ID: 1127231093

View in Genome Browser
Species Human (GRCh38)
Location 15:56996345-56996367
Sequence GTCAACAATCAGATGGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4057
Summary {0: 1, 1: 28, 2: 517, 3: 1686, 4: 1825}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127231093_1127231096 2 Left 1127231093 15:56996345-56996367 CCTACAACCATCTGATTGTTGAC 0: 1
1: 28
2: 517
3: 1686
4: 1825
Right 1127231096 15:56996370-56996392 AGTCAGTAAAACTAAGCAGTGGG 0: 1
1: 0
2: 2
3: 42
4: 391
1127231093_1127231095 1 Left 1127231093 15:56996345-56996367 CCTACAACCATCTGATTGTTGAC 0: 1
1: 28
2: 517
3: 1686
4: 1825
Right 1127231095 15:56996369-56996391 AAGTCAGTAAAACTAAGCAGTGG 0: 1
1: 0
2: 3
3: 51
4: 457
1127231093_1127231097 3 Left 1127231093 15:56996345-56996367 CCTACAACCATCTGATTGTTGAC 0: 1
1: 28
2: 517
3: 1686
4: 1825
Right 1127231097 15:56996371-56996393 GTCAGTAAAACTAAGCAGTGGGG 0: 1
1: 0
2: 1
3: 35
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127231093 Original CRISPR GTCAACAATCAGATGGTTGT AGG (reversed) Intronic
Too many off-targets to display for this crispr