ID: 1127235587

View in Genome Browser
Species Human (GRCh38)
Location 15:57047696-57047718
Sequence CTGATATTCAAGAGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 450}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127235587 Original CRISPR CTGATATTCAAGAGGAAAAA AGG (reversed) Intronic
902419186 1:16264318-16264340 CTGATATTCGATAGTTAAAAAGG + Intronic
902855971 1:19205347-19205369 ATGATATTGAAGAGGGAGAAGGG - Intronic
904280952 1:29417789-29417811 CTGATTTTCAAGAGAGAAATTGG + Intergenic
904999089 1:34654097-34654119 GTGATGCTCAAGAGGAATAAAGG + Intergenic
905310192 1:37043631-37043653 CTGAAATCCAAGGGGACAAATGG + Intergenic
905408945 1:37755098-37755120 CTCATTTTAAAGAGGATAAAGGG - Intronic
909615191 1:77600763-77600785 TTGAGACTCAAGAGGAAGAAAGG + Intronic
909627694 1:77736513-77736535 CTCATTTTCAACAGGGAAAAAGG + Intronic
909726280 1:78839779-78839801 CTAATAATCAAAAGAAAAAAAGG - Intergenic
909823425 1:80095363-80095385 CTGATAAAAAAGAGGCAAAAAGG - Intergenic
909836303 1:80259840-80259862 CTTTAATTCAAGAAGAAAAATGG + Intergenic
910510839 1:88002177-88002199 TTGATATCCAAGTGGAAAGATGG + Intergenic
910779868 1:90919074-90919096 CTGATTTTAAAAAGAAAAAAAGG + Intronic
910821408 1:91352982-91353004 ATTATTTTTAAGAGGAAAAAAGG - Intronic
911754326 1:101535452-101535474 CTGATTGTCAAGAGGAAATAAGG - Intergenic
914877124 1:151520399-151520421 CTGAGCTTCTAGAGGATAAAAGG - Exonic
915075490 1:153305122-153305144 CTGATCCTCAAAAGGAAAAGGGG + Intronic
916196851 1:162232365-162232387 CTGATCCCCAAGAGGAAAAAAGG - Intronic
916692886 1:167208032-167208054 CTGATCTTCAAAAGGAAAACAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917589212 1:176459753-176459775 CTGAACATCAAGAGGAAAAGAGG - Intergenic
917707494 1:177649040-177649062 ATGATGTTCAAGGGGAAAAATGG + Intergenic
919006403 1:191904210-191904232 CTGATGTGCAGCAGGAAAAATGG + Intergenic
919218128 1:194587793-194587815 ATTATATTCAATAGGAAAATTGG + Intergenic
919227832 1:194730440-194730462 CTACTATTCAAGAGGAAATTTGG + Intergenic
919345736 1:196375623-196375645 CTAATATGAAAGAGAAAAAATGG - Intronic
921263761 1:213405771-213405793 CTCTTATACAAGAGGAAAGATGG - Intergenic
921692937 1:218173535-218173557 CTGATATTGCAGGGGAAAAAAGG - Intergenic
922137286 1:222841898-222841920 CTGAAATATCAGAGGAAAAATGG + Intergenic
922427002 1:225507299-225507321 CTGATATTCAGGTTTAAAAAAGG + Intronic
923844438 1:237713287-237713309 CTTATTTGCAAGAAGAAAAAAGG + Intronic
923975875 1:239261824-239261846 CTGATACTCAACACGAAATAGGG + Intergenic
923982845 1:239345154-239345176 CTGTTATTCATGAGTAAGAATGG - Intergenic
924687415 1:246308615-246308637 ATGATACTTAAGAGGAAGAATGG + Intronic
1063479520 10:6362033-6362055 TTGATATTCCAGAGGAAATCAGG + Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1063840603 10:10067763-10067785 CTGGTCTTTAAGGGGAAAAATGG - Intergenic
1064453934 10:15469265-15469287 ATGAGAGTCAAGATGAAAAAGGG - Intergenic
1064800802 10:19069094-19069116 TTGATATTAAAGGTGAAAAAGGG + Intronic
1065056159 10:21844704-21844726 CTATCATTTAAGAGGAAAAATGG + Intronic
1066151559 10:32625674-32625696 CAGTTATTCACGAGGAATAAAGG - Intronic
1066442569 10:35452121-35452143 CTGGTACTCAACAGCAAAAAAGG - Intronic
1066528209 10:36305830-36305852 CAGTTCTTCAATAGGAAAAAGGG - Intergenic
1066547162 10:36512101-36512123 CTAATATTCTAGAGGAAGAAGGG - Intergenic
1067121999 10:43480935-43480957 ATGATATTCTAGATGAATAAAGG + Intronic
1067190093 10:44061623-44061645 GTGAGATTCAAGGGGAAACATGG - Intergenic
1068564340 10:58555478-58555500 CTGATTATCAAGATCAAAAAAGG + Intronic
1068765230 10:60756078-60756100 ATGTGATTCATGAGGAAAAATGG + Intergenic
1068972768 10:62976941-62976963 CTGATTTGTAAGAGGAAAAGGGG - Intergenic
1069136724 10:64776464-64776486 CTTAGGTTCAAAAGGAAAAAAGG + Intergenic
1069235960 10:66073513-66073535 ATGAAAATCAAGAGGATAAATGG - Intronic
1070712595 10:78693648-78693670 CAGATAGACAAGAGGAAGAAGGG - Intergenic
1071372892 10:84971704-84971726 ATTATATTCAGGAAGAAAAAAGG - Intergenic
1071861273 10:89675216-89675238 CTAAAATTGTAGAGGAAAAAAGG + Intergenic
1073638135 10:105220387-105220409 CTGATACCCAAGAAGATAAAAGG - Intronic
1073665553 10:105529314-105529336 CTCCTATTAAAGAGAAAAAATGG + Intergenic
1075858694 10:125654736-125654758 AGGATATTTAAGGGGAAAAAAGG - Intronic
1075885709 10:125897037-125897059 CTGACATTTTAGAAGAAAAATGG - Intronic
