 CAAAATTGTTTCCGAAATCAGGG - Exonic
927951821 2:27175560-27175582 GAGAAGTGTTTCAAGAAGGATGG - Intergenic
928830865 2:35481185-35481207 CAGAATAGTTTCAGAAGGAATGG - Intergenic
929256872 2:39821063-39821085 CAGCATTGTTTGTAAAAGCAAGG - Intergenic
930205432 2:48583005-48583027 CAGTCTTATTTCAAAGAGCAGGG - Intronic
930623986 2:53675980-53676002 CAGAATTTTTACAAAATACATGG + Intronic
930793693 2:55364202-55364224 AATAATTATTTTAAAAAGCAAGG + Intronic
931807246 2:65819135-65819157 AAAAATTGTTTCAAGAAGGAGGG - Intergenic
931842189 2:66165175-66165197 CAAAAATGTTTCAAGAAGGAGGG + Intergenic
932072344 2:68634059-68634081 CAAAATTGTTTTTAAAAGAATGG - Intergenic
932119817 2:69088242-69088264 CAGAGTTGGTTCAAAAAGGTTGG + Intronic
932171332 2:69559561-69559583 TAGAATTTTTTAAAAAATCACGG + Intronic
932307055 2:70711529-70711551 CAGAGTTTTTTTAAAAATCAAGG - Intronic
933029539 2:77310775-77310797 CAGTATTATTTAAAAAATCATGG - Intronic
933129150 2:78651401-78651423 CAGAATTATTTCAACCAGGAAGG - Intergenic
933323735 2:80810110-80810132 CAGAATAGTTTCAGAAGGAATGG - Intergenic
934939720 2:98491788-98491810 CAGAATTGTCTTTAAAATCAGGG + Intronic
937101897 2:119278003-119278025 AAGAATAGTTTTAAAAATCACGG - Intergenic
937732024 2:125244496-125244518 CAGAATTGCTTTAAAAAGAGAGG - Intergenic
939258353 2:139774233-139774255 CAGTAGTGTTTCATCAAGCATGG + Intergenic
939743198 2:145935812-145935834 GATATTTGTTTCTAAAAGCAAGG + Intergenic
940619458 2:156092794-156092816 AAGGATTGTTTCCAAAACCAAGG - Intergenic
941363820 2:164585246-164585268 GAGATTTATTTCAAAATGCATGG - Intronic
941399782 2:165016409-165016431 AAGAATTTTTTAAAAAAGAAAGG + Intergenic
942803783 2:179905675-179905697 CACAACCTTTTCAAAAAGCAAGG - Intergenic
943173565 2:184436236-184436258 CAGAATTGTATGAAATATCAAGG - Intergenic
943922488 2:193726888-193726910 AAGAAATGTCTCAAAAAGTAAGG - Intergenic
943935721 2:193913750-193913772 GAGAATAGTTTCAAAATGGATGG + Intergenic
944231718 2:197401440-197401462 CAGAAGTGTTTAAAAAAGGGAGG + Exonic
944448328 2:199815025-199815047 CATCATTGTTTAAAAATGCAGGG - Intronic
944492896 2:200276341-200276363 CAGAATTGTTTCTAAAATTCTGG - Intergenic
945240254 2:207670124-207670146 CACAAGTGTTCCAAAGAGCATGG + Intergenic
945268700 2:207916822-207916844 CAGAGATCTTTCAAAAAGCCAGG - Intronic
945778259 2:214134146-214134168 TTGAATTGATTCAAAAAGCGTGG - Intronic
945994911 2:216428354-216428376 CTACATTCTTTCAAAAAGCAAGG + Intronic
947171461 2:227316841-227316863 CAGTATTTTTAGAAAAAGCATGG - Intergenic
947376068 2:229496201-229496223 CACAATACTTTCAAAAAGAAAGG - Intronic
948780435 2:240318471-240318493 CCTAGTTGTTTCAATAAGCAGGG + Intergenic
1169726875 20:8744445-8744467 TAAAATTGTTTCAAATAGCTGGG + Intronic
1170201675 20:13750681-13750703 TACAATCCTTTCAAAAAGCAGGG + Intronic
