ID: 1127236628

View in Genome Browser
Species Human (GRCh38)
Location 15:57059833-57059855
Sequence TTTGATCCACTAGCAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127236628_1127236629 -4 Left 1127236628 15:57059833-57059855 CCAGTTTTTGCTAGTGGATCAAA 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1127236629 15:57059852-57059874 CAAAACCTAGAGATGCCCATAGG 0: 1
1: 0
2: 1
3: 13
4: 122
1127236628_1127236632 6 Left 1127236628 15:57059833-57059855 CCAGTTTTTGCTAGTGGATCAAA 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1127236632 15:57059862-57059884 AGATGCCCATAGGACTCTGGTGG 0: 1
1: 0
2: 1
3: 9
4: 125
1127236628_1127236635 18 Left 1127236628 15:57059833-57059855 CCAGTTTTTGCTAGTGGATCAAA 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1127236635 15:57059874-57059896 GACTCTGGTGGCTTGATGAAAGG 0: 1
1: 0
2: 0
3: 9
4: 143
1127236628_1127236637 29 Left 1127236628 15:57059833-57059855 CCAGTTTTTGCTAGTGGATCAAA 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1127236637 15:57059885-57059907 CTTGATGAAAGGGAAGAAGTAGG 0: 1
1: 0
2: 3
3: 37
4: 407
1127236628_1127236631 3 Left 1127236628 15:57059833-57059855 CCAGTTTTTGCTAGTGGATCAAA 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1127236631 15:57059859-57059881 TAGAGATGCCCATAGGACTCTGG 0: 1
1: 0
2: 1
3: 10
4: 141
1127236628_1127236636 19 Left 1127236628 15:57059833-57059855 CCAGTTTTTGCTAGTGGATCAAA 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1127236636 15:57059875-57059897 ACTCTGGTGGCTTGATGAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127236628 Original CRISPR TTTGATCCACTAGCAAAAAC TGG (reversed) Intronic
903718975 1:25390459-25390481 CTTGAGCAACTAGCAGAAACGGG + Intronic
908617167 1:65934933-65934955 TTTTATCCACTATTAAAAATGGG - Intronic
910382911 1:86648650-86648672 TATGATTCATTAGCAAATACAGG - Intergenic
916624496 1:166540580-166540602 TTTTTTCCACCAGAAAAAACTGG - Intergenic
919002153 1:191846675-191846697 TTTGCTTCACTAGGAAAAAAGGG - Intergenic
919516425 1:198531263-198531285 TTTAATCCAGTGGAAAAAACTGG + Intronic
920706871 1:208257863-208257885 TTTGAACCAAAGGCAAAAACTGG - Intergenic
1067746669 10:48941424-48941446 TTTTATCCACGAGCAAAACAAGG + Intronic
1068269931 10:54708242-54708264 ATTTATCCACAAGAAAAAACTGG - Intronic
1068356340 10:55914142-55914164 TTTGACCCACTAACCAAAAATGG + Intergenic
1069357433 10:67603206-67603228 TTTGCTACATGAGCAAAAACTGG + Intronic
1072833116 10:98680677-98680699 TTTGCTCCATTAGCAAAATATGG + Intronic
1077670558 11:4153522-4153544 TTTTATGCACTTGCTAAAACTGG - Intergenic
1079192913 11:18296558-18296580 TTTGATGCATGATCAAAAACAGG + Intronic
1081076483 11:38680394-38680416 TTTGATATTCTAGCAAAAACTGG + Intergenic
1084932712 11:72569881-72569903 TTTGGTCCCCTTGCAAAAAGGGG - Intergenic
1093757793 12:22871858-22871880 TTTGAACCACTAGTTAAGACTGG - Intergenic
1096938765 12:55316776-55316798 TGTGATCCAATAACAAGAACTGG - Intergenic
1099761378 12:86923939-86923961 ATTCATCCATTAGCAAACACAGG - Intergenic
1099796409 12:87406329-87406351 TCTTATCCACTATCAAGAACTGG - Intergenic
1102488739 12:113276198-113276220 TTTGATCCACAGGGAAAAAATGG + Intronic