1078264853 11:9747353-9747375 CTGATAATGAAGATGAAGAAAGG - Intronic
1078635212 11:13043209-13043231 CTGGAATTCAGGAGGAGAAATGG + Intergenic
1078870689 11:15341722-15341744 CTGATATTGAAGAGATAAACGGG - Intergenic
1078957080 11:16211142-16211164 ATGAAATTAAAGAGGTAAAAGGG + Intronic
1079012162 11:16837797-16837819 ATGATCTTCACCAGGAAAAAGGG + Intronic
1079543528 11:21605101-21605123 GTGGTATTCAAGAGGAATCAAGG - Intergenic
1080947285 11:36988073-36988095 CTGAAAATCAAGAAGAAAAATGG + Intergenic
1081511912 11:43783358-43783380 ATAATATTTAAGAGTAAAAAGGG - Intronic
1082035043 11:47638571-47638593 GTGTTTTTCAAGAGGAAGAAAGG + Intronic
1083009323 11:59381218-59381240 TTGGTATTCCTGAGGAAAAAAGG - Intergenic
1083110364 11:60400272-60400294 CTGATGCTCAGGTGGAAAAACGG + Intronic
1083506783 11:63165312-63165334 CTGACATTCAAGAGGAGAACTGG + Intronic
1086029146 11:82332672-82332694 CAGAAATTCAAGGGCAAAAAAGG + Intergenic
1086140687 11:83495578-83495600 CTGCTATTAAAGAGGAAGATTGG + Intronic
1086311060 11:85536832-85536854 CAGACAATCAAGAGGAAAAGAGG - Intronic
1087252779 11:95922802-95922824 CTGAACATCAACAGGAAAAAAGG + Intronic
1088002501 11:104899337-104899359 CAGGTGTTCAAGAGGAAGAAGGG - Intergenic
1088210725 11:107453455-107453477 CTGGTATTCAAGATGCAAGATGG - Intronic
1088212274 11:107469895-107469917 CTTATATTCTAGTGGAAAGAAGG + Intergenic
1088566237 11:111175976-111175998 CCCATATTCCAGAGGAGAAATGG - Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1090053870 11:123404971-123404993 CTGATTTTCAGCAGGAAAATGGG + Intergenic
1090469098 11:126963655-126963677 ATGATATCCAAAAGGAAGAAGGG - Intronic
1093314379 12:17629904-17629926 CATAAATTTAAGAGGAAAAAAGG + Intergenic
1093832488 12:23780451-23780473 CTGATATGCATGAAGCAAAAAGG + Intronic
1094630018 12:32164817-32164839 AAGACATTCAAGAGGTAAAATGG + Intronic
1095600452 12:44007292-44007314 CTGATCTTCATAAAGAAAAAAGG - Intronic
1095950404 12:47778603-47778625 CTACTTTTCAAGAGGATAAAAGG - Intronic
1096326980 12:50672115-50672137 CTGATTGTCAAGAAAAAAAAGGG - Intronic
1096765373 12:53883913-53883935 GTGATTTACAAGAGGAGAAAAGG + Intergenic
1097315563 12:58167378-58167400 ATGGCATTCAAGAGGAAAATGGG + Intergenic
1098478885 12:70938783-70938805 CTAATATCCAGGAGGAAAGAGGG - Intergenic
1098709409 12:73736717-73736739 CAGATATGGGAGAGGAAAAATGG - Intergenic
1099293124 12:80797194-80797216 GCGATTTTCAAGAGGAAAACAGG + Exonic
1100215100 12:92439451-92439473 CAGATATTTAAGAGGAGAAATGG + Intergenic
1100677451 12:96882966-96882988 CTGATATAAAAGATAAAAAATGG + Intergenic
1100952495 12:99866980-99867002 CTCTTAAACAAGAGGAAAAAGGG + Intronic
1101746741 12:107547414-107547436 AGGAGATTCAAGAGGGAAAATGG - Intronic
1102729364 12:115094457-115094479 GTGACCTTCAAGAGGAAAGAGGG + Intergenic
1104549468 12:129743258-129743280 CTGCAATTCAAGATGAAAAGTGG - Intronic
1105237156 13:18567894-18567916 CAGACAATCAAGAGGAAAAGAGG + Intergenic
1105329398 13:19401019-19401041 CTGAGAAACAAGAGGAAAACTGG + Intergenic
1105862459 13:24428249-24428271 CTGAGAAACAAGAGGAAAACTGG - Intronic
1107023494 13:35775746-35775768 TAAATTTTCAAGAGGAAAAATGG - Intronic
1107340222 13:39397581-39397603 CTGAGATGCCAGAGGAAAGAGGG - Intronic
1107490468 13:40876381-40876403 CTTATTTTAAAGAAGAAAAAAGG - Intergenic
1107922261 13:45221333-45221355 CTTATATTCTGGAGCAAAAATGG - Intronic
1109285319 13:60401734-60401756 GTGAAATTCAAGAGGTAAGAAGG - Intronic
1109796459 13:67320107-67320129 CTGCAAATCAAGAGGGAAAATGG - Intergenic
1110266611 13:73544534-73544556 CTGATGATAAAGAGGAAAAGAGG - Intergenic
1110560127 13:76902288-76902310 CTGATGGTCAAGAGGAAAGCGGG + Intergenic
1111080986 13:83307403-83307425 GTGATATTCATGGGAAAAAAGGG + Intergenic
1111383003 13:87484300-87484322 CTGACATTTAACAGTAAAAAGGG - Intergenic
1111471585 13:88690387-88690409 CTGGCATTCATGAGGGAAAAAGG + Intergenic
1111741194 13:92207548-92207570 CTGATCCTCCAGAGGAAGAAAGG + Intronic
1112223573 13:97515174-97515196 CTTTAATTCAAGAAGAAAAACGG - Intergenic
1112768249 13:102769542-102769564 CTGGAATTCAAGAGAATAAAGGG + Intronic
1113245495 13:108390379-108390401 ATGATATACATGAAGAAAAATGG - Intergenic
1113259821 13:108549286-108549308 CTGGTTTTGAAGGGGAAAAAGGG + Intergenic
1113542470 13:111119703-111119725 CTGATGTTGCATAGGAAAAAAGG + Intronic
1114336178 14:21692771-21692793 CTCATAAACAAAAGGAAAAAGGG + Intergenic
1114807869 14:25858495-25858517 CTGATTTTTAAGAATAAAAAGGG + Intergenic