1170365923 20:15598325-15598347 CAGAACTTTTTTAAGAAGCAGGG + Intronic
1171885652 20:30650390-30650412 CAGAAATCTTTCAATAATCATGG + Intergenic
1171923117 20:31166974-31166996 CAGAATTGTCTCAAATAGAATGG + Intergenic
1173138433 20:40460447-40460469 AGGAAATGATTCAAAAAGCAAGG + Intergenic
1173417982 20:42875352-42875374 CAGAATTGATAGAAAAGGCAAGG - Intronic
1173707920 20:45126484-45126506 CACAATTTTTTAAAAAAACACGG - Intergenic
1173885022 20:46449842-46449864 AACAATTGTCTCAAAAAACATGG - Intergenic
1174091846 20:48055395-48055417 CAGACTTGTTTCAGTAAGAAGGG - Intergenic
1174107041 20:48169920-48169942 GGGAATTGTTTCCAAAAGGATGG - Intergenic
1176849915 21:13905084-13905106 CAGAAATCTTTCAATAATCATGG + Intergenic
1176909394 21:14544977-14544999 CAGAAAAGTTTTTAAAAGCATGG - Intronic
1177333326 21:19690273-19690295 CAGAATTTTTTTTAAAATCAGGG - Intergenic
1177676827 21:24310802-24310824 CTGTTTTGTTTTAAAAAGCAAGG - Intergenic
1177879876 21:26679842-26679864 AAGATTTGTTTGAAAAAGTAAGG + Intergenic
1179201662 21:39229005-39229027 CTGAATTTTTTCAAAAACAAAGG + Intronic
1180362907 22:11915664-11915686 CAGAAATCTTTCAATAATCATGG - Intergenic
1184051324 22:42007514-42007536 CAGAATTGTTGGGAAAAGTATGG - Intronic
949174449 3:1042159-1042181 CAAAATTGTTACAAAAGACAAGG - Intergenic
951221810 3:20076523-20076545 AAAAAGTTTTTCAAAAAGCACGG - Intronic
951397230 3:22184086-22184108 CAGTAGTGGTACAAAAAGCAAGG + Intronic
954048098 3:47950305-47950327 CAGAACTGGTACAAAAAGTAGGG + Intronic
954480228 3:50792961-50792983 TAGAATTGTTTCAGTAAGAATGG + Intronic
954947542 3:54439682-54439704 CAGGCTTGTGTCATAAAGCATGG + Intronic
954989256 3:54825412-54825434 CAGAATTGTATCTATAAGCAAGG - Intronic
956006143 3:64780454-64780476 CAGAATAGTTTCAGAAGGAATGG - Intergenic
957108273 3:75919589-75919611 CAGAATAGTTTCAGAAGGAATGG + Intronic
957628769 3:82690995-82691017 CATAATTGTGTTCAAAAGCATGG + Intergenic
958154167 3:89731371-89731393 CAGAATTGATTAAAAAAAAATGG + Intergenic
958260933 3:91380302-91380324 TAGAATAGTTTCAGAAAGAATGG + Intergenic
958953480 3:100441393-100441415 CATAATTATTTCAAAAAGTTTGG + Intronic
959921360 3:111871844-111871866 CAGAATTGTACCAAAGAGAAAGG + Intronic
960119414 3:113931986-113932008 CAGAATTGTTTCAAGAGTTAGGG + Intronic
962260594 3:133901007-133901029 TAAAATTTTTTCAAAAAACATGG - Intergenic
962450148 3:135506793-135506815 CACAATTGTTTTAACAGGCAAGG - Intergenic
962702598 3:138014008-138014030 CACATTTTTTTCAAAAAGTAAGG + Intronic
964290374 3:155172123-155172145 CAGAATTATATTAAAAAGAATGG + Exonic
964354733 3:155839853-155839875 CAGAATTGTTTGAACAAGGGAGG + Intronic
964615326 3:158657959-158657981 CAGAAATTTTTCAAAAACTATGG - Intronic
964665058 3:159163011-159163033 CAGAATAGTTTCAGAAGGAATGG - Intronic
965798691 3:172468296-172468318 AAGAATTGGTTCCAAAAGCAGGG - Intergenic