1106539874 13:30680821-30680843 ATTAATCCACTTGCAGAAACAGG + Intergenic
1108641418 13:52385862-52385884 TTAGATACACTAACAAATACAGG + Intronic
1110046645 13:70841204-70841226 TTTGATCCCCAAGCAACAGCTGG - Intergenic
1111718049 13:91905591-91905613 TTTGATCCACTTCTTAAAACTGG + Intronic
1112134926 13:96566993-96567015 TATGTTCCATAAGCAAAAACTGG + Intronic
1115586271 14:34816558-34816580 CTTGATCCACTGTAAAAAACAGG + Intronic
1117791583 14:59347696-59347718 AATGATCCACTAGCAACAACCGG - Intronic
1118360484 14:65052642-65052664 TATGATACCCTAGCAAAAACTGG - Intronic
1121963698 14:98285005-98285027 TTTGATTCAGTAAAAAAAACAGG - Intergenic
1125459965 15:39896699-39896721 TTTGATCCACTACCCCACACAGG + Intronic
1127236628 15:57059833-57059855 TTTGATCCACTAGCAAAAACTGG - Intronic
1130692424 15:86095065-86095087 TTTTATCCTCTATCATAAACTGG - Intergenic
1132093513 15:98965194-98965216 TATGCTCCAATAGCAAAATCGGG + Intergenic
1149138797 17:53404301-53404323 TATGTTCCATTAGCCAAAACAGG + Intergenic
1150880939 17:69027096-69027118 GTTCATCCAATAGCAAAACCTGG + Exonic
1155958800 18:31976596-31976618 TTTGAAACACTTGCAAAACCAGG - Intergenic
1157162006 18:45322173-45322195 TTTGATCCAGCTGCAAAAATGGG + Intronic
1158157196 18:54439185-54439207 TGAGATCCACACGCAAAAACTGG - Intergenic
1158241054 18:55378831-55378853 TTGGACGCACTAGCAAGAACAGG + Intronic
1159879726 18:73846854-73846876 TTTGATACACCCTCAAAAACTGG - Intergenic
1165091437 19:33390226-33390248 TTTTTTCCACCAGCAAAAATTGG - Intronic
928833736 2:35518901-35518923 TTTGGTCCACTGGAACAAACAGG + Intergenic
928993252 2:37258016-37258038 TTTGAGCCTCTAGAAAAATCTGG - Intronic
930926602 2:56825559-56825581 TTTGTTCCTCTAGCAAAGTCTGG - Intergenic
930988955 2:57627365-57627387 TTTGTTTAAATAGCAAAAACTGG - Intergenic
931597987 2:63971119-63971141 TTTGCTCCATTACCAATAACTGG + Intronic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
933274259 2:80266889-80266911 CTTGATCCACTTGCAGAATCTGG - Intronic
936663101 2:114564071-114564093 TTTGATACACTTGGAAAAAATGG - Intronic
938401654 2:130997819-130997841 TTTCATCCACTAGAAACACCAGG + Intronic
941723787 2:168839526-168839548 TTTGTTCCAAGAGCAAAAAAAGG + Intronic
942389109 2:175473720-175473742 TTTGATGTATTAGCAACAACTGG - Intergenic
947956781 2:234199143-234199165 TTTGGTCCACTAAGACAAACTGG - Intergenic
949065460 2:241987645-241987667 TCTGATCCACCTGCAAAAGCAGG - Intergenic
1170397927 20:15947911-15947933 TTGGATGCACCAGCAAAAAGTGG - Intronic
1170677232 20:18493792-18493814 TTCAATCCACTAGCAAAACCAGG + Intronic
1171439126 20:25147180-25147202 CTTGATCCACTAGCACTAAGCGG - Intergenic
1176037534 20:63047163-63047185 TATGACCCACTGGGAAAAACTGG - Intergenic
1177058415 21:16338706-16338728 TTTGATAAACAAACAAAAACAGG - Intergenic
1177103641 21:16926313-16926335 TTTGTGCTACTAGCAAAGACAGG + Intergenic
1184371864 22:44087497-44087519 CTTGCTCCACTAGCAGAACCAGG - Intronic
949105171 3:194733-194755 TTTGATACATTATCAAAAGCAGG - Intergenic
950819256 3:15740705-15740727 TATGTTCCATTAGTAAAAACAGG + Intronic
952626745 3:35415038-35415060 TGGGATCTACTAGCAAAAGCTGG - Intergenic
953101010 3:39827793-39827815 TTTCATAGACAAGCAAAAACAGG - Intronic
956128798 3:66036341-66036363 TTTGAACCTCAAGCAAAACCTGG + Intronic