1115454089 14:33581242-33581264 CTGATATTTCAGAGGCAAAAAGG + Intronic
1116145129 14:41056954-41056976 ATGTTTGTCAAGAGGAAAAATGG - Intergenic
1116539750 14:46086558-46086580 CTCACATTCAAGAGAAAAGAAGG - Intergenic
1116603749 14:46962705-46962727 CTGATTGTCAAGGGAAAAAATGG + Intronic
1116863627 14:50014142-50014164 CTGATTGTCAAGATGTAAAAGGG + Intergenic
1117363521 14:55001771-55001793 CTGAAATTTTAGAGGAAGAAAGG - Intronic
1117772437 14:59148238-59148260 CAAATATTAAAGATGAAAAAAGG - Intergenic
1119003416 14:70903827-70903849 CTGATATTCACCAATAAAAAGGG + Intergenic
1119146273 14:72317756-72317778 ATGATTTTCAAGAGGAAACTGGG - Intronic
1119816399 14:77572257-77572279 ATGATTTTCAAGAGGAAGATGGG - Intronic
1120078130 14:80183422-80183444 ATGTTTTTCAAGAAGAAAAAAGG + Intergenic
1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG + Intergenic
1121190146 14:92020358-92020380 CTGATATATAAGACAAAAAAGGG + Intronic
1122198167 14:100105304-100105326 CTGAGATTCAAAAGGTGAAAAGG - Intronic
1122432629 14:101665443-101665465 CTGATTTTCAACAGAAATAAAGG - Intergenic
1122879130 14:104682166-104682188 CTGCTATTCTACAGGAGAAAGGG + Intergenic
1124357958 15:29011614-29011636 GATATATTCATGAGGAAAAATGG + Intronic
1124467532 15:29951677-29951699 CTGATAATCATTAGGCAAAAGGG - Intronic
1124874726 15:33581112-33581134 TTGATATTTAAGAGAAAAATAGG + Intronic
1126012903 15:44320265-44320287 TTGATATTCAGTAAGAAAAAAGG - Intronic
1126446798 15:48755809-48755831 CTAAAATTTAAAAGGAAAAAAGG + Intronic
1126583620 15:50262644-50262666 CTGCTTTTCAAGAGCAAGAAGGG - Intronic
1127235587 15:57047696-57047718 CTGATATTCAAGAGGAAAAAAGG - Intronic
1128487573 15:68110086-68110108 GAGATATTCTGGAGGAAAAACGG - Intronic
1130244609 15:82233878-82233900 CTGACATTTTAGAGGAAAAGGGG + Intronic
1130456028 15:84109260-84109282 CTGACATTTTAGAGGAAAATGGG - Intergenic
1130756424 15:86769248-86769270 CTTATATTCCAGAATAAAAATGG - Intronic
1131334483 15:91534807-91534829 TTGCTAGTCAGGAGGAAAAAGGG - Intergenic
1131878806 15:96840234-96840256 CAGTTACTCAAGATGAAAAAAGG + Intergenic
1132405961 15:101542044-101542066 CTGACATCCAAGAGGGAAGATGG - Intergenic
1133650852 16:7813468-7813490 TTGATATTTAATTGGAAAAATGG + Intergenic
1133865778 16:9641793-9641815 CAGAAGCTCAAGAGGAAAAAAGG + Intergenic
1135655560 16:24245576-24245598 ATGGTAAACAAGAGGAAAAATGG - Intergenic
1136265321 16:29113713-29113735 GTGCTCTTCAAGAGAAAAAATGG - Intergenic
1137355176 16:47755582-47755604 CTAACGTTCAAGAGGAAATAGGG - Intergenic
1138053797 16:53811515-53811537 CTGACAGTGAAGAGGAAAGATGG - Intronic
1138297837 16:55901822-55901844 CTGATATATAAGAGGAAAAGAGG - Intronic
1138525840 16:57606847-57606869 CTGAGGTTCAAGACAAAAAAAGG + Intergenic
1139957368 16:70699558-70699580 CTGTTATACAAAAGGCAAAAAGG + Intronic
1141986412 16:87583097-87583119 CTGAGACTCTAGAGGCAAAATGG - Intergenic
1142054126 16:87981645-87981667 GTGCTCTTCAAGAGAAAAAATGG - Intronic
1142423021 16:89984464-89984486 ATGATATTCAACAGTAAACAGGG - Intergenic
1143840973 17:9731471-9731493 CTGAGCTTCCAGAGGAAGAATGG - Intergenic
1144218486 17:13078967-13078989 CTGTTTTTCAAGAGGAAGAAAGG - Intergenic
1146375253 17:32289425-32289447 CTGATTTTCAGGCGGGAAAAAGG - Intronic
1148283970 17:46371997-46372019 CTGAGATTCCAGTGGAGAAATGG + Intergenic
1148306191 17:46589918-46589940 CTGAGATTCCAGTGGAGAAATGG + Intergenic
1148407288 17:47427368-47427390 CTGATATTCTAAAGAAGAAAAGG - Intronic
1148541582 17:48484934-48484956 CAGTTGTTCAAGATGAAAAAAGG - Intergenic
1148730599 17:49833552-49833574 CTTATTTTCAAGAGCAAAAGTGG - Exonic
1148764875 17:50032060-50032082 TGGATATTCATGTGGAAAAAAGG + Intergenic
1148982904 17:51594559-51594581 ATGATATTAAAGAGGAAATAAGG - Intergenic
1150016629 17:61563995-61564017 CTTATTTTAAAGATGAAAAAAGG + Intergenic
1150253828 17:63727449-63727471 CTGTTAATTAAGAGGAAAAAAGG - Intronic
1150254294 17:63731709-63731731 AAGAAATTTAAGAGGAAAAAAGG + Intronic
1150543595 17:66129824-66129846 CTGAAATACAAAAGGGAAAAAGG + Intronic
1153988687 18:10376101-10376123 ATGATATACTGGAGGAAAAAAGG - Intergenic
1155608806 18:27639102-27639124 CTGATATTCATAAGCAACAATGG - Intergenic
1155646137 18:28080076-28080098 CTGATATTCAAAAGAGAAACAGG + Intronic
1155649069 18:28118257-28118279 CAGAAATGCAACAGGAAAAAAGG + Intronic
1155670499 18:28365195-28365217 CTGAAAGTCAAGAGACAAAAGGG - Intergenic