965918093 3:173875691-173875713 CACAACTGTTTAAAAAAGCAGGG - Intronic
966068863 3:175850125-175850147 AAGAACTGCTTCAAATAGCAAGG + Intergenic
966376721 3:179303767-179303789 TATAATTGTTTCAAAATGAAAGG + Intergenic
967284541 3:187855596-187855618 CAGAATTGTTTCAAGTAGACAGG - Intergenic
968391996 4:200775-200797 CATAATTTTTTCAAAAGGAAAGG + Intergenic
971055171 4:22904839-22904861 CAGAAAGGTTTCAAGAGGCAAGG + Intergenic
971417336 4:26444244-26444266 CATATTTTTTTCAAAAAGTATGG + Intergenic
972747811 4:41956745-41956767 CAGATTTGTTTCTTAAAGGAAGG + Exonic
972780776 4:42285376-42285398 CAGAATTGGTGGAAACAGCAAGG - Intergenic
972851014 4:43050919-43050941 AAGAATTGTTTTAAAAGGAATGG + Intergenic
973369294 4:49232635-49232657 CAGAAATCTTTCAATAATCATGG + Intergenic
973391743 4:49562781-49562803 CAGAAATCTTTCAATAATCATGG - Intergenic
974641226 4:64633407-64633429 CAGAATAGTTTCAGAAGGAATGG + Intergenic
975807127 4:78124526-78124548 CAGAATAGTTTCAGAAGGAATGG + Intronic
976062368 4:81143864-81143886 TAGAATTTTTTCAAAATGTAAGG - Intronic
979269592 4:118744361-118744383 CACAATTATTTCACACAGCACGG - Intronic
979656973 4:123206830-123206852 CAGAAATATTTTAAAAAGGATGG - Intronic
979830030 4:125287936-125287958 CTGAATTTTTTTAAAAGGCAGGG + Intergenic
980664619 4:135914838-135914860 CAAAATGCTTTGAAAAAGCAAGG - Intergenic
980842858 4:138287323-138287345 CAGAACTTTTTTAAAAAACATGG - Intergenic
982103085 4:151987761-151987783 CACCATTGTTTCAAAGAGGATGG + Intergenic
982614477 4:157623411-157623433 CAGAATAGTTTCAGAAGGAATGG - Intergenic
982638252 4:157924196-157924218 CAGAATAGTTTCAGAAGGAATGG + Intergenic
982667152 4:158278964-158278986 CAGTATTGTTCCAGGAAGCAGGG - Intergenic
982967931 4:161937874-161937896 CAGGAATATTTCAATAAGCAGGG - Intronic
982993140 4:162305066-162305088 CAGAGTTGTTTAAAAATGCCAGG + Intergenic
983168672 4:164511097-164511119 AAAGATTGTTTCAAAAAGGAGGG + Intergenic
983531358 4:168812960-168812982 CAGCATTCTTTCAAACAGCCTGG - Intronic
984002236 4:174263499-174263521 CTGAATTGTGATAAAAAGCAGGG - Intronic
1202766392 4_GL000008v2_random:152057-152079 CAGAAATCTTTCAATAATCATGG + Intergenic
985514874 5:336681-336703 TAGATTTGTCACAAAAAGCACGG - Intronic
986465815 5:8022490-8022512 CAGAATTTTTGTAAAAAGCAAGG - Intergenic
986879431 5:12152419-12152441 CAGAATAGTTTCAGAAGGAATGG - Intergenic
987104665 5:14626067-14626089 TCCAAATGTTTCAAAAAGCAAGG - Intergenic
987111838 5:14695056-14695078 TAGAACAGTTTCAAAATGCAAGG - Exonic
989997814 5:50856442-50856464 CAAAATTGATTCAAAAAATATGG - Intergenic
990059655 5:51631515-51631537 CAGAATTGTTTTGAAATGTATGG + Intergenic
991131671 5:63129833-63129855 CAGAATTTTTTGAGAAAGGAAGG - Intergenic
992039045 5:72810348-72810370 CAGTTTTTTTTCTAAAAGCATGG - Intergenic
992570040 5:78046112-78046134 GAGAATTGTTTCCAACAACAAGG - Intronic