957974963 3:87431471-87431493 TTTTATCCACTAACATAACCAGG + Intergenic
962705972 3:138044996-138045018 TTTGAACCACTAGTCAAAACTGG - Intergenic
964330743 3:155599523-155599545 TTTGATCCACCAGCAATGAGAGG + Intronic
965837690 3:172869376-172869398 TATGAACCACTAAAAAAAACTGG - Intergenic
969451984 4:7279173-7279195 TTTGAACCACCACCAAAAAAGGG - Intronic
970100837 4:12520127-12520149 TTTGTTCAACTAGAAAACACAGG + Intergenic
970521188 4:16885475-16885497 TTTGATCCAGTAAGGAAAACAGG + Intronic
974889362 4:67861181-67861203 TTTGCTACACTAGTGAAAACTGG + Intronic
975571016 4:75817897-75817919 TTTTATCCAATTGCACAAACAGG + Intergenic
976060524 4:81122968-81122990 TTTCATCAAGTAGCAAAAATGGG - Intronic
982080906 4:151788745-151788767 TTTTATCTACTAGGAAAAATTGG + Intergenic
983270806 4:165559565-165559587 TTTAATATACTAGCAAAAATTGG - Intergenic
984220652 4:176970722-176970744 TTGGACCCTCTAGCAAAGACAGG + Intergenic
988211959 5:28215423-28215445 TTTGATCAAATAGCTAACACAGG + Intergenic
990596593 5:57318331-57318353 TTGGATCCACCAGCAAAAGATGG + Intergenic
990669484 5:58112050-58112072 TGTGATACTGTAGCAAAAACAGG - Intergenic
995350504 5:111169679-111169701 TGTGATCCACTAGCACACAGTGG - Intergenic
1000081720 5:157854831-157854853 TTTGAATCACTATCAAAAAAAGG + Intronic
1008692603 6:53997506-53997528 TTAGTTCCACTGGAAAAAACTGG + Intronic
1009192662 6:60648243-60648265 TTTGAGGCACTAGCAGAAACAGG - Intergenic
1012792577 6:103715936-103715958 TTTGGTACACTAGCTACAACAGG + Intergenic
1014812521 6:125902707-125902729 TTTTATGAACTAGCAAAACCAGG + Intronic
1015603368 6:134932413-134932435 TTTGAACGACAAGCAAAGACAGG + Intronic
1015824744 6:137299735-137299757 ATTTATCCACTAGCAAGAAAAGG + Intergenic
1016797615 6:148134535-148134557 TTTGATGTAGTAGTAAAAACCGG - Intergenic
1017856216 6:158351425-158351447 TTTGATTAATTTGCAAAAACGGG - Intronic
1023128405 7:36977806-36977828 ATTTATCCACTTTCAAAAACTGG - Intronic
1026520601 7:71114645-71114667 TTATTTCTACTAGCAAAAACTGG + Intergenic
1027615527 7:80418803-80418825 TTTGATGCACTTACAAAAGCAGG - Intronic
1031440572 7:121789685-121789707 TTTGATATATGAGCAAAAACTGG - Intergenic
1032635176 7:133699192-133699214 TTTGCTCCAGGAGCAAAAAAGGG - Intronic
1038965549 8:32567402-32567424 TTTGATGCATTGGCAAAACCTGG - Intronic
1043657801 8:82693215-82693237 TTTGATCCACTAACAATAACTGG + Intergenic
1045513067 8:102829924-102829946 TTTATTCCAGTAGAAAAAACCGG - Exonic
1046312083 8:112450364-112450386 TTTGATCCACCAGAAAATAGGGG + Intronic
1046816413 8:118588976-118588998 TTTTTCCCACTATCAAAAACAGG + Intronic
1047290492 8:123525334-123525356 CTTGATCCACTAGCACATACGGG + Intronic
1050500679 9:6294769-6294791 TTTGATCAATTAGCAAAATTGGG - Intergenic
1052103327 9:24478706-24478728 TTGGATCCACTTGGATAAACTGG - Intergenic
1059297044 9:113280505-113280527 TATAATCCATTAGCAAAATCTGG + Intronic
1191862863 X:65680061-65680083 TTTGATCCACCACCTACAACTGG - Intronic
1192946751 X:75971340-75971362 TTTTATCCAAGATCAAAAACAGG - Intergenic
1193468235 X:81872016-81872038 ATTGCTCCACTATCATAAACTGG + Intergenic
1198390073 X:136165167-136165189 TTTAATAAACAAGCAAAAACTGG - Intronic
1199734644 X:150674008-150674030 TTTGCTGCATTATCAAAAACAGG - Intergenic