1155677087 18:28441851-28441873 CTTTAATTCAAGAAGAAAAATGG - Intergenic
1155982370 18:32194690-32194712 ATGATATTTAAGGGGAAATAGGG - Intronic
1156783330 18:40878748-40878770 CTGATATTCAACAGTATAACAGG + Intergenic
1156957810 18:42990164-42990186 CTGAGAATCAAGAGGACTAATGG + Intronic
1157518996 18:48332196-48332218 CTGATGTTCAGGGGGAAAAGGGG - Intronic
1158295076 18:55987280-55987302 CAGATACTTAAGAAGAAAAAAGG + Intergenic
1158333780 18:56392303-56392325 ATGAAATTTCAGAGGAAAAAAGG - Intergenic
1159293329 18:66450326-66450348 CTGATTATCAAGAGGAAATTGGG - Intergenic
1162613344 19:11773882-11773904 CCTATATTCAACAGTAAAAAAGG - Intronic
1165524278 19:36339971-36339993 CTGGTAATCAAGTGGAGAAAGGG + Exonic
1166245582 19:41523257-41523279 CTAATATTCAGGTGGAAAACGGG - Intergenic
1166610762 19:44193549-44193571 TTAAAATTGAAGAGGAAAAAAGG - Intergenic
1167030829 19:46958971-46958993 GTGATTCTCCAGAGGAAAAAGGG + Intronic
1167172753 19:47844112-47844134 CTGAAAGGCAAGAGGAAGAATGG - Intergenic
926928113 2:18008799-18008821 CTGGTATTCAAGAGGAAAGCAGG - Intronic
928646718 2:33361561-33361583 CAGATATTCAAGTGAAAACATGG + Intronic
929093567 2:38243137-38243159 CTGACATGGAAGAAGAAAAATGG - Intergenic
929344196 2:40860542-40860564 ATCTTATGCAAGAGGAAAAAAGG + Intergenic
929548613 2:42874937-42874959 GTGATATTCATGAGGAATGAAGG + Intergenic
930010942 2:46938336-46938358 CTGATATTAAGGAAAAAAAAAGG - Intronic
931446509 2:62331460-62331482 CAGGTATTGGAGAGGAAAAATGG + Intergenic
931651123 2:64469875-64469897 GTGATATTAAAGAAGCAAAATGG + Intergenic
933197116 2:79404729-79404751 CTGATAATCTAGTGGAAATATGG + Intronic
933326653 2:80846493-80846515 CTGATATTCAGAAAGAATAAGGG - Intergenic
933617173 2:84494347-84494369 CTGATTTTCAGGAAGCAAAAAGG + Intergenic
935093547 2:99920702-99920724 CAGATAAGCAAGAGAAAAAAAGG + Intronic
936343939 2:111661037-111661059 CTGGGTTTCAAAAGGAAAAATGG - Intergenic
936892626 2:117390199-117390221 GTGATTTTGAAGAGGAGAAATGG + Intergenic
937631692 2:124109196-124109218 CTGATGTCCCAGGGGAAAAAGGG + Intronic
938512622 2:131966620-131966642 CAGACAATCAAGAGGAAAAGAGG - Intergenic
939010083 2:136836362-136836384 CTGACAGTGAAGATGAAAAAAGG - Intronic
939596729 2:144134442-144134464 TTGACATTGAAGAGGGAAAAAGG - Intronic
939647460 2:144718077-144718099 ATGGTATTCAAGATGAAAAGTGG + Intergenic
939717030 2:145596811-145596833 CTGATATTCCTGAGGGCAAAGGG - Intergenic
940453841 2:153872327-153872349 CAGACAATCAAGAGGAAAAGAGG - Intronic
940732679 2:157412002-157412024 CTGGTAATGAAGAGGAAAAAGGG - Intergenic
941286868 2:163625257-163625279 CTTATCATTAAGAGGAAAAATGG + Intronic
942714528 2:178876319-178876341 CTGATTTTCAAAAGGAGGAAAGG + Intronic
943024605 2:182612268-182612290 CAGGTATTCAAGACAAAAAAAGG + Intergenic
943038750 2:182778552-182778574 GTGATATTGAAAAGAAAAAAAGG - Exonic
943237599 2:185342226-185342248 ATCATATTCAAGGGTAAAAATGG + Intergenic
943748054 2:191482911-191482933 CTGAGCTACAAGAGGAAAGATGG + Intergenic
943795558 2:191988590-191988612 CTGACTTTCTAGAGGACAAATGG + Intronic
943946835 2:194076459-194076481 CTTATATGCAAGAGGCAAAGGGG - Intergenic
943964108 2:194309473-194309495 ATGATATTCAAAAGACAAAACGG - Intergenic
945711778 2:213306187-213306209 AATATAATCAAGAGGAAAAAGGG - Intronic
1168910857 20:1445567-1445589 CTGGTATTTAGGAGGAAGAACGG + Intronic
1170070035 20:12357106-12357128 CTTTAATTCAAGAAGAAAAATGG + Intergenic
1170157431 20:13281386-13281408 CTGCTTTCCAAGAGGAAAGACGG + Intronic
1170747699 20:19115415-19115437 CTGAGATTCAAAAGAAAAAGAGG - Intergenic
1170997951 20:21383091-21383113 GTTATCTTCAAGAGGATAAAAGG + Intronic
1171428707 20:25065137-25065159 CTTATAGTCCAGAGGACAAAAGG + Intergenic
1172679332 20:36700188-36700210 ATGATATTCAAAAGTAAAATTGG + Intronic
1173088114 20:39944081-39944103 CTGATCTTCATGAGTAACAAGGG + Intergenic
1173544090 20:43879330-43879352 CTAATATGAAAGAGGAACAAAGG - Intergenic
1173813550 20:45971133-45971155 CTGACAGCCAAGAGGAAACAAGG - Intronic
1176781143 21:13196176-13196198 CAGACAATCAAGAGGAAAAGAGG + Intergenic
1176928292 21:14777796-14777818 ATCATATTCAGAAGGAAAAATGG + Intergenic
1177735991 21:25091095-25091117 CTGCAATTCAAGATGAAATATGG - Intergenic
1177978834 21:27885325-27885347 CAGACAATCAAGAGGAAAAGAGG + Intergenic
1179227987 21:39472849-39472871 TTGACACTGAAGAGGAAAAAGGG - Intronic
1180143135 21:45905090-45905112 CTGATTTTGAAAAGGAAGAATGG - Intronic