993308689 5:86300795-86300817 CAGTATTCTTTCAACAAACAAGG + Intergenic
993403793 5:87486166-87486188 CTGAATAGTTTCAGAAAGAATGG + Intergenic
993570620 5:89534295-89534317 AGGAATTCTTTCCAAAAGCATGG - Intergenic
994141761 5:96348958-96348980 AAGAATTGTTTCATAGAGCTGGG + Intergenic
994768315 5:103950752-103950774 AAGAATTACTTCAAAAAACAGGG - Intergenic
995121817 5:108544295-108544317 TATACTTGTTTCAAAAAGCAAGG - Intergenic
995217283 5:109610444-109610466 GAGAATTTTTTTAAAAATCAGGG - Intergenic
995891297 5:116955114-116955136 CAGAATTTTTTTGAAAAGAATGG + Intergenic
995901548 5:117073635-117073657 CAGAATTGTTGGAAAAAATAGGG - Intergenic
995963884 5:117880559-117880581 CAGAATCCTTTAAAAATGCATGG - Intergenic
996696615 5:126404067-126404089 CACAATTGTTTTCAAAAGTATGG - Intronic
996708760 5:126523270-126523292 CAGAATGGCTTCCAAAAGCACGG - Intergenic
996863567 5:128091838-128091860 CAGAATTTTTTTAAAAATTAAGG - Intronic
998074796 5:139226849-139226871 TAGAAATGTTTCCAAATGCATGG - Intronic
998463979 5:142328433-142328455 TAAAATTGTTTCAAAAAGCTGGG + Intergenic
999034515 5:148332588-148332610 GAGAAATATTTCAAAAAGCCTGG - Intronic
1000927327 5:167209783-167209805 AAAAATTATTTTAAAAAGCAAGG + Intergenic
1001512729 5:172335210-172335232 CACAATTGTGTTAATAAGCAGGG + Exonic
1002124059 5:177028623-177028645 CAGAGGTGTTTCAGGAAGCAAGG - Intronic
1002700494 5:181121072-181121094 CTGAGTTGTTCCACAAAGCATGG - Intergenic
1003594590 6:7463005-7463027 CACAACTTTTTTAAAAAGCAAGG + Intergenic
1004293220 6:14387290-14387312 AAGAATTGTATCAAAAATAAAGG - Intergenic
1004532958 6:16471160-16471182 CAGAAGTCTTTCAGATAGCAGGG - Intronic
1004567328 6:16810379-16810401 CAGAATTATTTTAAAATGCCTGG + Intergenic
1004677900 6:17862464-17862486 CAAAATTGTTGCAAAAATGAAGG - Intronic
1004720191 6:18262069-18262091 AAGATTTGTTTAAAAGAGCATGG + Intronic
1005125240 6:22439317-22439339 CAGAGTTGTTTAATAAAGCAGGG + Intergenic
1005131500 6:22513838-22513860 CAGAATTGTTTTGAAAGGCAGGG - Intergenic
1007606814 6:43123474-43123496 CACAATTGTTACAGAGAGCAGGG - Intronic
1008424889 6:51345830-51345852 CAGAATAGTTTCAGGAAGAATGG + Intergenic
1008758562 6:54826778-54826800 AAGACTTGTTTCAAGAAGAATGG + Intergenic
1008907818 6:56698648-56698670 CAGATTTGTTTCAAAACCCCAGG + Intronic
1008977605 6:57446326-57446348 CAGAATAGCTTCAATAAGAAAGG + Intronic
1008994233 6:57639822-57639844 TAGAATAGTTTCAGAAAGAATGG - Intronic
1009182832 6:60538936-60538958 TAGAATCGTTTCAGAAAGAATGG - Intergenic
1009337751 6:62514039-62514061 GAGGAGTGTTTCAAAAAGCCTGG + Intergenic
1009883659 6:69600102-69600124 AAGAATTGCTACAAACAGCATGG - Intergenic
1011062689 6:83289685-83289707 CAGAATAGTTTCAGAAGGAATGG + Intronic
1011537696 6:88394296-88394318 CAGAATAGTTTCAGAAGGAATGG - Intergenic
1011897390 6:92246969-92246991 TGGAATTGTTTCAAAAATGATGG - Intergenic
1012448988 6:99335014-99335036 CTGATTTGTTTTAAAAAGCATGG - Intronic
1013132007 6:107242242-107242264 AATAATTTTTTCAAAAAGAATGG - Intronic
1014154746 6:118097381-118097403 CTGAATTGTTTTAAAAGGAAGGG - Intronic
1014162660 6:118187871-118187893 CAGAGTTGTTTCAAAAATAATGG + Intronic
1014273540 6:119361539-119361561 GAAGACTGTTTCAAAAAGCAGGG - Intergenic
1014301351 6:119685653-119685675 GAGAATTGTTTCTTAAAGCTTGG + Intergenic
1014498578 6:122158013-122158035 TAGAATGGTTTCTAGAAGCATGG - Intergenic
1015150858 6:130035529-130035551 GCAAATTGTTTCACAAAGCAGGG + Intronic
1015351748 6:132227169-132227191 CAGAAGTTTTTCAAATAGAAGGG - Intergenic
1016247994 6:142010166-142010188 CAGAATTGTGTCAAAAGCCATGG + Intergenic
1017228189 6:152043816-152043838 CAGCATTGATTGAAAAAGAATGG - Intronic
1018668299 6:166159716-166159738 CAGACTTGTTTAAAACAGTATGG - Intronic
1018858830 6:167696068-167696090 CAGCAGTGTTTCTCAAAGCATGG - Intergenic
1020765717 7:12317743-12317765 CATAATTTTTTCAAAAAATAAGG + Intergenic
1020966418 7:14875402-14875424 CTTAATTTTTTAAAAAAGCATGG - Intronic
1021422872 7:20465042-20465064 AAAAAGTGTTTCAAAAAGCAGGG - Intergenic
1021749014 7:23776383-23776405 TGGAATTGTTTCAGAAAGAATGG + Intronic
1022147846 7:27564263-27564285 CAGAATTTTTTCCAAACCCAAGG + Intronic
1022205825 7:28162692-28162714 CAGAAGAGTTGCAAAAAGCATGG - Intronic
1022299029 7:29085254-29085276 CACCTTTGTGTCAAAAAGCAAGG + Intronic
1022335122 7:29414878-29414900 CAGGATTGGTCCACAAAGCATGG - Intronic
1023773380 7:43581391-43581413 CAGAATTGTCTTAAAAACTAAGG - Intergenic
1024160133 7:46665378-46665400 ATGAGTTGATTCAAAAAGCATGG + Intergenic
1024265731 7:47605055-47605077 CAGAATTCTTTCAAATAGCATGG + Intergenic
1024322084 7:48080538-48080560 CTGAAGTTTTTAAAAAAGCAGGG + Intergenic
1024880992 7:54085014-54085036 CATATTTATTTCAAAAAGCATGG + Intergenic
1027392035 7:77714205-77714227 CAATAATGTTTCAAAAAGCCAGG - Intronic
1028995074 7:97091064-97091086 CAGAAGTGTTTCAGCAAGCAGGG + Intergenic
1030053824 7:105563926-105563948 CAAAATTGTATAAAAAAGAAAGG + Exonic
1030591161 7:111483640-111483662 CAGTGTTGTTTCCTAAAGCATGG - Intronic
1031001474 7:116420473-116420495 TAAAAATGTTTCTAAAAGCAAGG + Intronic
1031155493 7:118105775-118105797 AATAATACTTTCAAAAAGCAAGG + Intergenic
1031184533 7:118459887-118459909 CAGAATTGTTTCACTTAGAAAGG - Intergenic
1031847922 7:126828265-126828287 TAGAATAGTTTCAGAAAGAATGG + Intronic
1033039654 7:137906212-137906234 CAAAATTCTTGCACAAAGCAGGG - Intronic
1033523750 7:142189132-142189154 CAGAGTTGGTGCAAAAAGAAGGG + Intronic
1033719621 7:144044972-144044994 AAGAAATGTTTCTGAAAGCATGG - Intergenic
1035985929 8:4431944-4431966 CAGTATTGTTTTAAAAGCCACGG + Intronic
1036489048 8:9207551-9207573 CAGAATTGGTTCTAAACTCAAGG + Intergenic