1180285737 22:10742573-10742595 CTGACATTTTAGAAGAAAAATGG - Intergenic
1181863364 22:25836301-25836323 CAGAAATTCTAGAGAAAAAAGGG - Intronic
1183312364 22:37117504-37117526 CTGATCTCCAATAAGAAAAATGG + Intergenic
1183852593 22:40603573-40603595 CTGAGATTCAAGGAGACAAACGG + Intronic
1184313157 22:43661766-43661788 CTTATATTAAACAGGAAAGAGGG + Intronic
1185004018 22:48264793-48264815 CTGATATTGAACAGGAAAGGAGG + Intergenic
949097829 3:106963-106985 CTGATATTTAAGTGAATAAAGGG + Intergenic
949774357 3:7614920-7614942 CAGAGATTCAAGAGGAAATGTGG - Intronic
950977737 3:17267362-17267384 CTGACATTGAAGAAGGAAAAAGG - Intronic
951002776 3:17583380-17583402 CTGATAATCAAAAAAAAAAATGG + Intronic
951049714 3:18080475-18080497 CTGATATTGAAAAGTATAAAGGG + Intronic
951062633 3:18227629-18227651 CTGATGTCCAAGATGCAAAATGG + Intronic
951077008 3:18406394-18406416 CTCATATTCAAGAGTAAAATAGG - Intronic
951191000 3:19771480-19771502 TTGATATTTAAAAGAAAAAAAGG - Intergenic
951738140 3:25890605-25890627 CTGAGATTCAGGAAGAAAAAAGG - Intergenic
952987486 3:38799081-38799103 CTGATATTAAGAAGGCAAAAGGG - Intergenic
953991497 3:47487263-47487285 CTTATATACCACAGGAAAAAGGG + Intergenic
954748167 3:52798712-52798734 CTGATCTCCAAGGGGAAAAGCGG + Intronic
955242889 3:57195099-57195121 ATGATATTCAGGGGGAAAATTGG - Intergenic
955605043 3:60692530-60692552 CTGATATTGAAGATGAAAGGGGG + Intronic
956185931 3:66562030-66562052 CTGGTATCCAAGAAGAAAAGAGG + Intergenic
956507439 3:69957642-69957664 CTGATAAAGAAGAGGAAAATGGG - Intronic
957485281 3:80853093-80853115 CTGATTCTCTAGAGGAGAAAAGG + Intergenic
958017793 3:87962238-87962260 GTAATATTCAAGGGGGAAAATGG + Intergenic
958604473 3:96339747-96339769 CTGATATTCAAGATGAGATTTGG - Intergenic
959622326 3:108411766-108411788 CTGCTATTAAACAGAAAAAAAGG + Intronic
959797420 3:110447320-110447342 CAGATAATCAAGAGTTAAAAAGG + Intergenic
959800662 3:110491252-110491274 ATGCTTTTCAAGATGAAAAAAGG - Intergenic
960221502 3:115115651-115115673 CTGTTCTTCAAGAGCAATAATGG - Intronic
960310687 3:116112845-116112867 CTGAGATTCAAAATGTAAAAAGG - Intronic
960435316 3:117619362-117619384 GTCATATTCTAGAGCAAAAAGGG + Intergenic
960767161 3:121145994-121146016 CTGATATTCAAAAGCAGGAAAGG - Intronic
960802555 3:121554139-121554161 TTGATATTTAAGAGAAAAAGTGG + Intergenic
961094349 3:124141838-124141860 CTGAGATTTAATAGGAAAAAGGG - Intronic
962320888 3:134389394-134389416 CTGATTTCCATGAGGAACAATGG + Intergenic
962698429 3:137973576-137973598 CAGATATTCACTAGGAAAAGAGG - Intergenic
962819281 3:139032413-139032435 CTGATTTTGAAAAGGAAGAATGG - Intronic
964729460 3:159849766-159849788 CATATGTTCAAAAGGAAAAAAGG - Intronic
965212834 3:165816922-165816944 CTGAAATTCAAGGGAGAAAAAGG - Intronic
965743644 3:171902619-171902641 CTGAAAATCAATAGGAAAAATGG - Intronic
965992289 3:174833854-174833876 GTGATATTCAATATGATAAATGG - Intronic
965992312 3:174834258-174834280 GTGATATTCAATATGATAAATGG - Intronic
966373119 3:179268850-179268872 CTGCTTTTCCAGAGTAAAAAGGG + Intergenic
966681349 3:182644890-182644912 CTGAAATTCAAAAAGAGAAAGGG + Intergenic
966883988 3:184364795-184364817 CAGATATGCAAGAAGGAAAAGGG - Intronic
969641286 4:8400329-8400351 CAGATATTCAACAGAAAAGACGG + Intronic
969991894 4:11273049-11273071 CTGATGTTCAAGAGGCAGAGAGG - Intergenic
970892611 4:21065128-21065150 CTGACATTAAAGGGGAAGAAAGG - Intronic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
971842700 4:31874662-31874684 CTGATTTTGAAGATGGAAAAAGG - Intergenic
972869964 4:43285837-43285859 CTCAGATTCAAGATGAAAATGGG - Intergenic
973090685 4:46132568-46132590 CTGAAATTCAATGGGAACAATGG + Intergenic
973158669 4:46990431-46990453 CTGTAATTCAAAAGGAAGAAGGG - Intronic
973232043 4:47851446-47851468 CAGCAACTCAAGAGGAAAAAAGG - Intronic
973804436 4:54512197-54512219 TTGGTGTTCAGGAGGAAAAAAGG + Intergenic
974529206 4:63085280-63085302 CTGACATTCCTGAGGAAGAAGGG - Intergenic
975528268 4:75374741-75374763 CTGCTATTCAGAAGAAAAAAGGG + Intergenic
975578751 4:75888366-75888388 CTGATATTCGTGAGGGAAAATGG + Intronic
975881939 4:78920425-78920447 CTCATATTAAAAAGGAAAAAGGG + Exonic
976826282 4:89264015-89264037 CTGATATAGAAGAAGAGAAATGG - Intronic
976962973 4:91002365-91002387 CTGGTATTCCTGAGGAAGAAGGG - Intronic
977397781 4:96492443-96492465 ATAATATTGAAGAGGAAGAAGGG - Intergenic
978017364 4:103761923-103761945 CTGTGATTTAACAGGAAAAATGG + Intergenic