1036975177 8:13403187-13403209 CAGTCTTGTTTCAAACAGCAGGG - Intronic
1036996799 8:13667388-13667410 GAGAATTGTTTCAGAAGGAATGG + Intergenic
1037866268 8:22445617-22445639 CATAATGGTTTCAATCAGCATGG + Intronic
1038378807 8:27072376-27072398 TAAAATAGTTTGAAAAAGCATGG + Intergenic
1039661271 8:39470075-39470097 AACAATTGTTTCAAAAAGATTGG + Intergenic
1039958180 8:42223175-42223197 CATCATTGTTGCCAAAAGCAGGG - Intergenic
1041308948 8:56494560-56494582 CTGAATTGTTTTAAAAAAAATGG + Intergenic
1041356381 8:57005324-57005346 TAAAATTGTTGCAAAAATCAAGG - Intergenic
1042667099 8:71219005-71219027 AAGAGTTTTTTGAAAAAGCAGGG + Intronic
1042918053 8:73894579-73894601 GAGAAGTGTTTCAAAATGCTAGG + Intergenic
1043190265 8:77212472-77212494 CATAATTTTTTTAAAAAACAAGG - Intergenic
1043238882 8:77905720-77905742 CACAATTGTTCCAAAAATCTTGG + Intergenic
1043551177 8:81374844-81374866 CAGAAATTTTCCAGAAAGCAGGG + Intergenic
1044143353 8:88682539-88682561 CAGTATTGTTTAGAACAGCAAGG - Intergenic
1044317481 8:90766623-90766645 CGGACTTGTTTCTAAAAGCATGG - Intronic
1045336404 8:101207106-101207128 CAGAATTGTTTAAACTAGCCAGG + Intergenic
1046090329 8:109496004-109496026 CAGAATTGTTTCAAAATGAAAGG - Intronic
1047813233 8:128433542-128433564 CAGCACTGTTTAAAATAGCAAGG + Intergenic
1048156811 8:131963659-131963681 TGGAATAGTTTCAAAAGGCATGG - Intronic
1048174282 8:132137786-132137808 CAGAAATAATTCAAAATGCAGGG - Intronic
1048211788 8:132460178-132460200 CAGAATGGTTTTAGAAACCAAGG + Intronic
1048345841 8:133573575-133573597 TAGAATTCTATCAAAAACCAAGG - Intergenic
1048836777 8:138526296-138526318 CTGAAATGTTTCAAAATACAAGG - Intergenic
1050816241 9:9816038-9816060 AAGGAATGTTTCAATAAGCATGG + Intronic
1051207863 9:14708456-14708478 TGGAATAGTTTCAGAAAGCATGG + Intergenic
1051250192 9:15151487-15151509 CAGAATGGTTTCACAGAGCAAGG - Intergenic
1052120559 9:24710495-24710517 CAAAATCGTTTCAAAAAACTAGG - Intergenic
1052212792 9:25926955-25926977 GAGTAATGTTTCAAAGAGCATGG - Intergenic
1052537720 9:29768793-29768815 CATAATTGAGTGAAAAAGCATGG - Intergenic
1053376828 9:37614467-37614489 CCGTAGTGTTTCAAAAGGCATGG + Intronic
1053444725 9:38143267-38143289 CAGCATTGAGTGAAAAAGCAAGG - Intergenic
1054855110 9:69891138-69891160 GAGAATTGTTTCACAATACATGG + Intronic
1055214155 9:73837589-73837611 CAGTATTATGTGAAAAAGCAAGG - Intergenic
1055716417 9:79122847-79122869 CACAAATTTTTTAAAAAGCAAGG - Intergenic
1056407343 9:86287353-86287375 AATAATTGTTTAAAAAAGAAGGG + Intergenic
1056524378 9:87429355-87429377 GTGCATTGTTTCACAAAGCATGG + Intergenic
1056914796 9:90736886-90736908 AAGAACTGTTTTAAAAAGCAGGG + Intergenic
1058852231 9:109023973-109023995 CAAAATATTTTCAAAGAGCAAGG - Intronic
1058895250 9:109395327-109395349 CAAAATTTTTACAAAAAGCTAGG + Intronic
1059223632 9:112650750-112650772 CTGGATTTTTTAAAAAAGCAAGG + Intronic
1061740693 9:132703437-132703459 CAGAATTATTTAATATAGCAAGG + Intergenic
1203547147 Un_KI270743v1:136947-136969 CAGAAATCTTTCAATAATCATGG + Intergenic
1186446387 X:9633557-9633579 CATAATAGTGTCAAGAAGCAGGG - Intronic
1187640955 X:21289109-21289131 CAGAACTGTGTCAAATAGGAAGG + Intergenic
1188062261 X:25616287-25616309 CAGAATTGTTTCTAAATTCAGGG + Intergenic
1188167079 X:26874665-26874687 CAGTATAGTTTCAAATAGCTAGG + Intergenic
1188327164 X:28819706-28819728 CAGAATTGTTCCAGAAACCTAGG + Intronic
1188771133 X:34156074-34156096 CAGAATAGTTTCCATAAGAATGG + Intergenic
1189528015 X:41846960-41846982 CAGATTTCTTTCAAAAACCAAGG - Intronic
1189871029 X:45382827-45382849 AAGAATTGTGTTAAAAAGGATGG - Intergenic
1191145417 X:57160393-57160415 TGGAATTGTTTCAAAAGGAATGG + Intergenic
1192115584 X:68407381-68407403 CAGAATTGTTCCAAAACACAAGG + Intronic
1193477552 X:81985180-81985202 CAGAATAGTTTCAGAAGGAATGG - Intergenic
1194020122 X:88678726-88678748 CAGCATTGTTGTAAATAGCATGG + Intergenic
1194650003 X:96503308-96503330 GAGAATTGTTTCTATAAGGAAGG + Intergenic
1195515187 X:105766155-105766177 CAGAATTGCTCCACAAAGTAGGG + Intronic
1195604284 X:106784827-106784849 CAGTATTGTTTAAGAAAGTAGGG + Intronic
1196592077 X:117497161-117497183 TAGAAATTTTTAAAAAAGCAGGG + Intergenic
1196658945 X:118249558-118249580 TAAAGTAGTTTCAAAAAGCAAGG + Intergenic
1197022049 X:121703045-121703067 CTGAATGGATTTAAAAAGCAAGG - Intergenic
1197026744 X:121759899-121759921 TAGTATTCTTTCAAAAAGCATGG + Intergenic
1197039820 X:121923215-121923237 CAGCATTATTTGATAAAGCAAGG - Intergenic
1197960885 X:132004969-132004991 CAGAATTCTTTCAGAATTCATGG - Intergenic
1198591030 X:138182087-138182109 ATGAATTCTGTCAAAAAGCAAGG + Intergenic
1198650695 X:138860777-138860799 CAGCAGCCTTTCAAAAAGCATGG - Intronic
1198789951 X:140334160-140334182 TGGAATTGTTTCAAAAGGAATGG - Intergenic
1198881733 X:141288616-141288638 CAGAAGTTTTTCAAAAGACATGG - Intergenic
1199058302 X:143324381-143324403 CTTAATTGTTTCTAAAAACATGG + Intergenic
1200184525 X:154173572-154173594 CAGAAGTGTTTCAACCAGCCAGG - Intergenic
1200190177 X:154210710-154210732 CAGAAGTGTTTCAACCAGCCAGG - Intergenic
1200195930 X:154248512-154248534 CAGAAGTGTTTCAACCAGCCAGG - Intergenic
1200201584 X:154285630-154285652 CAGAAGTGTTTCAACCAGCCAGG - Intronic
1200758561 Y:7014981-7015003 CATAATAGTGTCAAAAAGCAGGG - Intronic
1200760423 Y:7033421-7033443 TGGAATTGTTTCAGAAAGAATGG - Intronic
1201197174 Y:11505713-11505735 TAGAATTGATTCAAAAGGAATGG + Intergenic
1201210345 Y:11674791-11674813 CAGAATTGACTCAAAAGGAATGG + Intergenic
1201537372 Y:15065629-15065651 CAGAATAGTTTCAGAAGGAATGG + Intergenic
1201740740 Y:17322316-17322338 TAGAATAGTTTCAAAAGGAACGG + Intergenic
1202068484 Y:20965612-20965634 CACAATTGTTTCAGAAGGAATGG - Intergenic