978270307 4:106881509-106881531 GTGATTTTCCACAGGAAAAATGG + Intergenic
978568326 4:110109072-110109094 ATTATATTCAAGATGAATAATGG + Intronic
980604393 4:135070579-135070601 AGGAAATTTAAGAGGAAAAAAGG - Intergenic
980617905 4:135256578-135256600 CTGCTATTCCAGAGGACACAAGG - Intergenic
980712531 4:136589410-136589432 CATATTTTCAAGTGGAAAAAAGG + Intergenic
981183254 4:141770124-141770146 CTGATAGACAAAAGGAAAGAAGG - Intergenic
981665219 4:147216840-147216862 CTAATAGTCAATAGGAACAATGG + Intergenic
981665480 4:147220529-147220551 CTGATACTAAAAAGTAAAAAAGG + Intergenic
982508846 4:156254685-156254707 CTAATCTTCAAGAGAAGAAATGG + Intergenic
982530515 4:156536413-156536435 TTGAGACTCGAGAGGAAAAAAGG - Intergenic
982641033 4:157961097-157961119 CTGATATAAAAGATCAAAAAAGG - Intergenic
982756269 4:159222112-159222134 ATGATGTACAAGAGGAAAGAGGG - Intronic
983706079 4:170661045-170661067 GAGATATTCCAGAGGAATAAAGG + Intergenic
983714231 4:170757184-170757206 CTTTAATTCAAGAAGAAAAATGG - Intergenic
983832090 4:172339887-172339909 CTTTAATTCAAGAAGAAAAATGG - Intronic
983951392 4:173646687-173646709 CTGACACTCAAGAAGAAAACAGG + Intergenic
984592996 4:181637170-181637192 CTAATTTTGCAGAGGAAAAAAGG - Intergenic
984988494 4:185354354-185354376 CTACTGCTCAAGAGGAAAAAAGG - Intronic
986455470 5:7913894-7913916 CTAATATTCAAGGGAGAAAATGG - Intergenic
986540630 5:8840663-8840685 CAGACAATCAAGAGGAAAAGAGG - Intergenic
986810175 5:11349098-11349120 GTGTTATTGAAGAGAAAAAATGG + Intronic
986821259 5:11469249-11469271 CTGATTTCCAGGGGGAAAAAAGG - Intronic
986926107 5:12754063-12754085 CTTTTAATGAAGAGGAAAAAAGG + Intergenic
987184862 5:15406819-15406841 CTGAAACTCAAGAGGAAAATGGG - Intergenic
987242805 5:16017956-16017978 ATGATTCTCAAGAGGAATAAAGG - Intergenic
987627632 5:20423085-20423107 GTGATATTCCAAATGAAAAACGG + Intronic
987810162 5:22824298-22824320 CATATATTTAAGATGAAAAATGG + Intronic
988441786 5:31241998-31242020 CTGATTATCAAGGGGAAATAAGG - Intronic
989089924 5:37719715-37719737 CTGAGATTCCAGAGGAACTAAGG - Intronic
989480401 5:41924804-41924826 CTGATACTCAAGAAAATAAATGG + Intergenic
991154656 5:63417521-63417543 CTGATGTTAAAGAGGCAAGAGGG - Intergenic
991306799 5:65185359-65185381 CCCTTGTTCAAGAGGAAAAATGG - Intronic
991432505 5:66562899-66562921 TTCTTATTTAAGAGGAAAAATGG - Intergenic
992358079 5:76006362-76006384 ATGCTATGTAAGAGGAAAAATGG + Intergenic
992603851 5:78434961-78434983 CTGATTTTTAAAAGGAAATATGG + Intronic
993068933 5:83134161-83134183 CAGACAATCAAGAGGAAAATAGG - Intronic
993090883 5:83424702-83424724 CCCATAGTCAAGAGGAAAACTGG + Intergenic
993152859 5:84182770-84182792 CTGATTTTCAAAAAGTAAAAAGG + Intronic
993726887 5:91379833-91379855 CTGATATTAAACGAGAAAAAGGG + Intronic
994112442 5:96021945-96021967 AAGATATTCAAGGGGAAAGAAGG + Intergenic
994466526 5:100140137-100140159 CTGAGAGCAAAGAGGAAAAAAGG + Intergenic
994757298 5:103810334-103810356 CTGTTATTCAAGTAGAAACATGG - Intergenic
994855029 5:105108838-105108860 TTCATATTCAAGAAAAAAAAAGG + Intergenic
995189622 5:109306873-109306895 TTGATATTCAAGGAGAAACAGGG + Intergenic
995753860 5:115480893-115480915 CTGGTAGTCAAGGTGAAAAAAGG + Intergenic
996137638 5:119864568-119864590 CTGAAATGCAAGAGAAAAAAAGG - Intergenic
996588090 5:125113987-125114009 CTGTCATTCAAGAACAAAAATGG - Intergenic
997077427 5:130696936-130696958 TTGATATAAAAGATGAAAAATGG + Intergenic
997130605 5:131272403-131272425 CTGAAAATGAAGAGGAAAAAAGG - Intronic
998579486 5:143356404-143356426 CTGATTATCAAGAGAAAAATGGG + Intronic
999062317 5:148649290-148649312 CTAATATTCAAGAAGAAGGAAGG + Intronic
999447047 5:151648437-151648459 ATGAGATTCAAGAGAAAAATAGG + Intergenic
999929234 5:156412533-156412555 CTTTTACTCATGAGGAAAAAGGG + Intronic
1000732399 5:164852406-164852428 GTGATTTTCGAGAAGAAAAATGG - Intergenic
1000884504 5:166735815-166735837 CACATTTTAAAGAGGAAAAAAGG - Intergenic
1001081968 5:168673970-168673992 CTGATATTTAAGGGGGAAATTGG - Intronic
1001092940 5:168754900-168754922 CTGATTTTCAAGAGGAAGGCAGG + Intronic
1002594692 5:180314209-180314231 CTCATCCTCAAGAGGAAAATGGG - Intronic
1003007701 6:2397198-2397220 CTGGTAAACAAGAGAAAAAAAGG - Intergenic
1003131339 6:3397692-3397714 TTGATATTAAAGAGTAAAAAGGG - Intronic
1003684010 6:8282755-8282777 CAGACAATCAAGAGGAAAAGAGG - Intergenic
1004075550 6:12341192-12341214 ATGAAATTTAAGAAGAAAAATGG + Intergenic
1004210586 6:13638282-13638304 ATGATATTCAAGAGGAGTAGTGG + Intronic
1005914390 6:30340112-30340134 CTGATGTTCAAAGGGGAAAAGGG - Intronic
1006805571 6:36786569-36786591 CTGATGTTCAAAAGAAAAACAGG + Intronic
1007365466 6:41388823-41388845 GTGATATTCAAGAGGAGAAGGGG - Intergenic
1007739956 6:44004203-44004225 CTGAAACTCAAGATGACAAAAGG - Exonic
1007955374 6:45913394-45913416 CTGTTACTCTAGAGAAAAAATGG + Intronic
1008151695 6:47960277-47960299 CTGATAGAAAAGATGAAAAAGGG + Intronic
1008441775 6:51539981-51540003 CTGATTTCTAAGAGGAATAAAGG - Intergenic
1008756547 6:54802131-54802153 CATATATTTAAAAGGAAAAAAGG - Intergenic
1009362687 6:62834983-62835005 CTAATATTCAGGAGGAAAGAGGG + Intergenic
1009485869 6:64220898-64220920 CCGTAATTCAAGAGAAAAAATGG - Intronic
1010504600 6:76641744-76641766 CAGATATACTAGAAGAAAAAAGG + Intergenic
1010744964 6:79550463-79550485 GTGATAAATAAGAGGAAAAAAGG - Intergenic
1010787639 6:80023177-80023199 CTGATAATTAAGAGTATAAAAGG - Intronic
1010791132 6:80066521-80066543 TTGATATACAAGATGATAAATGG - Intergenic
1011499981 6:87977383-87977405 ATGATATTAAAAAGGAAAGAAGG - Intergenic
1012149062 6:95722577-95722599 ATCATACTCAAGAGGAGAAATGG - Intergenic
1012323323 6:97880025-97880047 CTAAAATTCAAGAAAAAAAAAGG + Intergenic
1012424042 6:99094930-99094952 CTGGAATTCAACAGGAAAATGGG + Intergenic
1013209370 6:107973084-107973106 CTAATACTAAGGAGGAAAAAAGG + Intergenic
1013798002 6:113907382-113907404 CTTAGTTTCAAGAGAAAAAAAGG - Intergenic
1013871521 6:114767613-114767635 GCTATATTCAAAAGGAAAAAAGG - Intergenic
1015191261 6:130475046-130475068 CTGATTATCAAGAGGAAATGGGG - Intergenic
1015333799 6:132011384-132011406 TAGAAGTTCAAGAGGAAAAATGG + Intergenic
1015737581 6:136417193-136417215 CTGATTCTCACAAGGAAAAAGGG + Intronic
1015795633 6:137008270-137008292 ATGATTTTAAAGAAGAAAAAAGG + Intronic
1016088739 6:139948483-139948505 CTTATATTAGAAAGGAAAAAAGG + Intergenic
1016189165 6:141239655-141239677 CTGTTATCCATGAGAAAAAATGG + Intergenic
1016797028 6:148129297-148129319 CTGTTATTCCAGAGGAAAATAGG + Intergenic
1016803067 6:148185899-148185921 GTAATATCCAAGGGGAAAAATGG - Intergenic
1017193921 6:151680721-151680743 CTTATATTCTAGTGGAACAAGGG - Intronic
1020708190 7:11572010-11572032 ATGATATTCCAGAGAAAGAAGGG - Intronic
1020955658 7:14737328-14737350 CTGAGATGCAAGAGGAAATTTGG + Intronic
1021385311 7:20022306-20022328 GAGATATTCATGATGAAAAATGG - Intergenic
1022605400 7:31808761-31808783 ATGATGTTTAAGATGAAAAATGG + Intronic
1022755860 7:33288575-33288597 ATGAAATACAAGAGGAAAAAGGG - Intronic
1023049216 7:36236487-36236509 CAGACAATCAAGAGGAAAAGAGG - Intronic
1023181808 7:37492278-37492300 CAGAGAATCAAGAGGAAAAGAGG - Intergenic
1023238217 7:38113661-38113683 CTGTTAGACCAGAGGAAAAAAGG - Intergenic
1024188957 7:46985762-46985784 CTGAAATCCAACTGGAAAAATGG + Intergenic
1024391024 7:48812670-48812692 CTGATATTTATTAGAAAAAATGG + Intergenic
1024555946 7:50603865-50603887 CTCATTTTAAAGAGGAGAAAAGG - Intronic
1026394880 7:69941312-69941334 CTTGGATTCAAGAGGAAAAGGGG + Intronic
1029861266 7:103574856-103574878 CTGAGATTAAAGAGGAAAATTGG - Intronic
1030151263 7:106407562-106407584 CTGATATTCATGAGAAATTATGG + Intergenic
1030624946 7:111834074-111834096 CTGACATTAAATAGGAAATAAGG - Intronic
1031068387 7:117133954-117133976 ATGAGATTCAGAAGGAAAAATGG - Intronic
1031167201 7:118243659-118243681 GTGATATTGAAGAGCTAAAATGG + Intergenic
1031479714 7:122263939-122263961 CAGGAATTCAAGGGGAAAAAGGG + Intergenic
1031747219 7:125515308-125515330 CTAATTTTTAAAAGGAAAAAAGG - Intergenic
1032594114 7:133222430-133222452 ATGATTCTCAAGAGGAGAAAGGG + Intergenic
1032714324 7:134492008-134492030 CTGAAACTGAAGAGGAAAGAGGG - Intergenic
1033399806 7:141011689-141011711 CTGATATTCAAGCAGGAAAAAGG + Intronic
1033899665 7:146120688-146120710 ATAATATACAAGATGAAAAATGG - Intronic
1034074373 7:148217664-148217686 CTGATATTCATGGAGAGAAATGG - Intronic
1035595518 8:854334-854356 CTTTTATTCAGGAGGCAAAAAGG + Intergenic
1038087722 8:24218342-24218364 CTGACATTCAAAAGGAAGAAAGG + Intergenic
1038482506 8:27911381-27911403 CTGCTTTTCAAGAGAAAACAAGG + Intronic
1039322179 8:36444332-36444354 CTGAATTTCAAGAGGTGAAAGGG - Intergenic
1039771376 8:40690804-40690826 CTAATTTTCAACAGGAAATAAGG + Intronic
1040596600 8:48843894-48843916 CTCATATTGAAGGGGAAAAATGG - Intergenic
1041011833 8:53551331-53551353 CTGATGTCCAACAGGGAAAAGGG - Intergenic
1042474056 8:69225248-69225270 TTGATACTCAAGAGTAAAAAAGG + Intergenic
1042522233 8:69725827-69725849 CTGAAAATCCAGAGGAAACAAGG - Intronic
1042752927 8:72178084-72178106 CTGATTAGCAAGAGGAAATATGG + Intergenic
1043716040 8:83488109-83488131 CTGAATTTCAAAAGGGAAAAGGG + Intergenic
1043802265 8:84624451-84624473 CTGGCATTGAAGATGAAAAAGGG - Intronic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1047159029 8:122355719-122355741 CTGATATTCAAAAGGTAGTATGG - Intergenic
1047175244 8:122534735-122534757 CTTATATTCTAGTGGGAAAAGGG + Intergenic
1047280106 8:123438157-123438179 CTGACATTTAAGAAGATAAAGGG + Intronic
1048305224 8:133279398-133279420 CAGAGATTCAAGAGGAAAAGCGG + Intronic
1048492965 8:134911805-134911827 CTGATTTTCCAGAGGAGAGAAGG + Intergenic
1048746282 8:137617850-137617872 CGGAAATGCAAGAGAAAAAAAGG - Intergenic
1048874717 8:138827825-138827847 CTGATATGCAAGAGGCAGGAGGG - Intronic
1050710163 9:8452491-8452513 CTGAAATTTATCAGGAAAAAAGG - Intronic
1050898275 9:10911144-10911166 CAGACAATCAAGAGGAAAAGAGG - Intergenic
1051850742 9:21504785-21504807 GGGAGATGCAAGAGGAAAAATGG + Intergenic
1051982648 9:23042362-23042384 TTGATATTAAAAAGGAAGAAAGG + Intergenic
1052078198 9:24171280-24171302 CTAATATTCAAAAGGAAATTGGG - Intergenic
1053242900 9:36510908-36510930 CTTATAGTCCAGAGGAAAAAAGG + Intergenic
1053594273 9:39544043-39544065 CTGAATTCCAAGAGGAAAGAGGG - Intergenic
1053611959 9:39722917-39722939 CTGATATACAAAAGGAGTAAAGG + Intergenic
1053852054 9:42299088-42299110 CTGAATTCCAAGAGGAAAGAGGG - Intergenic
1053869997 9:42480912-42480934 CTGATATACAAAAGGAGTAAAGG + Intergenic
1054086295 9:60748238-60748260 CTGATATACAAAAGGAGTAAAGG - Intergenic
1054241560 9:62619476-62619498 CTGATATACAAAAGGAGTAAAGG - Intergenic
1054555686 9:66653999-66654021 CTGATATACAAAAGGAGTAAAGG - Intergenic
1054571980 9:66820915-66820937 CTGAATTCCAAGAGGAAAGAGGG + Intergenic
1054706322 9:68466139-68466161 CTGAAACACAAGAAGAAAAAAGG - Intronic
1055407228 9:75987639-75987661 CTCATGTTTAAGGGGAAAAAGGG + Intronic
1056444707 9:86654536-86654558 CTGATGATCAAGAAAAAAAAAGG - Intergenic
1056645021 9:88403849-88403871 CTGAAATTAAAGGGTAAAAAAGG - Intronic
1057691513 9:97290831-97290853 CTGAGGTTTAAAAGGAAAAAAGG - Intergenic
1057715790 9:97494446-97494468 ATGTTATTTAAGAAGAAAAAAGG - Intronic
1057957125 9:99419246-99419268 CTGAAATACAAAAGGAAATAAGG + Intergenic
1058565778 9:106283579-106283601 CTGATACTCAAGAGCAGTAAGGG - Intergenic
1059918967 9:119136514-119136536 CTGATAATAAAGAGCATAAAAGG + Intergenic
1060577197 9:124707423-124707445 CAGATATTCCAGAGAAATAAAGG - Intronic
1061859949 9:133462862-133462884 CTCATGTGCAAGAGGAGAAACGG + Intronic
1186303139 X:8222522-8222544 CTGATTGTCAAGATGAAAGAGGG - Intergenic
1187277161 X:17826299-17826321 CTGATATGAGAGAGGAAAACTGG - Intronic
1187835876 X:23432124-23432146 CTGTTATTAAAAAGTAAAAAAGG + Intergenic
1188700469 X:33254092-33254114 CAGATATTCAAATGCAAAAATGG - Intronic
1189409802 X:40760141-40760163 CTAATATTCAAGGGGATCAAGGG + Intergenic
1191579669 X:62746360-62746382 GTGATATTCAATTAGAAAAAAGG + Intergenic
1192315544 X:70048563-70048585 CTCAAATTCAAGAGAAAAATGGG + Intronic
1193175116 X:78383890-78383912 CTGATACCCAAGATGCAAAACGG - Intergenic
1194460664 X:94163557-94163579 ATGATTTTCAAGAGGCAAATAGG + Intergenic
1194733077 X:97479076-97479098 CTGATTTTGAAGGGAAAAAAAGG - Intronic
1195512499 X:105733555-105733577 CTGAAATTCAAAGAGAAAAAAGG - Intronic
1197166337 X:123381633-123381655 CTGATATTCAACAGTAAGAGGGG - Intronic
1198007738 X:132515845-132515867 CTGATTTTGAAGATGAATAAGGG - Intergenic
1198122234 X:133605665-133605687 ATGATCTTGAAGAGGAAAAGAGG + Intronic
1198738670 X:139816666-139816688 CAGATATTTAAGAGGAAACAAGG + Intronic
1199009196 X:142739148-142739170 CTGATCATCAAGAGGACATATGG - Intergenic
1199073958 X:143509631-143509653 ATGATATTCCACTGGAAAAAGGG + Intronic
1199092958 X:143712879-143712901 ATGATATTCCACTGGAAAAAGGG + Intronic
1199352893 X:146824623-146824645 CTGAGATTTAAGAGGCAACAAGG + Intergenic
1199437452 X:147828663-147828685 CAGACAATCAAGAGGAAAAGAGG + Intergenic
1201054585 Y:9976005-9976027 CTGTGATTCAGAAGGAAAAAAGG + Intergenic
1201565997 Y:15365987-15366009 GTGATATTTTAAAGGAAAAAGGG + Intergenic
1202602501 Y:26608577-26608599 CTGAGAAACAAGAGGAAAACTGG - Intergenic